SNP-specific primer pair related to germplasm resources of dracaena cambodiana and application thereof

Abstract

The present application relates to the technical field of molecular marker, and specifically provides SNP specific primer pairs related to Hainan dragon tree germplasm resources and application thereof.The method is to detect specific SNP sites by using the specific primer pairs provided by the present application, and to distinguish two habitat types of Hainan dragon tree according to SNP polymorphism.The specific primer pair is composed of a forward primer with a nucleotide sequence as shown in SEQ ID NO.1 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.1, the sequence of the PCR amplification product of the limestone associated Hainan dragon tree is as shown in SEQ ID NO.3, and the sequence of the PCR amplification product of the granite associated Hainan dragon tree is as shown in SEQ ID NO.4.The method of the present application is simple, fast and accurate, and provides technical support for classification and identification of related Hainan dragon tree resources and molecular breeding selection.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular biology and plant molecular breeding, and particularly relates to a SNP specific primer pair related to Hainan dragon tree germplasm resources and application thereof. BACKGROUND

[0002] Hainan dragon tree is distributed only in Hainan, China, and is one of the two main source plants of domestic dragon's blood and a rare ornamental plant in China. The study of Hainan dragon trees of different habitat types (limestone associated type and granite associated type) is of great significance to the protection genetics and adaptive evolution of Hainan dragon tree. Therefore, it is urgent to establish a rapid, accurate and efficient technical means to realize accurate identification and typing of Hainan dragon tree germplasm resources, so as to better carry out basic research work on endangered mechanism and conservation genetics of Hainan dragon tree. SUMMARY

[0003] In order to overcome some defects in the prior art, the present application screens single base variation sites that can be used to identify Hainan dragon trees of the two habitat types by performing chloroplast whole genome sequencing and comparative analysis on one portion of limestone associated type and granite associated type Hainan dragon tree germplasm, and develops SNP markers, detection primers and methods.

[0004] The purpose of the present application is to provide chloroplast genome SNP sites for identifying limestone associated type and granite associated type Hainan dragon tree germplasm resources, and specific primers and identification methods for identifying limestone associated type and granite associated type Hainan dragon tree germplasm resources.

[0005] To achieve the above purpose, the present application provides the following technical solutions:

[0006] The first aspect of the present application provides a specific primer pair for identifying limestone associated type and granite associated type Hainan dragon tree germplasm resources.

[0007] The specific primer pair comprises a forward primer and a reverse primer.

[0008] The sequence of the forward primer is 5'ACCAAACCAAATACGACGAG 3'.

[0009] The sequence of the reverse primer is 5'CCAGACAAAATGAGCACCTA 3'.

[0010] The second aspect of the present application provides a product for identifying limestone associated type and granite associated type Hainan dragon tree germplasm resources comprising the specific primer pair.

[0011] The third aspect of the present application provides applications of the specific primer pair, which are any one of the following:

[0012] (1) in the application of identifying limestone associated type and granite associated type Hainan dragon tree germplasm resources;

[0013] (2) in the application of preparing the product for identifying limestone associated type and granite associated type Hainan dragon tree germplasm resources.

[0014] The fourth aspect of the application provides a method for identifying or assisting in identifying limestone associated type and granite associated type Hainan dragon tree germplasm resources, comprising the following steps:

[0015] S1, extracting total genomic DNA of the Hainan dragon tree germplasm material to be tested;

[0016] S2, using the SNP-specific primer pair to perform PCR amplification on the sample DNA to be tested, and obtaining a PCR amplification product;

[0017] S3, PCR amplification product detection: the PCR amplification product is subjected to electrophoresis on a 1% agarose gel, and is subjected to electrophoresis in 1xTBE buffer at a voltage of 100V for 40min, the agarose gel contains 8% Goldview nucleic acid dye, the running gel result is photographed in a gel imaging system, and a 5000bp DNA is used as a marker, the amplification product has only one band, and the band size is 336bp, that is, the target band;

[0018] S4, PCR amplification product sequencing: the PCR amplification product is sequenced by using Sanger first-generation conventional sequencing, the sequence of the limestone associated type Hainan dragon tree PCR amplification product is shown as SEQ ID NO.3, and the sequence of the granite associated type Hainan dragon tree PCR amplification product is shown as SEQ ID NO.4.

[0019] Further, in step S2, the PCR reaction system of 30ul is used: ddH2O 10.0ul, 2xtaq PCR Master Mix 15.0ul, total genomic DNA 1.0ul, forward primer 2.0ul, reverse primer 2.0ul;

[0020] PCR reaction amplification program: 95℃ pre-denaturation for 5min; 95℃ denaturation for 30sec, 55℃ annealing for 30sec, 72℃ extension for 30sec, 35 cycles; finally, 72℃ extension for 10min, and 4℃ preservation.

[0021] The application has the beneficial effects:

[0022] Compared with the nuclear genome sequence information, the chloroplast genome sequence information is more conservative, the accuracy of the specific molecular marker technology developed based on the variation sites thereof is higher, is not affected by environmental factors, needs no flowering or fruiting of the plant, and only needs a small amount of fresh tissue sample or the tissue sample dried by silica gel to achieve accurate and efficient identification of the plant germplasm resources. By performing chloroplast whole genome sequencing and comparative analysis on one representative germplasm material selected from each of limestone associated type and granite associated type Hainan dragon tree germplasm resources, the present application successfully develops a chloroplast SNP marker. Based on the detection system of the marker, limestone associated type and granite associated type Hainan dragon tree germplasm resources can be quickly and accurately distinguished and identified. The technology provides strong technical support for carrying out basic research work such as endangered mechanism and conservation genetics of Hainan dragon tree, and has important application value in exploring the origin and evolution of Hainan dragon tree resources and promoting molecular breeding research field. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 It is an electrophoresis map of the psA-1 primer amplification product in the embodiment.

[0024] Figure 2 It is a peak map result of part of bases in the psA-1 marker site sequencing;

[0025] Figure 3 It is a phylogenetic tree map obtained by UPGMA clustering analysis of Hainan dragon tree germplasm from different habitats. DETAILED DESCRIPTION

[0026] The specific embodiments of the present application are described below to facilitate the understanding of the present application by those skilled in the art, but it should be clear that the present application is not limited to the scope of the specific embodiments, and for those skilled in the art, it is obvious that various changes are within the spirit and scope of the present application defined and determined by the appended claims, and all the application and creation utilizing the concept of the present application are within the scope of protection.

[0027] Explanation of the sequence table: the underlined bases represent the polymorphic SNP sites:

[0028] SEQ ID NO. 1:

[0029] 5' ACCAAACCAAATACGACGAG 3'.

[0030] SEQ ID NO. 2:

[0031] 5' CCAGACAAAATGAGCACCTA 3'.

[0032] SEQ ID NO. 3:

[0033] ACCAAACCAAATACGACGAGTAGTGGGATCCTGAGCTAAACCTTGGCTAAACCTTGGAAATCTTAATGCCATAATGCCTTTCAAATCCTCCTAGCCATTATCCTACTGCAATAATTCTTGCTAAGAAGAATGCCCATGTTGTGGCAATTCCACCCAGAAGGTAATG T GTTACTCCTACAGCGCGTCCTTGTACAATGCTCAAGGCTCTAGGCTGAGTAGCAGGAGCAACTTTTAATTTGTTATGAGCCCAAACGATGGATTCAATGAGTTCTTGCCAATAACCACGGCCACTGAATAGAAACATTAAACTAAAAGCCCAGACAAAATGAGCACCTA.

[0034] SEQ ID NO.4:

[0035] ACCAAACCAAATACGACGAGTAGTGGGATCCTGAGCTAAACCTTGGCTAAACCTTGGAAATCTTAATGCCATAATGCCTTTCAAATCCTCCTAGCCATTATCCTACTGCAATAATTCTTGCTAAGAAGAATGCCCATGTTGTGGCAATTCCACCCAGAAGGTAATG C GTTACTCCTACAGCGCGTCCTTGTACAATGCTCAAGGCTCTAGGCTGAGTAGCAGGAGCAACTTTTAATTTGTTATGAGCCCAAACGATGGATTCAATGAGTTCTTGCCAATAACCACGGCCACTGAATAGAAACATTAAACTAAAAGCCCAGACAAAATGAGCACCTA.

[0036] Example 1 Molecular identification of limestone associated and granite associated Hainan Dragon Blood Tree

[0037] 1. Selection of experimental materials

[0038] One population of limestone associated Hainan Dragon Blood Tree with 11 samples distributed in Ouxianling of Dongfang City and Bawangling of Changjiang County, and three populations of granite associated Hainan Dragon Blood Tree with 20 samples in Nanshan, Yalongwan of Sanya City and Changhua Daling of Changjiang County (Table 1) were selected.

[0039] 2. SNP marker detection

[0040] 2.1 The total DNA of the experimental material of the above-mentioned sample of Hainan dragon tree was extracted by using a modified CTAB method;

[0041] 2.2 The DNA of the sample to be detected of Hainan dragon tree extracted in step 2.1 was used as an amplification template, and the developed specific marker primer psA-1 was used as an amplification primer to perform PCR amplification;

[0042] The psA-1 comprises:

[0043] Forward primer (SEQ ID NO. 1): 5'ACCAAACCAAATACGACGAG 3';

[0044] Reverse primer (SEQ ID NO. 2): 5'CCAGACAAAATGAGCACCTA 3';

[0045] 2.3 PCR reaction system: 30 μL in volume, wherein ddH2O 10.0 μL, 2×Taq PCR Master Mix 15.0 μL, genomic DNA (~20 ng) 1.0 μL, LH-1 forward primer 2.0 μL, LH-1 reverse primer 2.0 μL; reaction amplification procedure: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 30 sec, for 35 cycles; finally 72℃ extension for 10 min, 4℃ preservation.

[0046] The PCR amplification product was electrophoresed on a 1.5% agarose gel (containing 8% Goldview nucleic acid dye) for 7 min at a voltage of 240 V in 1×TBE buffer. The gel running result was photographed and recorded in a gel imaging system.

[0047] 2.4 The PCR product was sequenced by Sanger first-generation conventional sequencing method.

[0048] 3. Identification result: the sequencing result was analyzed to find out the SNP described above, and the limestone associated type and granite associated type of Hainan dragon tree germplasm material were identified. The detection results are shown in Table 1, Figure 1 , Figure 2 and Figure 3 .

[0049] Table 1 Specific SNP analysis table for identifying different Hainan dragon tree species resources

[0050]

[0051] It can be clearly shown from table 1 that: the primer psA-1 amplification sequence in 31 detection materials, the 167th site of the amplification product is SNP 1, and the sequence of SNP 1 as "T" base is limestone associated Hainan Dragon Tree; the sequence of SNP 1 as "C" base is granite associated Hainan Dragon Tree.

[0052] It can be clearly shown from table 1 that: the primer psA-1 amplification sequence in 31 detection materials, the 167th site of the amplification product is SNP 1, and the sequence of SNP 1 as "T" base is limestone associated Hainan Dragon Tree; the sequence of SNP 1 as "C" base is granite associated Hainan Dragon Tree. Figure 1 And Figure 2 It can be clearly shown from table 1 that: the primer psA-1 amplification sequence in 31 detection materials, the 167th site of the amplification product is SNP 1, and the sequence of SNP 1 as "T" base is limestone associated Hainan Dragon Tree; the sequence of SNP 1 as "C" base is granite associated Hainan Dragon Tree. Figure 1 It can be clearly shown from table 1 that: the primer psA-1 amplification sequence in 31 detection materials, the 167th site of the amplification product is SNP 1, and the sequence of SNP 1 as "T" base is limestone associated Hainan Dragon Tree; the sequence of SNP 1 as "C" base is granite associated Hainan Dragon Tree.

[0053] Figure 3 It is the UPGMA clustering tree analysis result, UPGMA clustering method is used, and the clustering tree of 31 samples is constructed. The granite associated Hainan Dragon Tree (EX) is clustered into a class group; the granite associated Hainan Dragon Tree (DX) is clustered into a class group two. The result shows that the method can effectively identify limestone associated and granite associated Hainan Dragon Tree germplasm resources, and the psA-1 specific SNP marker is effective, accurate and reliable.

[0054] The principle and implementation mode of the present application are described by specific examples in the present application, and the above example is only used to help understand the method and core idea of the present application; meanwhile, for the general technical personnel in the art, according to the idea of the present application, the specific implementation mode and application range will be changed, and the above description should not be understood as the limitation of the present application.

Claims

1. The application of SNP specific primer pairs for detecting the limestone associated type and granite associated type of Hainan dragon tree germplasm resources, characterized in that, The application is any one of the following: (1) application in identifying limestone associated type and granite associated type of Hainan dragon tree germplasm resources; (2) application in preparing products for identifying limestone associated type and granite associated type of Hainan dragon tree germplasm resources; The genomic DNA of the to-be-tested Hainan dragon tree is subjected to PCR amplification by using the primer pair, and the PCR amplification product is sequenced, the sequence of the PCR amplification product of the limestone associated type of Hainan dragon tree is shown as SEQ ID NO. 3; the sequence of the PCR amplification product of the granite associated type of Hainan dragon tree is shown as SEQ ID NO.

4.

2. A method for identifying or assisting in identifying the limestone associated type and the granite associated type of Hainan dragon tree germplasm resources, characterized in that, The method comprises the following steps: S1, extracting total genomic DNA of the to-be-tested Hainan dragon tree germplasm material; S2, using the sample DNA extracted in step S1 as an amplification template, the sample DNA is subjected to PCR amplification by using the SNP specific primer pair, and a PCR amplification product is obtained; S3, PCR amplification product detection: the PCR amplification product is subjected to electrophoresis on a 1% agarose gel, and is subjected to electrophoresis in 1xTBE buffer at a voltage of 100V for 40min, the agarose gel contains 8% nucleic acid dye, the running gel result is photographed in a gel imaging system, 5000bp DNA is used as a marker, the amplification product has only one band, and the band size is 336bp, which is the target band; S4, PCR amplification product sequencing: the PCR amplification product is sequenced by using Sanger first-generation conventional sequencing, the sequence of the PCR amplification product of the limestone associated type of Hainan dragon tree is shown as SEQ ID NO. 3; the sequence of the PCR amplification product of the granite associated type of Hainan dragon tree is shown as SEQ ID NO.

4.

3. The method for identifying or assisting in identifying the limestone associated type and granite associated type of Hainan dragon tree germplasm resources according to claim 2, characterized in that, In step S2, the PCR reaction system of 30ul: ddH2O 10.0ul, 2xtaqPCR Master Mix 15.0ul, total genomic DNA 1.0ul, forward primer 2.0ul, reverse primer 2.0ul; PCR reaction program: 95℃ pre-denaturation for 5min; 95℃ denaturation for 30sec, 55℃ annealing for 30sec, 72℃ extension for 30sec, 35 cycles; finally, 72℃ extension for 10min, 4℃ preservation.

Images