A rapid nucleic acid detection kit for African swine fever virus

Abstract

This invention discloses a rapid nucleic acid detection kit for African swine fever virus (ASFV), belonging to the field of virus detection technology. The kit includes a chain substitution loop-mediated isothermal amplification reaction system and a colloidal gold test strip. Its core lies in a specific primer set designed for the ASFV p72 gene, wherein the inner primer FIP and the oligonucleotide probe Fd pre-form a double-stranded structure. During amplification, the chain substitution activity of DNA polymerase specifically releases the Fd probe, and the released Fd acts as a reporter molecule, binding to the colloidal gold test strip to generate a visible detection signal. This invention combines efficient amplification with simple detection through primer-probe design, enabling direct detection of whole blood, serum, and other samples without nucleic acid extraction. The method can be completed within 40 minutes at 65℃, exhibiting high sensitivity (20 copies / μL) and strong specificity, and the kit demonstrates good stability and strong environmental adaptability.

Description

Technical Field

[0001] This invention belongs to the field of virus detection technology, specifically relating to a rapid nucleic acid detection kit for African swine fever virus. Background Technology

[0002] African swine fever (ASF) is an acute, febrile, and highly contagious animal disease caused by the African swine fever virus (ASFV). Its morbidity and mortality rates can reach 100%, posing a serious threat to the global pig industry. ASFV is characterized by its complex genome structure, strong mutation capacity, and diverse transmission routes. Currently, there is no effective vaccine or treatment; therefore, early and rapid diagnosis is a crucial step in controlling the disease.

[0003] Current ASFV detection technologies mainly include virus isolation, enzyme-linked immunosorbent assay (ELISA), polymerase chain reaction (PCR), and quantitative real-time PCR (qPCR). Among these, qPCR is widely used as a standard method due to its high sensitivity and specificity. However, it relies on sophisticated instruments, professional operators, and specific laboratory environments, resulting in long testing cycles and high costs, making it difficult to promote its application in grassroots settings such as farms and slaughterhouses. Loop-mediated isothermal amplification (LAMP), as an emerging nucleic acid isothermal amplification method, has advantages such as simple operation, rapid efficiency, and low equipment requirements, and has been gradually applied to ASFV detection. However, traditional LAMP methods often rely on turbidity, color changes, or gel electrophoresis for result interpretation, which is susceptible to subjective factors and non-specific amplification interference, and its accuracy needs to be improved.

[0004] Colloidal gold immunochromatographic assay strips, as a mature and visual detection tool, have been widely used for rapid pathogen detection. However, their application in nucleic acid detection still faces challenges such as complex signal transduction, cumbersome labeling steps, and high costs. How to organically combine the high efficiency of LAMP amplification with the intuitiveness and portability of colloidal gold assay strips to establish an integrated detection platform that requires no complex instruments, offers simple result interpretation, and is suitable for on-site use has become an important research direction for rapid ASFV diagnostic technology. Summary of the Invention

[0005] In view of this, the present invention provides an ASFV nucleic acid detection kit based on chain-substituted LAMP coupled with colloidal gold test strips. This kit modifies the structure of the primers within the LAMP to introduce a reporter probe that can be released by chain substitution, achieving efficient coupling between the amplification product and the test strip signal. This avoids interference from non-specific amplification products and significantly improves the accuracy and reliability of the detection. Simultaneously, this method supports direct detection of blood samples, further simplifying the operation process and shortening the detection time, providing strong technical support for rapid on-site screening of ASFV.

[0006] To achieve the above objectives, the technical solution of the present invention is as follows:

[0007] In a first aspect, this invention discloses a rapid nucleic acid detection kit for African swine fever virus, comprising:

[0008] A chain substitution loop-mediated isothermal amplification reaction system is described, wherein the reaction system contains a specific primer set designed for the African swine fever virus p72 gene, wherein the inner primer FIP anneals with an oligonucleotide probe Fd to form a double-stranded structure FD.

[0009] Colloidal gold test strips are used for the visual detection of reaction products of chain substitution ring-mediated isothermal amplification.

[0010] In the amplification reaction, the strand displacement activity of DNA polymerase displaces and releases the probe Fd from the FD double strand. The released Fd probe acts as a reporter molecule and binds to the colloidal gold test strip to generate a visual detection signal.

[0011] Specifically, the inner primer FIP contains F2 and F1c regions, and the sequence of the oligonucleotide probe Fd is complementary to part or all of the sequence of the F1c region in the FIP primer.

[0012] Preferably, the sequence of the oligonucleotide probe Fd is complementary to a portion of the F1c region in the inner primer FIP.

[0013] In some embodiments, the sequence of the inner primer FIP is shown in SEQ ID NO.2, and the sequence of the oligonucleotide probe Fd is shown in SEQ ID NO.8, as detailed below:

[0014] SEQ ID NO.2: CGGACATGTTGTTAACGCCATTTATCCTGAAAGCTTATCT

[0015] CTGC;

[0016] SEQ ID NO. 8: AATGGCGTTAACAACATGTCCGGATAG.

[0017] Specifically, the specific primer set also includes at least one of the inner primer BIP, the outer primers F3 and B3, and the loop primers LF and LB.

[0018] In some embodiments, the sequence of the inner primer BIP is shown in SEQ ID NO.3, the sequence of the outer primer F3 is shown in SEQ ID NO.4, the sequence of the outer primer B3 is shown in SEQ ID NO.5, the sequence of the circular primer LF is shown in SEQ ID NO.6, and the sequence of the circular primer LB is shown in SEQ ID NO.7, as detailed below:

[0019] SEQ ID NO.3 (p72-BIP): CGGTGTTGATGAGGATTTTGATCGGCTCTTAA

[0020] ATGGCCCATTGA;

[0021] SEQ ID NO.4 (p72-F3): GCGTCTGGAAGAGCTGTA;

[0022] SEQ ID NO.5 (p72-B3): ACAATAACCACCACGATGA;

[0023] SEQ ID NO.6 (p72- FL): TGCAGCCTACTCACCAC;

[0024] SEQ ID NO. 7 (p72-BL): GATGTTCCAGGTAGGTTTTAATCCT.

[0025] Specifically, the components and amounts of the chain substitution ring-mediated isothermal amplification reaction system are as follows:

[0026] Specific primer set 2 μL, 10× buffer 2 μL, 8 Units / μL Bst DNA polymerase 0.5-1 μL, 2.5mM dNTP 4.8 μL, 5M betaine 1 μL, test sample 1 μL, and deionized water to make up to 20 μL;

[0027] The molar concentrations of each primer in the specific primer set are as follows: F3 and B3 are both 0.2 μM, FL and BL are both 0.4 µM, BIP is 1.6 µM, and FD and FIP are both 0.8 µM.

[0028] Specifically, the reaction conditions for the kit are: 55-65 ℃ for 40 min.

[0029] Preferably, the optimal reaction conditions for the chain substitution loop-mediated isothermal amplification reaction system include: a molar ratio of FD to FIP of 75:25, 1 μL of Bst DNA polymerase, a reaction temperature of 65 °C, and a 10× buffer containing 25 mM TAPS, 50 mM MKCl, 2 mM MgCl2 and 0.1 mM DTT.

[0030] Specifically, the sample to be tested is whole blood, serum, or tissue sample.

[0031] Secondly, the present invention discloses a primer set for detecting African swine fever virus, characterized in that it contains the nucleotide sequences shown in SEQ ID NO.2-SEQ ID NO.8.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] (1) This invention combines chain substitution LAMP technology with colloidal gold test strip detection to achieve "one-step amplification and one-step color development". The entire detection process can be completed in 40-60 minutes with only a constant temperature device (such as a water bath). It is easy to operate and suitable for any environment.

[0034] (2) This invention modifies the structure of FIP primers to introduce Fd probes, which specifically anchor the detection signal to the Fd reporter molecule released during the target amplification process. The "chain displacement-release" signal transduction mechanism fundamentally ensures that the T line of the test strip will only show color when the specific amplification of the target gene occurs, thereby greatly improving the accuracy and reliability of the detection.

[0035] (3) This invention successfully developed a direct detection technology for spiked blood samples without nucleic acid extraction, achieving "instant detection after collection". This method not only significantly shortens the total detection time, but also effectively prevents nucleic acid loss and contamination by avoiding cumbersome extraction steps, ensuring high sensitivity (20 copies / μL) and accuracy. In addition, the colloidal gold test strip, a key component of the kit, exhibits excellent environmental adaptability, maintaining stable performance under conditions ranging from 4℃ to 37℃ and different humidity levels, ensuring its convenience and reliability in transportation, storage, and on-site use in different regions and seasons in my country. Attached Figure Description

[0036] Figure 1 This is a schematic diagram of the assembly of colloidal gold test strips;

[0037] Figure 2 This is the result of the feasibility verification of the colloidal gold test strip;

[0038] Figure 3(a) shows the LAMP amplification curve of ASFV p72 plasmid, and (b) shows the results of detection of ASFV p72 plasmid by chain substitution LAMP combined with colloidal gold test strip.

[0039] Figure 4 (a) shows the real-time fluorescence amplification curves of ASFV p72 plasmid with different ratios of FD primer sets; (b) shows the gray values ​​of the T line after the LAMP reaction of different ratios of FD primer sets and the inversion of the scan image on the colloidal gold test strip (error bars represent standard deviation, sample number n=3); (c) shows the color development results on the colloidal gold test strip after the LAMP reaction of different ratios of FD primer sets.

[0040] Figure 5 (a) shows the real-time fluorescence amplification curves of ASFV p72 plasmid with different amounts of Bst 2.0 DNA polymerase; (b) shows the gray values ​​of the T line after the LAMP reaction with different amounts of Bst 2.0 DNA polymerase and the inversion of the scan image on the colloidal gold test strip (error bars represent standard deviation, sample number n=3); (c) shows the color development results on the colloidal gold test strip after the LAMP reaction with different amounts of Bst 2.0 DNA polymerase.

[0041] Figure 6 (a) shows the real-time fluorescence amplification curves of ASFV p72 plasmid at different reaction temperatures; (b) shows the gray values ​​of the T line after the LAMP reaction at different reaction temperatures and the inversion of the scan image on the colloidal gold test strip (error bars represent standard deviation, sample number n=3); (c) shows the color development results on the colloidal gold test strip after the LAMP reaction at different reaction temperatures.

[0042] Figure 7 (a) shows the real-time fluorescence amplification curves of ASFV p72 plasmid in different buffers; (b) shows the gray value of the T line after the LAMP reaction in different buffers and the inversion of the scan image on the colloidal gold test strip (error bars represent standard deviation, sample number n=3); (c) shows the color development results on the colloidal gold test strip after the LAMP reaction in different buffers.

[0043] Figure 8 (a) shows the real-time fluorescence amplification curves of LAMP reactions for different targets, and (b) shows the color development results on colloidal gold test strips after LAMP reactions for different targets.

[0044] Figure 9 (a) shows the real-time fluorescence amplification curves of LAMP reactions with different concentrations of ASFV p72 plasmid, and (b) shows the color development results on colloidal gold test strips after LAMP reactions with different concentrations of ASFV p72 plasmid.

[0045] Figure 10This method replaces LAMP-bound colloidal gold test strips to directly detect the results of spiked blood sample test strips.

[0046] Figure 11 Results of colloidal gold test strips for detecting ASFV under different environments were obtained by using chain-replaced LAMP-bound colloidal gold test strips.

[0047] Figure 12 Results of colloidal gold test strips for detecting ASFV at different storage times using chain-substituted LAMP-bound colloidal gold test strips. Detailed Implementation

[0048] Unless otherwise defined, the technical terms used in the following embodiments have the same meanings as commonly understood by those skilled in the art. Unless otherwise specified, the experimental reagents used in the following embodiments are conventional biochemical reagents; and the experimental methods described are conventional methods.

[0049] The present invention will be further illustrated below with reference to the accompanying drawings and examples. It should be noted that the following examples are only for illustrating the present invention and are not intended to limit the present invention. Any non-essential improvements and adjustments made on the basis of the present invention shall fall within the scope of protection claimed by the present invention.

[0050] In this invention, “Copies / μL” represents the number of copies of the target nucleic acid molecule (such as plasmid DNA) detected per microliter (μL) of sample.

[0051] In this invention, the "internal primer FIP contains F2 and F1c regions". FIP is a composite primer composed of two functional sequences. The F2 region is complementary to the F2c region on the target DNA and is responsible for initiating the chain extension reaction of DNA polymerase. The F1c region is complementary to the F1 region on the target DNA and is used to form a circular structure during amplification, thereby realizing subsequent chain substitution and cyclic amplification.

[0052] The glass containers used in the experiments of this invention must be soaked in aqua regia (hydrochloric acid: nitric acid = 3:1) for at least 24 hours before use and thoroughly rinsed with ultrapure water.

[0053] The nucleotide sequences (5'-3') involved in the embodiments of the present invention are shown below:

[0054] SEQ ID NO.1 (partial fragment of ASFV p72 gene):

[0055] GCGTCTGGAAGAGCTGTATCTCTATCCTGAAAGCTTATCTCTGCGTGGTGAGTAGGCTGCATAATGGCGTTAACAACATGTCCGAACTTGTGCCAATCTCGGTGTTGATGAGGATTTTGATCGGAGATGTTCCAGGTAGGTTTTAATCCTATAAACATATATTCAATGGGCCATTTAAGAGCAGACATTAGTTTTTCATCGTGGTGGTTATTGT。

[0056] SEQ ID NO.2 (p72 - FIP): CGGACATGTTGTTAACGCCATTTATCCTGAAA

[0057] GCTTATCTCTGC。

[0058] SEQ ID NO.3 (p72 - BIP): CGGTGTTGATGAGGATTTTGATCGGCTCTTAA

[0059] ATGGCCCATTGA。

[0060] SEQ ID NO.4 (p72 - F3): GCGTCTGGAAGAGCTGTA。

[0061] SEQ ID NO.5 (p72 - B3): ACAATAACCACCACGATGA。

[0062] SEQ ID NO.6 (p72 - FL): TGCAGCCTACTCACCAC。

[0063] SEQ ID NO.7 (p72 - BL): GATGTTCCAGGTAGGTTTTAATCCT。

[0064] SEQ ID NO.8 (Fd - p72): AATGGCGTTAACAACATGTCCGGATAG。

[0065] SEQ ID NO.9 (T - line - p72): CTATCCGGACATGTT。

[0066] SEQ ID NO.10 (C - line - p72): TGGTGAAAAAAAAAA。

[0067] SEQ ID NO.11 (AuNP - p72): TTTTTTTTTTCACCATGTTAACGCCATTAA

[0068] AAAAAAAA.

[0069] Specifically, the 5' end of the SEQ ID NO.9 nucleotide sequence is covalently linked to a biotin tag, and the 3' end of the SEQ ID NO.10 nucleotide sequence is covalently linked to a biotin tag.

[0070] Example 1: Preparation of colloidal gold test strips

[0071] (1) Synthesis of gold nanoparticles: Gold nanoparticles were synthesized using the sodium citrate reduction method. 25 mL of 0.01% chloroauric acid (HAuCl4) solution was heated to boiling, and 1 mL of 1% sodium citrate solution was quickly added. The mixture was refluxed for 15 minutes to obtain a deep red gold nanoparticle solution. After cooling to room temperature, the solution was characterized by ultraviolet spectroscopy and stored at 4 °C in the dark.

[0072] (2) Functionalization of gold nanoparticles: Functionalization was performed using a microwave heating method. 5 μL (100 µM) of AuNP-p72 probe (sequence shown in SEQ ID NO.11) was mixed with 600 μL of concentrated gold nanoparticle solution and heated in a microwave oven on high for 8 minutes. After the reaction, the mixture was resuspended in ultrapure water and centrifuged at 4 °C, 10000 × g for 10 minutes. The resulting precipitate was resuspended in 1 × PBS buffer and stored at 4 °C protected from light.

[0073] (3) Preparation of gold nanoparticles: The functionalized gold nanoparticle solution was uniformly sprayed onto the gold nanoparticles at a rate of 30 µL / cm and dried in a 37 ℃ drying oven for 1 hour.

[0074] (4) NC membrane coating: Probe solutions for the detection line (T line) and control line (C line) were prepared separately. 1 µL (1 mg / mL) of streptavidin (SA) and 6.8 µL of biotinylated C-line-p72 (sequence shown in SEQ ID NO.10) and T-line-p72 probe (100 µM) (sequence shown in SEQ ID NO.9) were incubated at 4 °C for 1 hour to form SA-biotinylated probe complexes. Subsequently, the incubated probe solutions were streaked onto the corresponding positions on the NC membrane at a rate of 0.5 µL / cm, dried at 37 °C for 1 hour at an ambient humidity below 60%, and stored at room temperature in the dark.

[0075] (5) Test strip assembly: Assembly diagram as shown in the figure Figure 1 As shown, the sample pad, gold label pad, NC membrane, and absorbent pad are sequentially overlapped on the base plate, with an overlap of approximately 2 mm between each component. The assembled test strip is then cut into 3 mm wide strips and sealed for storage in a dry, dark environment at room temperature.

[0076] To verify the function of the colloidal gold test strip, a simulated detection experiment was conducted. 2 μL of Fd-p72 probe (1 μM) was mixed with 48 μL of running buffer (10 mM Tris-HCl, 2% DMSO, 0.1% Tween-20, 20 mM MgCl2) to form the positive group. A negative group was also prepared, with only 50 μL of running buffer added. Both solutions were added to the sample application area of ​​the test strip, and the colorimetric results were observed after standing at room temperature for 10 minutes.

[0077] The results are as follows Figure 2 As shown, the test line (T line) and control line (C line) of the positive group test strips are clearly visible; in the negative group, only the C line is visible, and the T line has no visible band. This indicates that the prepared colloidal gold test strips function normally and can specifically recognize the Fd-p72 reporter molecule, and can be used for the detection of subsequent LAMP reaction products.

[0078] Example 2: Design of primer set for LAMP detection of African swine fever virus (ASFV) p72 gene

[0079] Using the nucleic acid sequence with accession number MN886926.1, a LAMP detection primer set targeting the p72 gene of African swine fever virus was designed, and the specific sequence is as follows (5´-3´):

[0080] SEQ ID NO.1 (partial fragment of ASFV p72 gene):

[0081] GCGTCTGGAAGAGCTGTATCTCTATCCTGAAAGCTTATCTCTGCGTGGTGAGTAGGCTGCATAATGGCGTTAACAACATGTCCGAACTTGTGCCAATCTCGGTGTTGATGAGGATTTTGATCGGAGATGTTCCAGGTAGGTTTTAATCCTATAAACATATATTCAATGGGCCATTTAAGAGCAGACATTAGTTTTTCATCGTGGTGGTTATTGT.

[0082] SEQ ID NO.2 (p72-FIP): CGGACATGTTGTTAACGCCATTTATCCTGAAA

[0083] GCTTATCTCTGC.

[0084] SEQ ID NO.3 (p72-BIP): CGGTGTTGATGAGGATTTTGATCGGCTCTTAA

[0085] ATGGCCCATTGA.

[0086] SEQ ID NO. 4 (p72-F3): GCGTCTGGAAGAGCTGTA.

[0087] SEQ ID NO. 5 (p72-B3): ACAATAACCACCACGATGA.

[0088] SEQ ID NO. 6 (p72-FL): TGCAGCCTACTCACCAC.

[0089] SEQ ID NO. 7 (p72-BL): GATGTTCCAGGTAGGTTTTAATCCT.

[0090] SEQ ID NO. 8 (Fd-p72): AATGGCGTTAACAACATGTCCGGATAG.

[0091] Example 3: African Swine Fever Virus (ASFV) p72 Gene LAMP Detection Kit

[0092] 3.1 Detection principle of the kit

[0093] The core principle of this invention lies in coupling chain substitution loop-mediated isothermal amplification (LAMP) with colloidal gold test strip detection. Specifically, a short oligonucleotide probe (Fd) is pre-annealed to the F1c region of the LAMP inner primer (FIP) to form a double-stranded dimer. During LAMP amplification, the FIP primer binds to the target and extends, and the Fd probe is released by the chain substitution activity of DNA polymerase. The released Fd probe acts as a reporter molecule and can be specifically captured on the colloidal gold test strip: one end binds to gold nanoparticles labeled with DNA on the binding pad, and the other end binds to the capture probe fixed to the detection line (T line), resulting in color development of the T line. The test strip control line (C line) performs quality control by capturing the gold nanoparticles themselves. Therefore, simultaneous color development of both the T line and the C line indicates a positive result; color development of only the C line indicates a negative result.

[0094] 3.2 Feasibility Validation of the Reagent Kit

[0095] To evaluate the feasibility of a LAMP-based colloidal gold test strip detection system, LAMP amplification was performed using ASFV p72 plasmid as a template. The reaction system consisted of the following: 2 μL LAMP primer set (10×), 10 μL buffer (10×), 1 μL betaine (5 M), 1 μL ASFV p72 template, 2 μL SYBR (10×), 1 μL Bst 2.0 DNA polymerase (8 U / μL), 4.8 μL dNTP (2.5 mM), and sterile water was added to a final volume of 20 μL. After centrifugation with shaking, the reaction solution was placed in a real-time quantitative PCR instrument to monitor the amplification curve.

[0096] Figure 3 Figure (a) shows that the amplification curve of the ASFV p72 positive group is a typical "S" shape, indicating that the target sequence was successfully amplified; the fluorescence signal of the template-free control group (NTC) remained at the baseline level, and no non-specific amplification was observed. Figure 3 Figure (b) shows that the detection results of the colloidal gold test strip are consistent with the amplification curve. In the positive group, both the T and C lines show color, while in the NTC group, only the C line shows color. In summary, the kit of this invention has good feasibility and reliability, and is suitable for the specific detection of the ASFV p72 plasmid.

[0097] 3.3 Construction of the nucleic acid detection system for the reagent kit

[0098] (1) Chain-substitution LAMP amplification system:

[0099] First, double-stranded FD was formed by annealing 50 µM FIP and 50 µM Fd at 95 °C and then slowly cooling to room temperature. 2 μL of a specific primer set (10×) (0.8 µM FIP and 0.8 µM FD, 1.6 µM BIP, 0.2 µM F3 and B3, 0.4 µM FL and BL), 2 μL of 10× buffer, 1 μL of betaine (5 M), 1 μL of ASFV p72, 0.5–1 μL of LBst 2.0 DNA polymerase (8 U / μL), and 4.8 μL of dNTPs (2.5 mM) were mixed in a 0.2 mL enzyme-free centrifuge tube, and water was added to a total volume of 20 μL. The prepared reaction solution was then placed in a real-time quantitative PCR instrument and amplified at 55–65 °C for 40 minutes.

[0100] The 10× buffer solution consists of:

[0101] Buffer 1: 20 mM Tris-HCl (pH 8.8, 25 °C), 10 mM (NH4)2SO4, 50 mM KCl, 2 mM MgSO4, 0.1% Tween-20;

[0102] Alternatively, Buffer 2: 25 mM TAPS, 50 mM KCl, 2 mM MgCl2 and 0.1 mM DTT.

[0103] (2) Colloidal gold test strip detection:

[0104] Remove the amplified reaction solution and add 30 μL of running buffer (1×) to bring the total volume to 50 μL. Then, drop the reaction solution onto the test strip for detection and observe the color development results.

[0105] 3.4 Validation of optimal conditions for the nucleic acid detection system of the kit

[0106] LAMP primer set: In the LAMP primer system, the ratio of the double-stranded polymerase (FD) formed by FIP and Fd has a crucial impact on reaction performance. If the Fd ratio is too high, most of the FIP will be blocked, inhibiting amplification efficiency and potentially causing false positives on the test strip; if the Fd ratio is too low, non-specific amplification is likely to occur, also resulting in false positives. LAMP amplification and colloidal gold test strip experiments were conducted by setting different ratios of FD and FIP primer sets (positive group) and different ratios of template-free control groups (NTC). The results are as follows: Figure 4 As shown, Figure 4 As shown in (a), when the FD:FIP ratio is 100%, the Fd content is high and the amplification peak time is significantly delayed, indicating a decrease in amplification efficiency. When the FD:FIP ratio is 50%:50%, although the peak time is similar to that of 75%:25%, nonspecific amplification occurs in the negative control group. However, when the FD:FIP ratio is 75%:25%, the amplification efficiency is optimal, and the fluorescence signal in the negative group remains at the baseline level without any nonspecific amplification. Figure 4 Figures (b) and (c) show that only when the FD:FIP ratio is 75%:25% does the positive sample show clear color development, while the negative sample shows no color development. When the FD:FIP ratio is 100%, although no peak appears in the fluorescence curve for the negative group, the test strip may still produce false positives due to the presence of free Fd. In conclusion, an FD:FIP ratio of 75%:25% is determined to be the optimal condition for the LAMP primer system, and subsequent experiments were conducted based on this ratio.

[0107] Bst 2.0 DNA polymerase: Prepare 0.5-1 μL of Bst 2.0 DNA polymerase for LAMP amplification and colloidal gold strip experiments. Results are as follows: Figure 5 As shown, Figure 5 As shown in (a), when the amount of Bst 2.0 DNA polymerase was 1 μL, the LAMP reaction peak time was the earliest and the amplification efficiency was better than that of the 0.8 μL and 0.5 μL groups. Figure 5Figures (b) and (c) show that the results are consistent with those in (a). Figure 1 Therefore, the optimal amount of Bst 2.0 DNA polymerase was determined to be 1 μL, and all subsequent experiments were based on this.

[0108] Reaction temperature: LAMP amplification and colloidal gold test strip experiments were performed at a reaction temperature of 55-65 ℃. Results are as follows: Figure 6 As shown, Figure 6 As shown in (a), the LAMP reaction elutes earliest at 65 °C, followed by 60 °C, while at 55 °C the signal remains close to baseline throughout the reaction, indicating no effective amplification. Furthermore, Figure 6 The results in (b) and (c) show that positive samples in both the 65 ℃ and 60 ℃ groups exhibited both C and T lines, while the 55 ℃ group, similar to the negative control, only showed a C line. In conclusion, 65 ℃ was determined to be the optimal reaction temperature. This condition maintains high polymerase activity while ensuring specific primer binding and efficient amplification, and the system remains stable and reliable. Subsequent experiments were conducted at this temperature.

[0109] Buffer solution: 10× buffer solution components include:

[0110] Buffer 1: 20 mM Tris-HCl (pH 8.8, 25 °C), 10 mM (NH4)2SO4, 50 mM KCl, 2 mM MgSO4, 0.1% Tween-20;

[0111] Buffer 2: 25 mM TAPS, 50 mM KCl, 2 mM MgCl2 and 0.1 mM DTT.

[0112] The results are as follows Figure 7 As shown, Figure 7 As shown in Figure (ac), using "Buffer 2" significantly shortens the elution time for the same ASFV plasmid concentration. Furthermore, the elution effect of the colloidal gold test strip is more pronounced than that of "Buffer 1". Therefore, we consider "Buffer 2" to be the optimal buffer.

[0113] Example 4: Reagent kit specificity detection

[0114] To evaluate the specificity of the kit in detecting the ASFV p72 plasmid, LAMP-bound colloidal gold test strips were used to detect multiple different targets, with the detection conditions following the optimal parameters described in Example 3. These targets included the original detection target ASFV-p72-MN886926.1 and ASFV-p72-MK333180.1, which is also an ASFV p72 sequence, as well as other different viral plasmids such as SARS-CoV-2-N gene, HPV-16, and HPV-18. Results are as follows: Figure 8As shown, only the target ASFV-p72-MN886926.1 showed an "S"-shaped amplification curve and a positive result on the colloidal gold test strip; all other test results were negative.

[0115] Example 5: Reagent Kit Sensitivity Detection

[0116] To evaluate the sensitivity of the kit for detecting ASFV p72 plasmid, a (0.2-2)×10⁻⁶ ohmmeter was used. 3 ASFV-p72 plasmid copies / μL was analyzed using LAMP-bound colloidal gold test strips, with the detection conditions referring to the optimal parameters in Example 3. Results are as follows: Figure 9 As shown, Figure 9 As shown in (a), when the plasmid concentration is below 20 copies / μL, the fluorescence signal remains within the baseline fluctuation range and does not trigger effective amplification. When the concentration reaches or exceeds 20 copies / μL, the amplification curve exhibits a typical "S" shape, and the higher the concentration, the earlier the peak time. Figure 9 As shown in Figure (b), when the plasmid concentration is ≥20 copies / μL, the T line is clearly visible, indicating that the Fd chain was successfully released and captured by the colloidal gold probe; below this concentration, the T line is not visible, consistent with the results of the negative group (NTC). Therefore, the detection limit for the African swine fever virus p72 gene using the LAMP-combined colloidal gold test strip method of this invention is 20 copies / μL.

[0117] Example 6: Practical Application Testing of the Reagent Kit

[0118] To verify the feasibility of the kit in complex biological samples, different concentrations of ASFV p72 plasmid were spiked into blood samples for detection. Figure 10 As shown, in the spiked blood sample testing, after the LAMP amplification products were detected by the colloidal gold test strip, the positive samples (20 copies / μL to 2×10⁻⁶) were... 6 The samples (copies / μL) all showed clear bands at both the C and T lines, while the negative group (NTC) only showed the C line. These results demonstrate that the kit of this invention can effectively detect target nucleic acids in complex blood samples, requires no complex instruments, and operates at a constant temperature throughout, making it suitable for rapid on-site testing.

[0119] Example 7: Reagent Kit Stability Test

[0120] Colloidal gold test strips from the same batch of the kit were placed in incubators at 4 °C, 25 °C, and 37 °C, respectively, using 20 copies / μL of ASFV p72 plasmid as the target. After the LAMP reaction was complete, the reaction solution was added dropwise at the above three temperatures. Figure 11As shown, the physical properties, detection sensitivity, and specificity of the colloidal gold test strip remained stable under different temperatures and high humidity conditions (such as 70% relative humidity), with no significant changes observed. This indicates that it has good environmental adaptability and can meet the requirements for on-site storage and use under different regional climate conditions in my country.

[0121] Three batches of test strips were sealed and stored at 25 °C, and tested using simulated Fd chain products at weeks 1, 3, and 5. The results showed... Figure 12 As shown, the test strips stored for one week, three weeks, and five weeks exhibit clear detection and control lines with no background interference, maintaining good performance and demonstrating reliable short-term stability under normal conditions.

Claims

1. A rapid nucleic acid detection kit for African swine fever virus, characterized in that, include: A chain substitution loop-mediated isothermal amplification reaction system is described, wherein the reaction system contains a specific primer set designed for the African swine fever virus p72 gene, wherein the inner primer FIP anneals with an oligonucleotide probe Fd to form a double-stranded structure FD. Colloidal gold test strips are used for the visual detection of reaction products of chain substitution ring-mediated isothermal amplification. In the amplification reaction, the strand displacement activity of DNA polymerase displaces and releases the probe Fd from the FD double strand. The released Fd probe acts as a reporter molecule and binds to the colloidal gold test strip to generate a visual detection signal. The molar ratio of FD to FIP in the chain-substituted ring-mediated isothermal amplification reaction system is 75:

25. The sequence of the inner primer FIP is shown in SEQ ID NO.2, and the sequence of the oligonucleotide probe Fd is shown in SEQ ID NO.8, as detailed below: SEQ ID NO.2: CGGACATGTTGTTAACGCCATTTATCCTGAAAGCTTATCT CTGC; SEQ ID NO.8: AATGGCGTTAACAACATGTCCGGATAG; The specific primer set further includes inner primer BIP, outer primers F3 and B3, and loop primers LF and LB; the sequence of inner primer BIP is shown in SEQ ID NO.3, the sequence of outer primer F3 is shown in SEQ ID NO.4, the sequence of outer primer B3 is shown in SEQ ID NO.5, the sequence of loop primer LF is shown in SEQ ID NO.6, and the sequence of loop primer LB is shown in SEQ ID NO.7, as detailed below: SEQ ID NO.3 (p72-BIP): CGGTGTTGATGAGGATTTTGATCGGCTCTTAA ATGGCCCATTGA; SEQ ID NO.4 (p72-F3): GCGTCTGGAAGAGCTGTA; SEQ ID NO.5 (p72-B3): ACAATAACCACCACGATGA; SEQ ID NO.6 (p72- FL): TGCAGCCTACTCACCAC; SEQ ID NO. 7 (p72-BL): GATGTTCCAGGTAGGTTTTAATCCT.

2. The reagent kit according to claim 1, characterized in that, The components and amounts of the chain substitution ring-mediated isothermal amplification reaction system are as follows: Specific primer set 2 μL, 10× buffer 2 μL, 8 Units / μL Bst DNA polymerase 0.5-1 μL, 2.5 mM dNTP 4.8 μL, 5 M betaine 1 μL, test sample 1 μL, and deionized water to make up to 20 μL. The molar concentrations of each primer in the specific primer set are as follows: F3 and B3 are both 0.2 μM, FL and BL are both 0.4 µM, BIP is 1.6 µM, and FD and FIP are both 0.8 µM.

3. The reagent kit according to claim 2, characterized in that, The reaction conditions of the chain substitution loop-mediated isothermal amplification reaction system include: 1 μL of Bst DNA polymerase, a reaction temperature of 65 °C, and a 10× buffer containing 25 mM TAPS, 50 mM KCl, 2 mM MgCl2, and 0.1 mM DTT.

4. The reagent kit according to claim 2, characterized in that, The sample to be tested is whole blood, serum, or tissue sample.

Images