High gph content fish collagen peptide, functional food and method for preparing same using collagenase colg

Abstract

The application provides a fish collagen peptide with high GPH content, a functional food and a method for preparing the fish collagen peptide by using collagenase colG. The method comprises the following steps: a) homogenizing fish scales; b) performing first-step enzymolysis on the homogenate by using alkaline protease; and c) performing second-step enzymolysis on the homogenate by using collagenase colG. The process parameters of the first-step enzymolysis are as follows: the pH is 8-10, the enzymolysis temperature is 45-55 DEG C, the dosage of alkaline protease is 0.5-2% of the mass of the fish scales, and the enzymolysis time is 0.5-3 h. The process parameters of the second-step enzymolysis are as follows: the pH is 7-8, the enzymolysis temperature is 35-45 DEG C, the dosage of collagenase colG is 1-2.5% of the mass of the fish scales, and the enzymolysis time is 4-8 h. The content of the characteristic fragment Gly-Pro-Hyp in the fish collagen peptide prepared by the method can be up to 6.1%.

Description

Technical Field

[0001] This invention relates to a high GPH content fish collagen peptide, a functional food, and a method for preparing it using collagenase colG, belonging to the fields of bioengineering and food processing technology. Background Technology

[0002] Collagen is composed of amino acids and its unique triple helix structure, a special structure that determines its irreplaceable value and function compared to other proteins. Collagen has many uses, varying depending on the required molecular weight. Currently, small-molecule collagen is widely used, such as in cosmetics and food additives. However, the superhelical structure of collagen is extremely unique, making it difficult for ordinary proteases to degrade it, resulting in significant challenges in obtaining collagen peptide fragments. Research has revealed that bacterial collagenases derived from microorganisms can achieve this. Microbial collagenases are primarily derived from bacteria. With further research, more and more collagenase-producing strains have been isolated and screened. The structure and properties of collagenases from different sources vary greatly, and currently, only a few strains are capable of industrial-scale collagenase production. Commercially available microbial collagenases are derived from Clostridium histolytica, but the pathogenicity of these strains limits their industrial application, especially in the food industry.

[0003] BioSpecifics, the original research company, purified AUX-I and AUX-II from the fermentation supernatant by culturing Clostridium histolyticum. However, Clostridium histolyticum itself is a pathogenic bacterium causing gas gangrene, and its fermentation supernatant often contains various toxins and has a complex composition. Without the original research company's strains and production and purification processes, it is difficult to guarantee that it meets food standards. Bacillus subtilis is a non-pathogenic bacterium that does not produce endotoxins during metabolism. It is recognized as a food-grade safe strain, with advantages such as rapid growth rate, short culture cycle, low nutritional requirements, strong resistance, low culture cost, and high protein secretion capacity. It is widely used in fermentation, food, and agriculture. Therefore, Bacillus subtilis is an excellent strain for collagenase production, and how to utilize Bacillus subtilis for industrial-scale collagenase production is a research topic for those skilled in the art.

[0004] Collagen hydrolysate is a well-known dietary supplement used to treat skin aging. Studies have shown that oral administration of collagen hydrolysate leads to increased levels of collagen-derived peptides in the blood, particularly small collagen-derived peptides such as Gly-Pro-Hyp (GPH) and Pro-Hyp (PH), which play roles in various physiological functions. Research has also shown that, compared to high molecular weight collagen peptides (H-CP), oral administration of connective tissue to rats resulted in better absorption of Hyp-containing peptides (i.e., GPH and PH) and higher plasma levels.

[0005] However, the collagen tripeptide (GTP) prepared by existing enzymatic hydrolysis methods has a low Gly-Pro-Hyp (GPH) content, which cannot meet the needs of practical applications. Summary of the Invention

[0006] This invention provides a high-GPH content fish collagen peptide, a functional food, and a method for preparing the same using collagenase colG, which can effectively solve the above-mentioned problems.

[0007] This invention provides a method for preparing fish collagen peptides, comprising the following steps:

[0008] a) Homogenize the fish scales;

[0009] b) Perform the first enzymatic hydrolysis of the homogenate using alkaline protease;

[0010] c) The homogenate was subjected to a second enzymatic hydrolysis using collagenase colG.

[0011] In some embodiments, the process parameters for the first step of enzymatic hydrolysis are: pH 8-10, hydrolysis temperature 45-55℃, alkaline protease dosage 0.5-2% of the fish scale mass, and hydrolysis time 0.5-3h.

[0012] In some embodiments, the process parameters for the second enzymatic hydrolysis step are: pH 7-8, hydrolysis temperature 35-45℃, collagenase colG dosage 1-2.5% of the fish scale mass, and hydrolysis time 4-8h.

[0013] In some embodiments, the first enzymatic hydrolysis is followed by a step of heating to inactivate the alkaline protease; the second enzymatic hydrolysis is followed by a step of heating to inactivate the collagenase colG.

[0014] In some embodiments, the inactivation parameters are: heating to 90°C and holding for 30 minutes to inactivate the enzyme.

[0015] In some embodiments, the method further includes, after step c), impurity removal, filtration, and spray drying steps.

[0016] In some embodiments, the collagenase colG is expressed by a recombinant Bacillus subtilis strain capable of producing Clostridium histolytica-derived collagenase colG, the coding sequence of which is shown in SEQ ID NO:1.

[0017] In some embodiments, the strain contains the colG expression vector pP43NMK or pHT01.

[0018] The present invention also provides a fish collagen peptide, which is prepared by the above method.

[0019] In some embodiments, the fish collagen peptide contains 6.1% of the characteristic fragment Gly-Pro-Hyp.

[0020] The present invention also provides a functional food comprising the above-mentioned fish collagen peptide.

[0021] The beneficial effects of this invention are:

[0022] This invention constructs a recombinant Bacillus subtilis strain that can secrete and express collagenase colG, and for the first time uses collagenase colG to prepare fish collagen peptides. After optimization of the preparation process, the content of the characteristic fragment Gly-Pro-Hyp in the prepared fish collagen peptides can reach up to 6.1%. While ensuring high GPH content, the fish scale utilization rate can reach 92%, which has the potential for large-scale production and application. Attached Figure Description

[0023] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation of the scope. For those skilled in the art, other related drawings can be obtained from these drawings without creative effort.

[0024] Figure 1 This is an SDS-PAGE protein electrophoresis image of the fermentation supernatant of recombinant Bacillus subtilis;

[0025] Figure 2 A small-scale experiment on the enzymatic hydrolysis of fish scales by collagenase colG;

[0026] Figure 3 Optimize the enzymatic hydrolysis time of collagenase colG on fish scales;

[0027] Figure 4 To optimize the ratio of collagenase colG to fish scale mass;

[0028] Figure 5 Comparison of GPH content in different enzymatically hydrolyzed samples;

[0029] Figure 6 Optimize the enzymatic hydrolysis time of alkaline protease in the complex enzymatic hydrolysis of fish scales;

[0030] Figure 7 The chromatogram for detecting the content of Gly-Pro-Hyp, a characteristic fragment of fish collagen peptide, is shown below. The horizontal axis represents the retention time (RT) of the target analyte, and the vertical axis represents the absorbance of the target analyte.

[0031] Figure 8 A small-scale enzymatic hydrolysis experiment was conducted using a complex of collagenase colG and alkaline protease 37071.

[0032] Figure 9 The effect of the order of adding collagenase colG and alkaline protease on GPH content is shown in the chromatogram for the detection of Gly-Pro-Hyp content. The horizontal axis represents the retention time (RT) of the target analyte, and the vertical axis represents the absorbance of the target analyte.

[0033] Figure 10 The image shows the enzyme activity verification diagram of the fermentation supernatant of the colG gene recombinant strain and the chromatogram for the detection of Gly-Pro-Hyp content. The horizontal axis represents the retention time (RT) of the target analyte, and the vertical axis represents the absorbance of the target analyte. Detailed Implementation

[0034] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Therefore, the following detailed description of the embodiments of the present invention provided in the accompanying drawings is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments of the invention.

[0035] The culture medium formulations involved in the embodiments of this invention are as follows, where % refers to mass percentage:

[0036] LB liquid medium: 1% tryptone, 0.5% yeast extract, 1% NaCl;

[0037] LB solid medium: 1% tryptone, 0.5% yeast extract, 1% NaCl, 1.8% agar powder.

[0038] Example 1: Cloning of the collagenase gene colG

[0039] The *Clostridium histolytica* genome collagenase *colG* gene sequence (ID: AB026889) was obtained from the GenBank database, synthesized by GenScript Biotech, and embedded in the pPICαA vector. Its nucleotide sequence is shown in SEQ ID NO:1, and its amino acid sequence is shown in SEQ ID NO:2. Using pPICαA-colG as a template, the *colG* gene fragment was amplified using primers GF and GR.

[0040] colG nucleotide sequence (SEQ ID NO:1)

[0041]

[0042] Collagenase colG amino acid sequence (SEQ ID NO:2)

[0043]

[0044] GF:tttgtaacacatgcctcagctaaaccaatagaaaatactaatgatact (SEQ ID NO: 3)

[0045] GR: gaccatgattacgccaagctttcagtggtggtggtggtggtgtttatttacccttaactcatagtttc (SEQ ID NO: 4)

[0046] PCR conditions were: 95℃ for 2 min; 95℃ for 15 s, 60℃ for 15 s, 72℃ for 2 min, 35 cycles; 72℃ for 5 min. PCR amplification products were recovered using a gel extraction kit.

[0047] Example 2: Construction of recombinant plasmids

[0048] (1) Preparation of linearized vector: The vector is pP43NMK. A suitable cloning site was selected and the linearized vector was prepared by reverse PCR amplification.

[0049] (2) Primer design for a single insert fragment: By introducing a 20bp linearized vector terminal homologous sequence into the 5' end of the forward and reverse PCR primers of the insert fragment, the 5' and 3' ends of the insert fragment PCR product are respectively equipped with sequences that are completely identical to the two ends of the linearized vector;

[0050] (3) Amplification of the ColG gene fragment: Design appropriate primers and use commercial high-fidelity enzymes for amplification;

[0051] (4) Homologous recombination: Add homologous recombinase, buffer, ColG gene fragment and linearized vector according to the instructions of commercial homologous recombinase to carry out recombination reaction;

[0052] (5) Transformation: The host for plasmid construction was *E. coli* DH5α competent cells. The specific steps were as follows: *E. coli* glycerol bacteria were taken out of the -80°C freezer and streaked on LB agar plates for activation. A single colony was picked and inoculated into 5 mL of LB medium and cultured overnight at 37°C and 200 r / min. With an inoculum volume of 2%, 2 mL of bacterial solution was transferred to a conical flask containing 100 mL of LB medium and cultured at 37°C for 1-2 h until the OD600 reached 0.4-0.6. Then, the flask was removed from the shaker and placed on ice for 20 min. The sterilized cells were then... Place 50 mL centrifuge tubes, E. coli washing buffer, and E. coli resuspension on ice for 20 min. Centrifuge at 4000 rpm for 10 min at 4°C. Remove the supernatant in a clean bench. Resuspend the bacterial culture with 30-40 mL of E. coli washing buffer. Centrifuge under the same conditions for 10 min, repeating twice. Add 2 mL of pre-cooled E. coli resuspension to the centrifuge tubes to resuspend the bacterial pellet. Aliquot the resuspended bacterial culture into 1.5 mL centrifuge tubes, 80 μL per tube.

[0053] (6) Ligation and heat shock: 10 μL of ligation system was added to 80 μL of competent cells and placed in an ice bath for 20 min; then heat shock was performed in a 42℃ water bath for 90 s and then quickly placed in an ice bath for 2 min.

[0054] (7) Resuscitation and plating: Add 500 mL of LB medium and revive at 37°C and 200 r / min for 1 h. After revival, centrifuge and retain about 100 μL of supernatant to resuspend the bacterial cells. Spread the cells on LB solid plates containing the corresponding resistance and incubate at 37°C for 12 h.

[0055] (8) Plasmid extraction: The recombinant plasmid pP43NMK-colG constructed in Escherichia coli was extracted according to the instructions of the plasmid medium-quantity extraction kit (Beyotime Biotechnology Co., Ltd.) and stored at -20℃ for later use.

[0056] Example 3: Preparation and transformation of Bacillus subtilis competent cells

[0057] A single colony of Bacillus subtilis 168 was picked and cultured overnight at 37°C and 250 rpm in 5 mL LB medium. 100 μL of the above bacterial culture was then added to 5 mL SPI medium and cultured at 37°C and 250 rpm until the end of the logarithmic growth phase (approximately 4-5 hours). 200 μL of the bacterial culture was then added to 2 mL SPII medium and cultured at 37°C and 100 rpm for 90 minutes. 20 μL of 10 mL MEGTA was added, and the culture was further incubated at 37°C and 250 rpm for 10 minutes. The culture was then aliquoted into 0.5 mL tubes, and 10 μL of the ligation product was added. The tubes were then cultured at 37°C and 100 rpm for 90 minutes. The culture was then spread onto LB plates containing the corresponding antibiotic and cultured overnight. Single colonies were picked for PCR verification, yielding Bacillus subtilis with collagenase colG secretion ability.

[0058] Example 4: Shake-flask verification of recombinant engineered bacteria

[0059] The recombinant bacteria obtained in Example 3 were activated and cultured in 50 mL / 250 mL shake flasks of LB medium supplemented with the corresponding antibiotic at 37°C and 200 rpm for 12 h. This activated seed culture was then transferred at a 1% inoculum to 500 mL of liquid TB medium containing the corresponding antibiotic for fermentation at 37°C and 200 rpm for 24 h. A control without the colG gene empty vector was used. The supernatant was collected during fermentation and SDS-PAGE electrophoresis was performed to verify the fermentation results. The results are as follows: Figure 1 As shown, the recombinant strain ( Figure 1 The right lane showed a clear target band at the corresponding molecular weight position (the theoretical molecular weight of colG is approximately 114 kDa), while the empty control ( Figure 1 The middle lane did not have it, proving that colG was successfully expressed and secreted in Bacillus subtilis.

[0060] Activity verification: 1 mL of the fermentation supernatant of the above-mentioned recombinant strain containing the colG gene was added to 5 g of fish scale homogenate. After enzymatic hydrolysis at 35℃ for 8 h, the enzyme was inactivated in a 90℃ water bath for 10 min. The supernatant was collected by centrifugation at 8000 rpm. The GPH content of the enzymatic hydrolysis supernatant was determined according to the GPH content detection method in Example 5. The fermentation supernatant of the strain without the colG gene empty vector was used as a control (CK). The results are as follows: Figure 10 As shown, the enzymatic hydrolysis product (represented by colG in the figure) obtained by enzymatic hydrolysis of fish scales in the fermentation supernatant containing the colG gene has a GPH characteristic peak, while the empty vector control (CK) does not, indicating that the collagenase colG expressed by the recombinant strain has collagenase activity.

[0061] Preparation of collagenase colG enzyme powder: Collect the fermentation supernatant of the above recombinant strain, 7000 rpm

[0062] Centrifuge for 20 min to obtain sterile supernatant, concentrate by 4 times using ultrafiltration (8kDa cutoff) to increase the density of active ingredients. Freeze-drying process parameters: pre-freeze at -40℃ for 5 h, vacuum dry at -20℃ for 16 h, vacuum dry at 25℃ for 5 h, quickly grind into powder after freeze-drying, and store at 4℃.

[0063] Example 5: Process for preparing fish collagen peptides by enzymatic hydrolysis of fish scales with collagenase colG (effect of hydrolysis time on the GPH content of the product)

[0064] (1) Cleaning: Soak the degreased fish scales in clean water and wash them 3 times to remove excess water.

[0065] (2) Fish scale homogenization treatment: fish scales and water are mixed at a ratio of 1:9, and then the mixture is heated in a 90℃ water bath for 1 hour and then homogenized.

[0066] (3) Enzymatic hydrolysis: The fish scale homogenate obtained in step (2) was heated to 35°C and the pH was adjusted to 7.5 with sodium hydroxide. Collagenase colG (using collagenase colG enzyme powder from Example 4) was added at a ratio of 1 / 60 of collagenase colG / fish scale homogenate mass and hydrolyzed for 0-24 hours. During the hydrolysis process, the pH was maintained at 7.5 and the temperature at 35°C, and the stirring speed was 100 r / min.

[0067] (4) Inactivation of enzyme: Heat the enzyme hydrolysate obtained in step (3) to 90°C and keep it for 30 minutes to inactivate the enzyme.

[0068] (5) Detect the content of the enzymatic hydrolysis product Gly-Pro-Hyp (GPH).

[0069] High-performance liquid chromatography (HPLC) was used. Chromatographic column: ZORBAX SB-Aq 4.6×250nm, 5µm; mobile phase: 0.1% trifluoroacetic acid-water solution; elution gradient: isogradient elution for 30 min; flow rate: 1.0 mL / min; detection wavelength: 220 nm; column temperature: 50℃; injection volume: 10 µL; mobile phase preparation: 1000 mL ultrapure water, 1 mL trifluoroacetic acid, mixed, and ultrasonically degassed for 15 min; GPH standard solution: weigh an appropriate amount of GPH standard, dilute to 0.1 mg / mL with sample diluent solution.

[0070] The effect of collagenase colG hydrolysis time on the GPH content of the product is as follows: Figure 2 and Figure 3 As shown.

[0071] Example 6: Process for preparing fish collagen peptides by enzymatic hydrolysis of fish scales with collagenase colG (effect of enzyme dosage on product GPH content)

[0072] Collagenase colG (using the collagenase colG powder from Example 4) was added at different ratios of 0-1 / 20 to fish scales, and the enzymatic hydrolysis time was 4 hours. Other operations were the same as in Example 5. The results are as follows: Figure 4 As shown.

[0073] Example 7: Effects of different types of enzymatic hydrolysis

[0074] Following the enzymatic hydrolysis steps in Example 5, commercial alkaline protease (37071), neutral protease, acidic protease, and papain were used as controls for enzymatic hydrolysis. The hydrolysis conditions were based on the optimal reaction conditions for each commercial protease. The method for detecting the Gly-Pro-Hyp (GPH) content of the hydrolysis product was the same as in Example 5. The results are as follows: Figure 5 As shown, the GPH content of the enzymatic hydrolysate of collagenase colG (using the collagenase colG enzyme powder from Example 4) was significantly higher than that of other proteases.

[0075] Example 8: Process for preparing fish collagen peptides by enzymatic hydrolysis of fish scales using alkaline protease 37071 (Effect of hydrolysis time on the GPH content of the product)

[0076] (1) Cleaning: Soak the degreased fish scales in clean water and wash them 3 times to remove excess water.

[0077] (2) Fish scale homogenization treatment: fish scales and water are mixed at a ratio of 1:9, and then the mixture is heated in a 90℃ water bath for 1 hour and then homogenized.

[0078] (3) Enzymatic hydrolysis: The fish scale homogenate obtained in step (2) was heated to 50°C and the pH was adjusted to 9 with sodium hydroxide. Novozymes (alkaline protease 37071) was added at a mass ratio of 1:100 and the mixture was hydrolyzed for 0-3.0 h.

[0079] (4) Inactivation of enzyme: Heat the enzyme hydrolysate obtained in step (3) to 90°C and keep it for 30 minutes to inactivate the enzyme.

[0080] The method for detecting the content of the enzymatic hydrolysis product Gly-Pro-Hyp (GPH) is the same as in Example 5. Figure 6 The effect of alkaline protease hydrolysis time on the GPH content of the product was shown, indicating that 0.5 h of hydrolysis can achieve good results.

[0081] Example 9: Process for preparing fish collagen peptides by enzymatic hydrolysis of fish scales using collagenase colG and alkaline protease 37071

[0082] (1) Cleaning: Soak the degreased fish scales in clean water and wash them 3 times to remove excess water.

[0083] (2) Fish scale homogenization treatment: fish scales and water are mixed at a ratio of 1:9, and then the mixture is heated in a 90℃ water bath for 1 hour and then homogenized.

[0084] (3) Enzymatic hydrolysis (compound enzymatic hydrolysis): The fish scale homogenate obtained in step (2) was heated to 50°C and the pH was adjusted to 9 with sodium hydroxide. Novozymes (alkaline protease 37071) was added at a mass ratio of 1:100 and enzymatically hydrolyzed for 0.5 h. Then, collagenase colG (using collagenase colG enzyme powder from Example 4) was added at a ratio of 1 / 60 to 1 / 60 of fish scales and enzymatically hydrolyzed for 4 h. During the enzymatic hydrolysis, the pH was maintained at 7.5, the temperature at 35°C, and the stirring speed at 100 r / min.

[0085] (4) Inactivation of enzyme: Heat the enzyme hydrolysate obtained in step (3) to 90°C and keep it for 30 minutes to inactivate the enzyme.

[0086] (5) Decolorization and deodorization: After the temperature of the enzymatic hydrolysate obtained in step (5) drops to 75°C, adjust the pH to 5.5 with phosphoric acid, add 2% activated carbon, stir for 40 minutes, and adjust the pH to 6.5.

[0087] (6) Filtration: Filter the enzymatic hydrolysate obtained in step (5) to remove activated carbon and residue.

[0088] (7) Spray drying: The clarified enzymatic hydrolysate obtained in step (6) is spray dried to obtain peptide powder rich in fish collagen peptides.

[0089] The method for detecting the content of the enzymatic hydrolysis product Gly-Pro-Hyp (GPH) is the same as in Example 5.

[0090] Figure 2 The effect of colG single enzyme hydrolysis was shown (there was still a lot of unhydrolyzed precipitate). Figure 8 The results showed the effectiveness of the combined enzymatic hydrolysis (clear solution with minimal precipitation), demonstrating that it significantly improves the utilization rate of fish scales. Calculations show that the combined enzymatic hydrolysis process achieves a fish scale utilization rate as high as 92%.

[0091] Figure 9 The chromatogram for GPH content detection is shown. The black line represents GPH standard (0.1 mg / mL), the red line represents the complex enzymatic hydrolysis product of colG+Alcalase (alkaline protease 37071), and the blue line represents the single-enzyme hydrolysis product of Alcalase. The results show that the complex enzymatic hydrolysis product (red line) has an extremely high peak at the elution time of the GPH standard (approximately 4.4 min), significantly higher than that of the standard and other control groups. Quantitative calculations indicate that the GPH content is as high as 6.1%.

[0092] Example 10 Enzyme Addition Sequence Control

[0093] Following the steps of Example 9, the order of addition of alkaline protease and collagenase colG was reversed. The method for detecting the content of the enzymatic hydrolysis product Gly-Pro-Hyp (GPH) was the same as in Example 5. The results are as follows: Figure 9 As shown, the method of "adding alkaline protease first, then adding colG" is adopted. Figure 9 The order of adding GPH (black line) significantly increases the GPH content of the product compared to adding colG first, followed by alkaline protease. Figure 9 The order of the red lines.

[0094] Example 11: Detection of molecular weight distribution of fish collagen peptides

[0095] High-performance liquid chromatography (HPLC) was used. The chromatographic column was a TSK gel G2000SW xl 300 mm × 7.8 mm, 5 μm column; the mobile phase was acetonitrile:water:trifluoroacetic acid = 40:60:0.05; the detection wavelength was 220 nm; the flow rate was 0.5 mL / min; the detection time was 30 min of isocratic elution; the injection volume was 10 μL; and the column temperature was room temperature. Animal polypeptide standards were prepared as follows (mobile phase: 1 mg / ml through a 0.22 μm nylon membrane): cytochrome C (molecular weight 12500), aprotinin (molecular weight 6500), bacitracin (molecular weight 1450), acetaminophen-tyrosine-arginine (molecular weight 451), and acetaminophen-acetaminophen (molecular weight 189). All enzymes were subjected to enzymatic hydrolysis under optimal reaction conditions. Collagenase colG was the collagenase colG enzyme powder from Example 4, and alkaline protease 37071 was used.

[0096] The results are shown in Tables 1 and 2.

[0097] Table 1. Molecular weight distribution of fish collagen peptides (enzymatic hydrolysis by collagenase colG).

[0098]

[0099] Table 2. Molecular weight distribution of fish collagen peptides (alkaline protease 37071 + collagenase colG)

[0100]

[0101] Data analysis: Collagen peptides obtained by enzymatic hydrolysis with collagenase colG accounted for 25.54% of the molecular weight of 10,000-3,000, and those with a molecular weight less than 3,000 accounted for 71.54%. However, fish collagen peptides obtained by combined enzymatic hydrolysis with collagenase colG and alkaline protease 37071 accounted for only 1.85% of the molecular weight of 10,000-3,000, while those with a molecular weight less than 3,000 accounted for a high 98.14%. This indicates that combined enzymatic hydrolysis significantly increased the proportion of small molecule peptides in the product.

[0102] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the invention by those skilled in the art. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the invention should be included within the scope of protection of the invention.

Claims

1. A method for preparing fish collagen peptides with high GPH content using collagenase colG, characterized in that, Includes the following steps: a) Homogenize the fish scales; b) The homogenate is subjected to a first-step enzymatic hydrolysis using alkaline protease, wherein the amount of alkaline protease is 0.5-2% of the fish scale mass; the process parameters for the first-step enzymatic hydrolysis are: pH 8-10, hydrolysis temperature 45-55℃, and hydrolysis time 0.5-3h. c) The homogenate is subjected to a second enzymatic hydrolysis using collagenase colG, wherein the amount of collagenase colG is 1-2.5% of the fish scale mass; the process parameters for the second enzymatic hydrolysis are: pH 7-8, hydrolysis temperature 35-45℃, and hydrolysis time 4-8h.

2. The method according to claim 1, characterized in that, The first enzymatic hydrolysis step includes a step of heating to inactivate the alkaline protease; the second enzymatic hydrolysis step includes a step of heating to inactivate the collagenase colG.

3. The method according to claim 2, characterized in that, The inactivation parameters are: heat to 90°C and hold for 30 minutes to inactivate the enzyme.

4. The method according to any one of claims 1 to 3, characterized in that, The method further includes impurity removal, filtration, and spray drying steps after step c).

5. The method according to claim 1, characterized in that, The collagenase colG is expressed by a recombinant Bacillus subtilis strain, which is capable of producing Clostridium histolytica-derived collagenase colG. The coding sequence of the collagenase colG is shown in SEQ ID NO:

1.

6. The method according to claim 5, characterized in that, The strain contains the colG expression vector pP43NMK or pHT01.

Images