Application of epidermal growth factor-loaded pseudo-ginseng exosome-like nano-vesicles in wound healing

Abstract

The invention discloses a pseudo-ginseng exosome-like nano vesicle loaded with an epidermal growth factor / application of the pseudo-ginseng exosome-like nano vesicle in wound healing. The research shows that not all exosome-like nano-vesicles from Chinese herbal medicines capable of promoting wound healing have the effect of promoting wound healing, the action mechanism of the pseudo-ginseng exosome-like nano-vesicles in wound healing is further explored, and the research shows that PNVs can promote the proliferation and migration of an epidermal keratinocyte line, so that the PNVs can be used for promoting the healing of the wound. The treatment can be realized by regulating and controlling the activity of immune cells to promote cell proliferation and migration, and the wound healing effect of the EGF-loaded EGF-coated PNVs is remarkably enhanced, so that the EGF-loaded EGF-coated PNVs have a synergistic effect. The invention not only provides a theoretical basis for deeply researching PELNVs, but also provides a new method and a new idea for treating acute wounds.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the application of Panax notoginseng exosome-like nanovesicles loaded with epidermal growth factor in wound healing. Background Technology

[0002] As the largest organ in the human body, the skin is the body's first line of defense against infection and injury. When the skin barrier is damaged, the body is more susceptible to invasion by opportunistic pathogens colonizing the skin surface or pathogens from the environment, leading to infection. This can even result in pathogens entering the bloodstream and causing sepsis, especially in individuals with large wounds or weakened immune systems. Therefore, promoting rapid wound healing and restoring the skin barrier are crucial when the skin barrier is compromised.

[0003] In recent years, plant exosome-like nanovesicles (PELNVs) have shown great promise in disease treatment and drug delivery due to their advantages such as large-scale production, high yield, environmental friendliness, low immunogenicity, and good biocompatibility. Studies have demonstrated that PELNVs possess various physiological activities and drug delivery functions, including antibacterial, anti-inflammatory, antioxidant stress, immunosuppressive, and antitumor effects. They have been successfully applied in the treatment and drug delivery systems for diseases such as tumors, pneumonia, colitis, liver injury, and acute and chronic wounds. For example, Fikrettin Sahinden et al. found that wheat-derived PELNVs can promote the proliferation and migration of skin endothelial cells, keratinocytes, and fibroblasts and inhibit their apoptosis; they can also upregulate the mRNA level of COL1A1. Manho... Kim et al. found that PELNVs extracted and isolated from aloe vera could reduce the mRNA levels of IL-6 and IL-1β in an LPS-induced RAW264.7 inflammatory cell model, and promote the proliferation, migration, and cast formation of HDF cells and endothelial cells. This suggests that aloe vera-derived PELNVs may play a therapeutic role in chronic skin wounds. Yagiz Savci et al. found that grapefruit-derived PELNVs could promote HaCaT cell proliferation, reduce H2O2-induced ROS levels in HaCaT cells, promote HaCaT cell migration, upregulate the gene and protein expression of COL1A1, fibronectin, vimentin, and laminin, and promote cast formation in HUVEC cells. Based on the inherent advantages of PELNVs, their potential in promoting wound healing is enormous.

[0004] Panax notoginseng, also known as Jin Buhuan, has long been used in treating traumatic bleeding due to its hemostatic and anti-inflammatory effects. In recent years, research on the application of small molecule compounds contained in Panax notoginseng in wound healing has also been frequent. For example, Zheng Y et al. found that ginsenoside Rg1 extracted from Panax notoginseng can promote the migration and tube formation of human umbilical vein endothelial cells, thereby promoting angiogenesis. Zhang L et al. found that ginsenoside Rb1 may promote wound healing in a rat burn model by activating the FGF-2 / PDGF-BB / PDGFR-β signaling pathway. In addition, ginsenoside Rb1 can also induce the expression of COL1A1 in human dermal fibroblasts in a dose- and time-dependent manner, promoting the healing process mediated by the aging-related secretory phenotype through the p38MAPK / MSK2 / NF-κB pathway. Li D et al. found that Panax notoginseng saponin R1 promotes angiogenesis and wound healing by activating the Notch pathway. Furthermore, Panax notoginseng polysaccharides can reduce H2O2-induced oxidative stress in human dermal fibroblasts and promote COL1A1 synthesis. Total Panax notoginseng saponins improve wound healing in hyperglycemic rats by promoting endothelial cell proliferation, invasion, migration, and angiogenesis, inhibiting apoptosis and oxidative damage, and activating the GSK-3β / β-catenin pathway. Additionally, it was found that ginsenoside F2, a metabolite of ginsenoside Rb1, promotes keratinocyte proliferation; ginsenoside Rg3 hydrogel significantly accelerates wound contraction and healing in mice; and ginsenoside Rd can promote the proliferation and migration of keratinocytes and human dermal fibroblasts.

[0005] The article "Panax notoginseng: derived exosome-like nanoparticles attenuate ischemia reperfusion injury via altering microglia polarization" points out that exosome-like nanoparticles derived from Panax notoginseng can be used to treat cerebral ischemia-reperfusion injury. However, whether exosome-like nanovesicles derived from Panax notoginseng also have a wound-healing effect remains unknown. Therefore, exploring the role of exosome-like nanovesicles derived from Panax notoginseng in promoting wound healing is of great significance for further improving the role of plant-derived exosome-like nanovesicles in promoting wound healing. Summary of the Invention

[0006] The purpose of this invention is to overcome the above-mentioned defects and deficiencies in the prior art and to provide an application of Panax notoginseng exosome-like nanovesicles in the preparation of drugs that promote wound healing.

[0007] A second objective of this invention is to provide the application of Panax notoginseng exosome-like nanovesicles loaded with epidermal growth factor in the preparation of drugs that promote wound healing.

[0008] The above-mentioned objective of this invention is achieved through the following technical solution: This invention extracted PELNVs from six medicinal plants used to treat skin diseases. CCK8 assays revealed that PELNVs derived from Panax notoginseng (i.e., plant exosome-like nanovesicles, PNVs) showed the strongest effect in promoting HaCaT cell proliferation, while PELNVs derived from Scutellaria baicalensis, Lonicera japonica, Sophora flavescens, and Glycyrrhiza uralensis had no significant effect on HaCaT cell proliferation. Therefore, not all medicinal herbs used for skin wound healing possess PELNVs that promote wound healing. This invention focuses on exploring the mechanism of action of PNVs in wound healing.

[0009] First, network pharmacology was used to predict the targets of PNVs, with key targets enriched at MMP9, AKT1, and EGFR. GO analysis revealed positive regulation of cell proliferation, cell migration, MAPK cascade, and PI3K signaling in biological processes. KEGG analysis showed enrichment at the PI3K / AKT signaling pathway, MAPK signaling pathway, and Ras signaling pathway. Furthermore, LC-MS validated that PNVs carry small molecule compounds that promote wound healing, such as ginsenoside Rg1, notoginsenoside R1, ginsenoside Rg3, and ginsenoside F2. Therefore, PNVs can play a role in wound healing by promoting cell proliferation and migration through small molecule compounds.

[0010] Next, the miRNAs of PNVs were sequenced. Target enrichment analysis revealed enrichment in the PI3K / AKT signaling pathway, MAPK signaling pathway, Focal adhesion, and RHO GTPase cycle. These results showed high overlap with the network pharmacology target predictions based on chemical composition, indicating close correlation with cell proliferation and migration. Functional validation of the top three pno-miRNAs by read count revealed that pno-miRNA 159, pno-miRNA 166, and pno-miRNA 168 all promoted HaCaT cell proliferation to varying degrees. Among them, pno-miRNA 159 exhibited the strongest proliferative effect and was also the most abundant miRNA in PNVs. Transfection of pno-miRNA 159 into RAW264.7 cells showed a slight promotion of CD86 expression. Therefore, PNVs can exert a role in promoting wound healing through miRNAs.

[0011] Based on network pharmacology predictions and pno-miRNA target enrichment analysis, the role of PNVs in promoting wound healing was further investigated. PNVs at concentrations of 5–30 μg / mL promoted the proliferation of HaCaT cells (immortalized epidermal keratinocytes), and Western blot results showed that PNVs upregulated the EGFR / PI3K / AKT pathway in HaCaT cells. At a concentration of 30 μg / mL, PNVs promoted the proliferation and activation of Jurkat cells (T lymphocytes), and also increased CD86 expression and TNF-α secretion levels in RAW264.7 cells (monocytes / macrophages).

[0012] Next, the interactions between PNVs, monocytes / macrophages, and fibroblasts were investigated. The results showed that PNV-induced RAW264.7 cell culture supernatant promoted the proliferation and migration of L929 cells (fibroblasts), upregulated the mRNA expression of N-cadherin, vimentin, Slug, and ZEB1, and downregulated E-cadherin, and promoted EMT in L929 cells. This indicates that PNV treatment of mouse RAW264.7 cells induces TNF-α secretion to promote EMT in L929 cells, thereby promoting cell proliferation and migration and contributing to wound healing. This demonstrates that PNVs can directly promote the proliferation and migration of L929 cells, and can also promote the proliferation and migration of L929 cells by regulating the activity of RAW264.7 cells.

[0013] Epidermal growth factor (EGF), one of the most commonly used drugs in clinical practice for treating acute wounds, retains its original shape, particle size, and electrical potential when loaded onto PNVs. Both PNVs and EGF@PNVs can be taken up by cells. In in vitro experiments, EGF@PNVs showed a stronger ability to promote the proliferation and migration of HaCaT and L929 cells compared to PNVs, while also upregulating the mRNA levels of MMP9 and COL3A1 more significantly. In in vivo experiments, the EGF@PNVs group exhibited a higher wound healing rate compared to EGF and PNVs, and pathological tissue sections and real-time quantitative PCR showed that the wound-healing tissue had a more intact skin structure, more collagen, and less inflammatory infiltration. In vitro and in vivo experiments validated that EGF@PNVs are more effective than EGF and PNVs in promoting wound healing. In summary, PNVs can not only directly promote cell proliferation and migration but also promote cell proliferation and migration by regulating immune cell activity, and the effect is enhanced after loading with EGF.

[0014] Therefore, this invention provides the application of Panax notoginseng exosome-like nanovesicles in the preparation of drugs that promote wound healing.

[0015] This invention also provides the application of Panax notoginseng exosome-like nanovesicles loaded with epidermal growth factor in the preparation of drugs that promote wound healing.

[0016] Furthermore, the particle size of the Panax notoginseng exosome-like nanovesicles is 100–200 nm.

[0017] Furthermore, the potential of the Panax notoginseng exosome-like nanovesicles is 19–22 mV.

[0018] Furthermore, the extraction method of the Panax notoginseng exosome-like nanovesicles is to extract the broken Panax notoginseng using differential centrifugation.

[0019] Furthermore, the differential centrifugation method is performed at 2500–3500 g for 18–22 min, 9500–15000 g for 35–45 min, 35000–45000 g for 65–75 min, and 100000–200000 g for 85–95 min.

[0020] Preferably, the specific procedure for the differential centrifugation method is 3000 g, 20 min, 10000 g, 40 min, 40000 g, 70 min, 150000 g, 90 min.

[0021] Specifically, the extraction method of the Panax notoginseng exosome-like nanovesicles is as follows: crush Panax notoginseng, extract juice, filter, centrifuge at 3000 g for 20 min, 10000 g for 40 min, 40000 g for 70 min, 150000 g for 90 min, resuspend the precipitate, and filter to obtain the product.

[0022] Furthermore, the method for preparing the Panax notoginseng exosome-like nanovesicles loaded with epidermal growth factor is to encapsulate the epidermal growth factor into the Panax notoginseng exosome-like nanovesicles using an electroporation method.

[0023] Furthermore, the mass ratio of the Panax notoginseng exosome-like nanovesicles to epidermal growth factor is 98–102:1.

[0024] Preferably, the mass ratio of the Panax notoginseng exosome-like nanovesicles to epidermal growth factor is 100:1.

[0025] Specifically, the PNVs solution and EGF were mixed and transferred to an electroporation vessel. The mixture was then electroporated at 300 V / 150 µF. After electroporation, the mixture was placed on ice for 1 h. The electroporation was repeated once, followed by centrifugation, resuspending of the precipitate, washing, and filtration to obtain the final product.

[0026] Furthermore, the drug achieves therapeutic effects by regulating the proliferation and migration of epidermal keratinocytes, T lymphocytes, monocytes / macrophages, and fibroblasts.

[0027] Furthermore, the concentration of Panax notoginseng exosome-like nanovesicles in the drug is 20–50 μg / mL.

[0028] Furthermore, the wound healing described is acute wound healing.

[0029] Furthermore, the drug also includes other pharmaceutically acceptable excipients.

[0030] Furthermore, the dosage form of the drug is one or more of the following: powder, tablet, capsule, granule, and emulsion.

[0031] Compared with the prior art, the present invention has the following beneficial effects: This invention discloses the application of Panax notoginseng exosome-like nanovesicles loaded with epidermal growth factor (EGF) in wound healing. The research indicates that not all traditional Chinese medicines that promote wound healing utilize exosome-like nanovesicles derived from them. Further investigation into the mechanism of action of Panax notoginseng exosome-like nanovesicles in wound healing reveals that PNVs can promote the proliferation and migration of epidermal keratinocytes and can also regulate immune cell activity to promote cell proliferation and migration, thus achieving therapeutic effects. Loading with EGF significantly enhances the wound healing effect of EGF@PNVs, exhibiting a synergistic effect. This invention not only provides a theoretical basis for in-depth research on PNVs but also offers new methods and ideas for treating acute wounds. Attached Figure Description

[0032] Figure 1 The effects of different PELNVs on HaCaT cell proliferation.

[0033] Figure 2 For the identification of PNVs and EGF@PNVs. Among them, Figure 2 In the table, A represents fresh Panax notoginseng; B represents morphological images of PNVs taken using a transmission electron microscope (TEM), scale bar: 100 nm; C represents morphological images of EGF@PNVs taken using a TEM, scale bar: 100 nm; D represents the particle size distribution of PNVs and EGF@PNVs; E represents the lack of statistical difference in potential between PNVs and EGF@PNVs (P > 0.05); F represents the ability of PNVs to load EGF, i.e., the encapsulation efficiency. Data are expressed as mean ± standard error (SEM), n = 3.

[0034] Figure 3 This is a cellular uptake experiment. Among them, Figure 3In Figure A, DIO and DAPI fluorescence were imaged and analyzed using two-photon laser confocal scanning microscopy to evaluate cellular uptake and localization. Scale bar: 20 μm. In Figure B, DIO fluorescence signal in the FITC fluorescence channel of cells was detected by flow cytometry. Data are expressed as mean ± standard error (SEM), n=3. P <0.0001.

[0035] Figure 4 These are the top fifteen key targets for protein-protein interaction analysis.

[0036] Figure 5 For GO analysis.

[0037] Figure 6 KEGG analysis.

[0038] Figure 7 To verify the small molecule compounds carried by PNVs using LC-MS. Figure 7 A in the formula is ginsenoside Rg1, with the molecular formula: C 42 H 72 O 14 Molecular weight: 801.01; B is notoginsenoside R1, molecular formula: C 47 H 80 O 18 Molecular weight: 933.13; C is ginsenoside Rg3, molecular formula: C 42 H 72 O 13 Molecular weight: 785.01; D is ginsenoside F2, molecular formula: C 42 H 72 O 13 Molecular weight: 785.01.

[0039] Figure 8 To validate the function of pno-miRNA. Among them, Figure 8 In the diagram, A represents the top three most abundant pno-miRNAs that promote HaCaT proliferation; B represents pno-miRNA 159 that promotes CD86 expression in RAW264.7.

[0040] Figure 9 The effect of PNVs on HaCaT cell proliferation. Among them, Figure 9 In the figure, A represents the effect of different concentrations of PNVs on the viability of HaCaT cells; B represents the expression of EGFR / AKT / PI3K proteins.

[0041] Figure 10 This refers to the immune activity of PNVs. Among them, Figure 10In the table, A represents PNVs promoting Jurkat cell proliferation; B represents PNVs promoting CD86 expression in RAW264.7 cells. Data are expressed as mean ± standard error (SEM), n=3. P <0.0001.

[0042] Figure 11 Treatment of RAW264.7 cell culture supernatant with PNVs promoted L929 cell migration and proliferation. Figure 11 In this study, A represents the cell scratch assay (scale bar: 200 μm); B represents cell proliferation as determined by CFSE; C represents the TNF-α level secreted by RAW264.7 cells after PNV treatment; and D represents the mRNA level of EMT-related genes in L929 cells promoted by PNV treatment of RAW264.7 cells. Data are expressed as mean ± standard error (SEM), n = 3. (ns) P >0.05;**, P <0.01.

[0043] Figure 12 To detect cell proliferation using flow cytometry. Figure 12 In the table, A represents HaCaT cell proliferation; B represents L929 cell proliferation. Data are expressed as mean ± standard error (SEM), n=3. ns, P >0.05;**, P <0.01; ****, P <0.0001.

[0044] Figure 13 The effect of EGF@PNVs on cell migration. Data are presented as mean ± standard error (SEM), n=3. ns, P >0.05; *, P <0.05;**, P <0.01.

[0045] Figure 14 EGF@PNVs upregulate the expression of functional proteins. Among them, Figure 14 In the figures, A and B represent the mRNA expression levels of COL1A1 and MMP9 in HaCaT cells; C and D represent the mRNA expression levels of COL1A1 and MMP9 in L929 cells. Data are expressed as mean ± standard error (SEM), n=3. ns, P >0.05; *, P <0.05;**, P <0.01; ***, P <0.001; ****, P <0.0001.

[0046] Figure 15 This is a schematic diagram of an in vivo experiment.

[0047] Figure 16 To evaluate wound healing in mice. Figure 16 In the figures, A represents the wound healing status of mice; B represents the quantitative analysis of mouse wound healing; and C represents the mouse body weight change curve. Data are expressed as mean ± standard error (SEM), n=3. ns, P >0.05;**, P <0.01.

[0048] Figure 17 Staining of mouse wound healing tissue sections. Scale bar: 500 μm.

[0049] Figure 18 This represents the mRNA expression level in skin wound tissue. Data are expressed as mean ± standard error (SEM), n=3. ns, P >0.05; ***, P <0.001; ****, P <0.0001. Detailed Implementation

[0050] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0051] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0052] All experimental data in this study were analyzed using GraphPad Prism 7 (GraphPad Software Inc, USA). Unpaired t-tests were used to compare statistical differences between the two groups. All experimental data are expressed as mean ± standard error (SEM). * indicates no statistically significant difference. P <0.05;** P <0.01; ***, P <0.001; ****, P <0.0001.

[0053] Example 1: Screening PELNVs (plant exosome-like nanovesicles) for wound healing models I. Experimental Methods There are many studies on traditional Chinese medicines used for wound healing, but there are few studies on the use of PELNVs extracted from traditional Chinese medicines for wound healing. In order to screen suitable traditional Chinese medicine PELNVs for the treatment of acute wounds, six traditional Chinese medicinal plants with therapeutic effects on skin diseases were identified as candidate plants by reviewing the literature, including Panax notoginseng, Artemisia argyi, Scutellaria baicalensis, Lonicera japonica, Sophora flavescens, and Glycyrrhiza uralensis.

[0054] Keratinocytes, as the most abundant cells in the epidermis, play a crucial role in maintaining the skin barrier and are among the main cells involved in skin damage repair. During the proliferative phase of wound healing, macrophages release a large number of growth factors and chemokines to promote skin cell migration, proliferation, and matrix formation. Simultaneously, keratinocytes released from epidermal stem cells rapidly proliferate and migrate to cover the wound, thereby achieving epidermal barrier reconstruction. Therefore, the optimal PELNVs were screened by detecting the proliferation of HaCaT cells (immortized epidermal keratinocyte line) using the CCK8 assay.

[0055] 1. Extraction of PNVs Fresh Panax notoginseng ( Figure 2 A) Wash and air dry most of the water residue. First, cut the Panax notoginseng rhizomes into small pieces, put them into a high-speed blender, and add pre-cooled PBS (at a 1:2 mass ratio). Start the blender to extract the juice. Then filter with gauze to remove large particles of residue, repeating once. Next, extract PNVs using differential centrifugation. The specific program is 3000 g, 20 min; 10000 g, 40 min; 40000 g, 70 min; 150000 g, 90 min. The final precipitate is the PNVs. Resuspend in an appropriate amount of PBS and filter through a 0.22 µm membrane for later use. Perform the entire process on ice or at 4°C. Store long-term at -80°C, or for one week at 4°C.

[0056] 2. CCK8 Vitality Test (1) According to 5×10 5 A cell suspension with a density of cells / mL was evenly seeded into each well of a 96-well plate at a density of 100 µL. 100 µL of PBS was added to the wells near the edge to seal the edges and prevent the culture medium from evaporating and affecting the drug concentration.

[0057] (2) Place in an incubator and continue culturing overnight until the culture adheres to the wall. Remove the old culture medium. Add 100 µL of fresh culture medium to the control group and 100 µL of culture medium mixed with drug solution to the drug administration well. Continue culturing for 24 hours.

[0058] (3) Remove the culture medium, add 100 µL of culture medium mixed with 10% CCK-8 reagent to each well, and incubate at 37°C in the dark for 1 to 2 hours.

[0059] (4) The absorbance (OD) at 450 nm was measured using an enzyme-linked immunosorbent assay (ELISA) reader.

[0060] II. Experimental Results The results are as follows Figure 1 As shown, PELNVs derived from Panax notoginseng (i.e., plant exosome-like nanovesicles, PNVs) exhibited the strongest proliferative effect on HaCaT cells, followed by Artemisia argyi. PELNVs derived from Scutellaria baicalensis, Lonicera japonica, Sophora flavescens, and Glycyrrhiza uralensis had no significant effect on HaCaT cell proliferation. Therefore, not all traditional Chinese medicines used for skin wound healing possess PELNVs that promote skin wound healing.

[0061] Example 2 Identification of PNVs and EGF@PNVs I. Experimental Methods 1. PNVs electroporation method for encapsulating EGF (epidermal growth factor) Mix 1 mg of PNVs solution (final concentration 0.8 mg / mL) and 10 μg of EGF (final concentration 0.8 μg / mL), transfer 1 mL to an electroporator, and electroporate at 300 V / 150 µF. After electroporation, incubate on ice for 1 h, perform membrane recombination, and repeat the electroporation process once. Then, centrifuge at 15000 g for 90 min, discard the supernatant, resuspend the precipitate in ice-cold PBS, centrifuge to remove free EGF, and repeat the centrifugation and washing process once. The final precipitate is EGF-encapsulated PNVs, i.e., EGF@PNVs, filtered through a 0.22 μm filter membrane for later use. The entire process should be performed on ice or at low temperature. Store at -80℃ for long-term storage, or at 4℃ for up to one week.

[0062] 2. ELISA determination of EGF encapsulation rate (1) After centrifugation of the mixed solution after electroporation, take an appropriate amount of the supernatant and dilute it for later use. Before use, equilibrate the ELISA kit at room temperature for 20-30 minutes. Dilute the Biotinylated Antibody and Streptavidin-HRP to 1× working concentration with Dilution Buffer R and dilute the washing buffer to 1× working concentration with ddH2O. Serially dilute Cytokine Standard with 1× Dilution Buffer R to prepare 6 concentrations for later use.

[0063] (2) Sample loading: Add 100 µL of Cytokine Standard or the supernatant to be tested to the sample loading wells, and add 100 µL of 1×Dilution Buffer R working solution to the blank control wells. Cover with the sealing film and incubate at room temperature for 2 hours.

[0064] (3) Washing the plate: Remove the liquid from the wells onto the filter paper, add 300 µL of 1×Washing Buffer working solution to each well, let it stand for 1 minute, and remove the liquid from the wells onto the filter paper after staining. Repeat 3 times, and remove the liquid from the wells on the last time.

[0065] (4) Add Biotinylated Antibody: Add 100 µL of 1×Biotinylated Antibody working solution to each well. Cover with sealing film and incubate at room temperature for 2 hours.

[0066] (5) Wash the plate: Repeat step (3).

[0067] (6) Add enzyme: Add 100 µL of 1×Streptavidin-HRP working solution to each well. Cover with sealing film and incubate at room temperature for 30 minutes.

[0068] (7) Wash the plate: Repeat step (3).

[0069] (8) Color development: Add 100 µL of TMB to each well and incubate at room temperature in the dark for 25 minutes.

[0070] (9) Termination of reaction: Quickly add 100 µL of Stop Solution to each well to terminate the reaction.

[0071] (10) Plate reading: Within 10 minutes of terminating the reaction, quickly detect the absorbance at a wavelength of 450 nm.

[0072] (11) The standard curve was fitted using the ELISA Calc software with a four-parameter equation, resulting in the standard curve equation and the four-parameter Logistic curve fitting equation: Y=0.23863+3.33206 / [1+(X / 44.60465)-1.74051], R 2 =0.9987.

[0073] 3. Identification of PNVs and EGF@PNVs by transmission electron microscopy (1) Drop 10 µL of plant vesicle solution onto a copper grid, let it stand for 10 min, and then use filter paper to absorb the excess solution along the edge of the copper grid.

[0074] (2) Drop 10 µL of 2% uranium acetate solution onto the copper mesh, let it stand in the dark for 10 min, and wipe the excess solution off the edge of the copper mesh with filter paper.

[0075] (3) Add 20 µL of PBS to the copper mesh, let it stand for 10 min, and wipe the excess solution from the edge of the copper mesh with filter paper.

[0076] (4) After drying the copper mesh at room temperature, take a picture with a transmission electron microscope.

[0077] 4. Particle size distribution and zeta potential measurement Dilute PNVs and EGF@PNVs to appropriate concentrations with PBS. Add the test solution to an inverted cuvette using a clean 5 mL syringe (without the needle removed), taking care to avoid generating air bubbles. Detect particle size distribution and zeta potential using a Zetasizer Pro instrument.

[0078] 5. Cell uptake experiment using laser confocal microscopy (1) Add DIO staining solution to 1 mL of PBS containing appropriate amounts of PNVs and EGF@PNVs, mix well, and incubate at 37°C in the dark for 15 min. Then incubate at 14000 g for 20 min, remove the supernatant, and wash once with PBS to remove free DIO dye. Repeat once. Finally, resuspend the precipitate in PBS for later use.

[0079] (2) with 10 5 The cell suspension of 1 cell per mL was evenly spread in a confocal culture dish and placed in an incubator for overnight culture. After the cells adhered, the culture medium was discarded, the cells were washed once with PBS, and 1 mL of fresh culture medium containing DIO-labeled PNVs and EGF@PNVs was added. The cells were then cultured for another 24 hours.

[0080] (3) Remove the confocal culture dish, discard the culture medium, wash twice with PBS, add 0.5 mL of paraformaldehyde solution and fix at room temperature for 15 min, discard the paraformaldehyde solution, continue to wash with PBS 3 times, add DAPI working solution, stain at room temperature in the dark for 10 min, discard the staining solution, wash 3 times with PBS, add 0.5 mL of PBS and observe and photograph under a laser confocal microscope.

[0081] 6. Flow cytometry assay for cell uptake (1) The steps of the DIO staining method are the same as above.

[0082] (2) with 10 5 The cell suspension of cells per mL was evenly spread in a six-well plate and allowed to adhere overnight. The culture medium was then discarded. 2 mL of fresh culture medium was added to the control group, while 2 mL of fresh culture medium containing DIO-labeled PNVs and EGF@PNVs was added to the experimental group. The cells were cultured for another 24 hours.

[0083] (3) The fluorescence intensity of DIO was detected in the FITC channel by flow cytometry.

[0084] II. Experimental Results To enhance the function of PNVs and verify their loading capacity, EGF, the most common drug used in clinical acute wounds, was loaded into PNVs to protect EGF from destruction and to explore whether it could play a synergistic role in wound healing.

[0085] 1. The shapes of PNVs and EGF@PNVs were identified using transmission electron microscopy, and the results are as follows: Figure 2 As shown in B and C, EGF was loaded onto PNVs by electrospinning, and the shape of the EGF-loaded PNVs was then identified. The results showed that the PNVs still maintained a nearly circular vesicle structure after electrospinning.

[0086] 2. The particle size distribution and zeta potential of PNVs and EGF@PNVs were identified using dynamic light scattering, and the results are as follows: Figure 2 As shown in D and E, the particle size of both PNVs and drug-loaded PNVs is concentrated around 146.1 nm, which is consistent with the diameter range of plant-derived exosomes reported in the literature (50–500 nm). The potential of PNVs is -20.29 ± 0.2787 mV, and the potential of EGF@PNVs is -20.7 ± 0.2621 mV. There is no statistically significant difference between the two, which is also consistent with the potential range of plant-derived exosomes reported in the literature (-25 to -15 mV).

[0087] 3. The ability of PNVs to load EGF was tested using ELISA, and the results are as follows: Figure 2 As shown in F, the encapsulation efficiency of the PNVs loaded with EGF is 16.37 ± 1.574%.

[0088] 4. To further verify that PNVs and EGF@PNVs can be taken up by cells, PNVs and EGF@PNVs with lipid structures were labeled with DIO dye emitting green fluorescence, and cell nuclei were labeled with DAPI dye emitting blue fluorescence. Fluorescence analysis was then performed using two-photon laser confocal scanning microscopy. The results are as follows: Figure 3 As shown in Figure A, PNVs and EGF@PNVs are distributed around the cell nucleus. Simultaneously, flow cytometry was used to detect the DIO fluorescence intensity of HaCaT cells and L929 cells after 24 hours of incubation with DIO-PNVs and DIO-EGF@PNVs, respectively. The results are shown in Figure A. Figure 3 As shown in Figure B, strong fluorescence was detected in both L929 cells and HaCaT cells, and the affinity of PNVs and EGF@PNVs for HaCaT cells was stronger than that for L929 cells.

[0089] In summary, after extracting PNVs by differential centrifugation, EGF was successfully loaded onto PNVs via electroporation (i.e., EGF@PNVs) without altering the original shape, particle size, or potential of the PNVs. Both PNVs and EGF@PNVs could be taken up by L929 cells and HaCaT cells, indicating that electroporation did not change the cellular uptake properties of PNVs, and that they may exhibit physiological activity after cellular uptake.

[0090] Example 3: Network pharmacology prediction of the mechanism of action of PNVs in wound healing To explore how PNVs exert therapeutic effects in acute wounds, ginsenoside Rb1, ginsenoside Rg1, notoginsenoside R1, ginsenoside Rg3, ginsenoside F2, and ginsenoside Rd were incorporated into a network pharmacology study, using network pharmacology to predict potential mechanisms and targets.

[0091] Analysis of the targets of these 6 small molecule compounds yielded 287 targets. Screening using the OMIM, TDD, and GeneCards databases identified 1326 disease targets. Venn diagram analysis of the Panax notoginseng chemical components and wound healing targets yielded 105 overlapping targets. Further protein-protein interaction analysis of these overlapping targets resulted in a PPI network, identifying the top 15 key targets, with MMP9, AKT1, and EGFR ranking in the top three. Figure 4 MMPs can cleave most ECM components and can proteolytically modify many signaling molecules that play an important role in wound healing. Among them, MMP9 affects the migration of keratinocytes, and MMP9 knockout mice also show delayed wound healing. EGFR activation leads to the activation of the MAPK signaling pathway, including AKT activation, thereby regulating cell proliferation, differentiation and migration.

[0092] GO enrichment analysis yielded 453 items for biological processes, 69 items for cellular components, and 111 items for molecular functions. The top twenty items were selected based on p-values. Figure 5 Among the biological processes enriched were the positive regulation of cell proliferation, positive regulation of cell migration, positive regulation of MAPK cascade, positive regulation of PI3K signaling, and collagen catabolism. From this, we can derive a hypothesis: the small molecule compounds carried by PNVs may promote cell proliferation and migration by positively regulating the MAPK or PI3K signaling pathway, thereby promoting wound healing.

[0093] 142 signaling pathways were obtained in the KEGG enrichment analysis, and the top ten items were selected based on the p-value. Figure 6It is enriched in the PI3K / AKT signaling pathway, MAPK signaling pathway, and Ras signaling pathway, all of which play an important regulatory role in cell proliferation, migration, and invasion.

[0094] The small molecule compounds carried by the PNVs were then verified by LC-MS. Figure 7 The results showed that PNVs carried small molecule compounds that promote wound healing, such as ginsenoside Rg1, notoginsenoside R1, ginsenoside Rg3, and ginsenoside F2. This means that PNVs can exert their wound-healing effect through the small molecule compounds they carry. It also demonstrates that network pharmacology can, to some extent, predict the effects and mechanisms of action of PELNVs in traditional Chinese medicine plants through small molecule compounds.

[0095] Example 4: miRNA sequencing analysis and functional verification of PNVs I. Experimental Methods 1. pno-miRNA transfection (1) Taking a 96-well plate as an example, add 10 μL of serum-free culture medium and 0.5 μL of GP-transfect-Mate transfection reagent to a 1.5 mL centrifuge tube, mix gently, and let stand at room temperature for 5 min.

[0096] (2) At the same time, add 10 μL of serum-free culture medium and 20 pmol of RNA oligo to another 1.5 mL centrifuge tube, mix gently, and let stand at room temperature for 5 min.

[0097] (3) Add the GP-transfect-Mate- medium mixture to the RNA oligo medium mixture, mix gently, let stand at room temperature for 15 min, and then immediately add it to the cell culture system for transfection.

[0098] (4) While the plate is standing, replace the 96-well plate with 80 μL of fresh complete culture medium.

[0099] (5) Add 20 µL of transfection mixture to the wells. After adding, gently shake the plate to distribute the complex evenly. The final volume is 100 µL.

[0100] (6) Continue culturing for 24–72 h to detect mRNA expression, and culturing for 48–96 h to detect protein expression.

[0101] II. Experimental Results 1. miRNAs are a class of small non-coding RNAs that participate in physiological and pathological processes by regulating gene expression. They can be carried to target cells by exosomes or extracellular vesicles to exert physiological activities and play an important role in regulating inflammation, intestinal barrier, tumors and immune function.

[0102] Sequencing analysis of miRNAs in PNVs revealed 176 known plant miRNA sequences, collectively named pno-miRNAs. Target enrichment prediction analysis was performed on the top 20 pno-miRNA sequences by read count, showing enrichment in the PI3K / AKT signaling pathway, MAPK signaling pathway, Focal adhesion, and RHO GTPase cycle, all closely related to cell proliferation and migration. Therefore, it is hypothesized that these pno-miRNAs may promote wound healing by stimulating cell proliferation and migration.

[0103] 2. First, the three most abundant pno-miRNAs were used to verify their effects on HaCaT cell proliferation. The results showed that pno-miRNA 159 (uuuggauugaagggagcucua, SEQ ID NO.1), pno-miRNA 168 (ucgcuuggugcaggucgggac, SEQ ID NO.2), and pno-miRNA 164 (uggagaagcagggcacgugca, SEQ ID NO.3) all had varying degrees of proliferative effects on HaCaT cells, with pno-miRNA 159 exhibiting the strongest proliferative effect. Figure 8 A). Then, transfection of RAW264.7 cells with pno-miRNA 159 showed a slight promoting effect on CD86 expression. Figure 8 B). This suggests that PNVs may exert pharmacological effects on wound healing through miRNAs.

[0104] Example 5: PNVS upregulates the EGFR / PI3K / AKT signaling pathway to promote HaCaT cell proliferation and migration. I. Experimental Methods 1. Cell scratch assay 10 per hole 6 Cells were evenly seeded at a density of [number] cells / mL into six-well plates. After confluence, a 200 μL pipette tip was used to draw crosshairs perpendicular to the wells to observe four fields of view (top, bottom, left, and right). The plates were then washed three times with PBS, and the cells were examined under a microscope for any residual cells in the center of the scratches. Drug treatment was then administered, and images were taken under a microscope at 0h and 24h. The scratch area was analyzed using ImageJ software, and the migration rate was calculated using the following formula:

[0105] 2. CFSE proliferation experiment After digestion and centrifugation, the cells were washed once with PBS. The cell pellet was then resuspended in 1 mL of PBS, and an appropriate amount of CFSE solution was added. The cells were incubated at 37°C in the dark for 15 min. Then, 5 mL of complete culture medium was added, and the staining was stopped by incubation at room temperature for 2 min. The cells were then centrifuged at 800 rpm for 5 min, and the supernatant was discarded. The cell pellet was washed three times with PBS. Finally, the cell pellet was resuspended in complete culture medium and centrifuged at 10⁻⁶ ppm. 5 Cells were seeded at a density of cells / mL in 12-well plates, and CFSE fluorescence was detected by flow cytometry in the FITC channel at 0 and 48 hours.

[0106] 3. Effects of PNVs treatment on conditioned medium for RAW264.7 cells on the proliferation of L929 cells. (1) RAW264.7 cells were sputtered at 1000 cells per well. 6 Cells were evenly seeded into six-well plates at a density of cells / mL, allowed to adhere overnight, the supernatant was removed, culture medium containing the drug solution was added, and the cells were induced for 24 hours. The drug-containing culture medium was then discarded, and fresh culture medium was added to continue culturing for another 24 hours. The cell culture supernatant was then collected for later use.

[0107] (2) Take L929 cells in the logarithmic growth phase, stain them with CFSE, and use 10 cells per well. 6 Cells were seeded at a density of 1 cell / mL into six-well plates and allowed to adhere overnight.

[0108] (3) Take 500 μL of RAW264.7 cell supernatant and 1.5 mL of fresh culture medium and add them to the L929 cell culture system. Continue to culture for 24 hours, and then use flow cytometry to detect CFSE fluorescence in the FITC channel.

[0109] II. Experimental Results 1. First, the CCK8 activity assay was used to verify the effect of PNVs on HaCaT cell proliferation. The results showed that PNVs promoted HaCaT cell proliferation in a concentration-dependent manner at concentrations of 5 μg / mL, 10 μg / mL, 15 μg / mL, 20 μg / mL, 25 μg / mL, and 30 μg / mL. Figure 9 A).

[0110] To further verify the mechanism by which PNVs promote cell proliferation, Western blot analysis was performed on the EGFR / PI3K / AKT pathway. The results showed that at concentrations of 10 μg / mL, 20 μg / mL, and 30 μg / mL, the protein expression of p-EGFR, p-PI3K, and p-AKT was upregulated in a concentration-dependent manner. Figure 9(B) indicates that PNVs promote HaCaT cell proliferation by activating the EGFR / PI3K / AKT signaling pathway. Within a concentration range of 30 μg / mL, the promotion of HaCaT cell proliferation and activation of the EGFR / PI3K / AKT pathway by PNVs became more pronounced with increasing concentration. Therefore, a concentration of 30 μg / mL of PNVs was selected for the following experiments.

[0111] 2. Th1, Th2 and Th17 cells, CD4+ T cells, CD8+ T cells, Tregs cells, etc., all participate in the wound repair process. They promote wound healing by defending against the invasion of pathogenic microorganisms, regulating the activity of other immune cells, and promoting re-epithelialization and matrix remodeling.

[0112] Jurkat cells (T lymphocyte line) were treated with PNVs at 30 μg / mL to verify whether PNVs affected T cell proliferation and activation. Flow cytometry results showed that PNVs had a slight proliferative effect on Jurkat cells. Figure 10 A).

[0113] M1 macrophages secrete IL-1, TNF-α, FGF-2, PDGF, VEGF, etc., which can mobilize and recruit more immune cells, and then further induce the proliferation and migration of keratinocytes and fibroblasts, thereby promoting the wound healing process.

[0114] RAW264.7 cells (monocyte-macrophage cell line) were stimulated with PNVs at 30 μg / mL. Flow cytometry results showed that PNVs promoted CD86 expression in RAW264.7 cells. Figure 10 B) indicates that PNVs may promote the polarization of monocytes and macrophages towards the M1 type.

[0115] 3. Further investigation was conducted on how PNVs regulate the activity of monocytes and macrophages to promote wound healing. The supernatant of the culture medium from PNV-stimulated RAW264.7 cells was collected and added to the mouse fibroblast L929 cell culture system to explore the performance of fibroblasts.

[0116] Cell scratch assay ( Figure 11 A) and CFSE flow cytometry experiments ( Figure 11 B) The results showed that PNVs-treated RAW264.7 cell supernatant promoted L929 cell migration and proliferation. P <0.005).

[0117] 4. It is known that TNF-α can promote EMT, enhance the stemness of tumor cells, induce mesenchymal features in wound healing, mediate BMP-induced EMT to promote wound healing, and also enhance the effect of TGF-β-induced EMT. Therefore, in order to explore the reason why PNVs treated with the supernatant of monocyte / macrophage culture medium promote the proliferation and migration of mouse fibroblasts, the content of TNF-α secreted in the supernatant of culture medium was verified by ELISA. The results showed that ( Figure 11 C) PNVs treatment significantly increased the secretion of TNF-α in RAW264.7 cells. P <0.0001). Simultaneously, the mRNA levels of EMT marker proteins and transcription factors in L929 cells were detected, and the results showed ( Figure 11 D) The conditioned medium upregulated the mRNA levels of N-cadherin, vimentin, Slug, and ZEB1, and downregulated the mRNA levels of E-cadherin, indicating that it promoted EMT in L929 cells. This suggests that PNVs can promote cell proliferation and migration, thereby promoting wound healing, by regulating the immune activity of monocytes and macrophages and secreting TNF-α to promote EMT in fibroblasts.

[0118] Example 6: EGF@PNVs promote skin cell proliferation The above results have demonstrated the direct and indirect proliferative effects of PNVs, while the promotion of skin cell proliferation by EGF is undeniable. Next, flow cytometry was used to explore whether the proliferative effect of EGF@PNVs was superior to that of PNVs and EGF. The dosage of EGF was calculated based on the encapsulation efficiency; therefore, three experimental groups were set up: PNVs 30 μg / mL, EGF 50 ng / mL, and EGF@PNVs 30 μg / mL for subsequent experiments.

[0119] Flow cytometry results of HaCaT cell proliferation showed ( Figure 12 A): The proliferation rate in the Control group was 5.463 ± 0.04807%, the proliferation rate in the PNVs group was 26.73 ± 0.2848%, the proliferation rate in the EGF group was 26.53 ± 1.354%, and the proliferation rate in the EGF@PNVs group was 38.57 ± 2.092%. All three groups (PNVs, EGF, and EGF@PNVs) showed significant proliferation-promoting effects compared to the Control group. P <0.0001), PNVs and EGF had weaker proliferative effects than EGF@PNVs ( P <0.01), while there was no statistically significant difference between PNVs and EGF ( P>0.05). This means that PNVs, EGF, and EGF@PNVs all promote the proliferation of HaCaT cells. The proliferative effect of PNVs is comparable to that of EGF, while the proliferative effect of EGF@PNVs is stronger than that of PNVs and EGF alone.

[0120] Flow cytometry results of L929 cell proliferation showed ( Figure 12 B): The proliferation rate in the Control group was 55.10 ± 0.3480%, the proliferation rate in the PNVs group was 83.63 ± 0.2848%, the proliferation rate in the EGF group was 74.30 ± 0.3055%, and the proliferation rate in the EGF@PNVs group was 90.97 ± 0.9262%. All three groups (PNVs, EGF, and EGF@PNVs) showed significant proliferation-promoting effects compared to the Control group. P <0.0001), PNVs also have a stronger proliferative effect than EGF ( P <0.0001), while the proliferative effect of EGF@PNVs was significantly stronger than that of PNVs ( P <0.01) and EGF ( P <0.0001). The results showed that PNVs, EGF, and EGF@PNVs all promoted the proliferation of L929 cells. The proliferative effect of PNVs was stronger than that of EGF, and the proliferative effect of EGF@PNVs was stronger than that of PNVs and EGF alone.

[0121] In summary, PNVs, EGF, and EGF@PNVs all promote skin cell proliferation, with EGF@PNVs being the most potent. The proliferative effect of PNVs is comparable to or stronger than that of EGF.

[0122] Example 7: EGF@PNVs promote skin cell migration When the skin is injured, re-epithelialization of the wound begins within hours of injury. This re-epithelialization involves the migration and proliferation of keratinocytes from the wound edge, as well as stem cell differentiation. With re-epithelialization, basement membrane proteins reappear in a highly ordered, zipper-like manner from the wound edge inwards, and epidermal cells revert to their normal phenotype, firmly attaching again to the reconstructed basement membrane. Meanwhile, fibroblasts and the extracellular matrix they synthesize (called granulation tissue) begin to invade the wound environment approximately four days after injury. Before fibroblasts migrate to the wound surface, they specifically upregulate integrins that interact with the temporary matrix. Once fibroblasts have migrated into the wound, their primary function gradually shifts to collagen production. Therefore, the migration of keratinocytes and fibroblasts plays a crucial role in wound healing. This invention therefore validates the effects of EGF@PVVs on cell migration in HaCaT and L929 cells.

[0123] The results are as follows Figure 13 As shown, PNVs, EGF, and EGF@PNVs all promoted the migration of HaCaT cells and L929 cells. The migration rates of HaCaT cells were: Control group 49.67 ± 2.818%, PNVs group 68.95 ± 2.552%, EGF group 63.76 ± 2.529%, and EGF@PNVs group 81.80 ± 5.490%; the migration rates of L929 cells were: Control group 42.17 ± 1.894%, PNVs group 56.95 ± 2.947%, EGF group 57.88 ± 4.176%, and EGF@PNVs group 78.85 ± 4.885%. These results indicate that PNVs, EGF, and EGF@PNVs all promoted the migration of L929 cells and HaCaT cells, and the migration rates of the EGF@PNVs group were significantly different from those of the PNVs group and the EGF group, respectively. P <0.05), and the effect of PNVs in promoting cell migration is comparable to that of EGF ( P >0.05 (In general, EGF@PNVs have a more significant effect on promoting skin cell migration.)

[0124] Example 8: EGF@PNVs upregulate the mRNA expression of COL1A1 and MMP9 During wound healing, collagen synthesis and breakdown, as well as extracellular matrix (ECM) remodeling, occur continuously, and collagen breakdown is influenced by micromolecular protein (MMPs). MMPs can cleave most ECM components and proteolytically modify many signaling molecules that play crucial roles in wound healing. Mice with knockouts of MMP8, MMP9, MMP13, and MMP3 exhibit delayed wound healing, while MMP9 promotes keratinocyte migration. MMP1 is essential for re-epithelialization, cell elongation, actin cytoskeleton remodeling, basement membrane repair, and the promotion of ERK signaling. However, excessive MMP activity can also lead to insufficient collagen accumulation. During the remodeling phase, MMP activity is gradually inhibited by endogenous tissue inhibitors, resulting in collagen deposition, decreased vascular density, and the gradual maturation of granulation tissue composed of fibrin, collagen, capillaries, and fibroblasts, thus achieving wound healing. Therefore, the dynamic balance of MMP activity is crucial for the normal physiological activities of skin tissue cells.

[0125] Network pharmacology key targets were enriched in MMP9, while COL1A1 was predominant in normal skin. Therefore, this invention, using MMP9 and COL1A1 as representatives, explored the effects of EGF@PNVs on the mRNA expression of collagen and matrix metalloproteinases in HaCaT and L929 cells.

[0126] The results are as follows Figure 14 As shown, in HaCaT cells, PNVs, EGF, and EGF@PNVs all upregulated the mRNA expression of COL1A1 and MMP9, with the upregulation being more pronounced in the EGF@PNVs group. In L929 cells, PNVs, EGF, and EGF@PNVs all upregulated the mRNA expression of COL1A1 and MMP9. The EGF@PNVs group promoted the mRNA expression of COL1A1 and MMP9 more than the PNVs group, while there was no statistically significant difference between EGF@PNVs and EGF in the mRNA expression of COL1A1 and MMP9.

[0127] In summary, EGF@PNVs promoted the expression of collagen COL1A1 and matrix metalloproteinase MMP9 compared to EGF and PNVs alone, suggesting that EGF@PNVs may play an important role in the proliferative and remodeling phases of wound healing.

[0128] Example 9: EGF@PNVs promote skin wound healing in mice I. Experimental Methods 1. Establish a mouse skin wound model, as shown in the diagram ( Figure 15 ) (1) Anesthesia was performed by intraperitoneal injection of an appropriate amount of 1% pentobarbital. Then, hair was shaved and removed from the lower left side of the spine on the back. The skin was punched with an 8 mm skin puncher to the fascia layer to create a uniform skin incision.

[0129] (2) Mice were randomly divided into 5 groups (n=3): Model group (no treatment); blank control group (PBS) (5 mL / kg PBS); empty vesicle group (PNVs) (5 mg / kg PBS); EGF group (8 μg / kg EGF); and drug-loaded group (EGF@PNVs) (5 mg / kg EGF@PNVs).

[0130] (3) Treatment was administered to the wound site at 0:00 and 24:00. The weight changes of the mice were recorded daily, and the wounds of the mice were photographed every other day (using a circular control ring as a reference). The wound healing status was then analyzed using ImageJ software.

[0131] (4) On day 8, the mice were dissected and the wound-healed skin tissue was cut off to extract RNA and perform pathological analysis.

[0132] II. Experimental Results 1. First, the wound healing status of the mice was evaluated. Figure 16 (A and B), the results showed that on the fourth day, there was no significant statistical difference between the groups (P >0.05), on day 6, differences in wound healing began to appear among the groups. On day 8, the healing rate was 74.50 ± 2.346% in the Model group, 78.82 ± 5.039% in the PBS group, 86.15 ± 0.5359% in the PNVs group, 84.54 ± 0.6431% in the EGF group, and 91.90 ± 0.7267% in the EGF@PNVs group. There was no significant difference in wound healing rate between the PBS group and the Model group. The wound healing rates of the EGF group, PNVs group, and EGF@PNVs group were all significantly higher than those of the control group, and the wound healing rate of EGF@PNVs was also significantly higher than that of the EGF group and PNVs group, respectively, while there was no significant difference between the EGF group and PNVs group. During the treatment period, there were no significant differences in the growth curves of mice among the groups. Figure 16 C).

[0133] 2. Histopathological staining analysis of skin tissue sections from wound healing ( Figure 17 HE staining results showed that the EGF@PNVs group had a more intact skin structure, a thinner epidermis, and visible hair follicles and glands. Masson staining results showed that EGF@PNVs had more collagen fibers (blue) and a more orderly and regular arrangement compared to other groups. CD3 immunohistochemical staining results showed that EGF@PNVs had lower CD3+ expression compared to other groups, indicating lower T cell infiltration. The overall wound healing process was evaluated from a microstructural perspective; the wound healing tissue of EGF@PNVs was closer to normal skin, accelerating the wound healing process.

[0134] 3. Further analysis of the mRNA levels of inflammatory factors TNF-α and IL-1β in the local wound microenvironment revealed the following results: Figure 18 A and B): TNF-α and IL-1β were significantly decreased in the PNV group, EGF group, and EGF@PNVs group, with a more significant decrease in the EGF@PNVs group. This was consistent with the wound healing rate and CD3+ immunohistochemical results, indicating a negative correlation between wound healing degree and inflammation in the later stages of wound healing. Furthermore, the mild pro-inflammatory effect of PNVs in vitro did not affect the inflammatory response in the later stages of wound healing in vivo. The mRNA expression level of COL3A1 was also verified, and the results showed ( Figure 18 C) The mRNA level of COL3A1 in EGF@PNVs was significantly increased, consistent with the results of mouse wound healing rate and Masson staining.

[0135] In summary, PNVs promote HaCaT cell proliferation and migration by upregulating the EGFR / PI3K / AKT pathway. They not only directly promote L929 cell proliferation and migration but also indirectly promote cell proliferation and migration by regulating TNF-α secretion from RAW264.7 cells to promote EMT in L929 cells. The wound-healing effect of PNVs may be achieved through the small molecule compounds and miRNAs they carry. PNVs loaded with EGF exhibit stronger cell proliferation and migration-promoting effects in vitro and also show higher wound healing rates in a mouse skin wound model.

Claims

1. Use of Panax exosome-like nanovesicles in the preparation of a medicament for promoting wound healing.

2. Use of Panax exosome-like nanovesicles loaded with epidermal growth factor in the preparation of a medicament for promoting wound healing.

3. Use according to claim 1 or 2, characterized in that, The particle size of the Panax exosome-like nanovesicles is 100-200 nm.

4. Use according to claim 1 or 2, characterized in that, The electric potential of the Panax exosome-like nanovesicles is 19-22 mV.

5. The use according to claim 1, characterized in that, The extraction method of the Panax exosome-like nanovesicles is to extract the broken Panax by differential centrifugation.

6. Use according to claim 2, characterized in that, The preparation method of the Panax exosome-like nanovesicles loaded with epidermal growth factor is to load epidermal growth factor into Panax exosome-like nanovesicles by electroporation.

7. Use according to claim 6, characterized in that, The mass ratio of the Panax exosome-like nanovesicles to epidermal growth factor is 98-102:

1.

8. Use according to claim 1 or 2, characterized in that, The concentration of the Panax exosome-like nanovesicles in the medicament is 20-50 μg / mL.

9. Use according to claim 1 or 2, characterized in that, The wound healing is acute wound healing.

10. Use according to claim 1 or 2, characterized in that, The medicament further comprises other pharmaceutically acceptable excipients.

Images