Self-replicating element, self-replicating RNA molecule and application thereof

Abstract

The invention belongs to the technical field of mRNA vaccines, and particularly relates to a self-replicating element, a self-replicating RNA molecule and application thereof. Aiming at the problems that the existing saRNA self-replicating element has cytotoxicity and can induce innate immune response in vivo, so that expression of target gene mRNA (messenger Ribonucleic Acid) is reduced, and further the treatment effect of vaccines and drugs is influenced, the invention provides the self-replicating element which is taken from a VEEVTC83 strain and has the advantages that the self-replicating element can be used for preparing the saRNA self-replicating element; the sequence of the non-structural protein nsP2 of the strain is directionally mutated to be as shown in SEQ ID NO. 1. Meanwhile, the invention also provides a self-replicating RNA molecule, a related vector and a cell. The saRNA vector disclosed by the invention has higher expression quantity and longer expression time on a target gene. The saRNA is used for expressing a tumor vaccine surrounding MUC16, and a vaccine with good prevention and treatment effects on MUC16 positive tumors can be prepared. Therefore, the invention has a good application prospect in the development of medicines and vaccines.

Description

Technical Field

[0001] This invention belongs to the field of mRNA vaccine technology, specifically relating to a self-replicating element, a self-replicating RNA molecule, and its uses. Background Technology

[0002] Currently, various mRNA vaccine platforms have been established both domestically and internationally, including traditional mRNA and self-replicating RNA (saRNA). Among them, most saRNA vaccines use sequences derived from the VEEV_TC83 strain. These sequences encode RNA polymerase, thereby prolonging RNA translation time and increasing antigen expression levels.

[0003] saRNAs are a class of mRNAs capable of self-replication using their own RNA sequences as templates. Compared to linear non-replicating mRNAs, saRNAs, in addition to having a 5' cap structure, a 3' polyA tail, a 5' untranslated region (5'-UTR), and a 3' untranslated region (3'-UTR), also introduce self-replicating elements upstream or downstream of the target gene. The main components of these self-replicating elements include virus-derived RNA-dependent RNA polymerases, functional proteins associated with viral RNA replication, and subgenomic promoters located upstream of the target gene.

[0004] Its working mechanism mimics the replication characteristics of positive single-stranded RNA viruses. By replacing the viral structural gene with the target antigen gene (GOI), it can significantly prolong the time of antigen expression, increase the amount of antigen expressed, and enhance the effectiveness of related immune responses after being delivered to the cytoplasm of target cells.

[0005] Currently, the self-replication elements used to prepare self-replicating RNA are mostly derived from alphaviruses, including Sindbisvirus (SIN), Semliki Forest virus (SFV), and Venezuelan equine encephalitis virus (VEEV). Some studies have also used genomic elements from flaviviruses, specifically Kunzin viruses, as self-replication elements for RNA. However, these unmodified viral genomic elements exhibit varying degrees of cytotoxicity when transfected into cultured cells in vitro, and can induce innate immune responses in vivo, leading to decreased expression of the target gene mRNA and consequently affecting the efficacy of vaccines and drug treatments. Therefore, there is an urgent need to develop a self-replication element that can easily enhance the in vivo expression of the target gene mRNA.

[0006] MUC16 (also known as CA125) is a high-molecular-weight transmembrane glycoprotein belonging to the mucin family. Normally distributed primarily on the surface of epithelial tissues, it plays a lubricating and barrier role. Its extracellular region is highly glycosylated, making it not only the source of CA125, the most commonly used serum biomarker for ovarian cancer in clinical practice, but also a crucial factor in tumorigenesis and development. MUC16 interacts with molecules such as NK cell receptors (e.g., Siglec-9) and mesothelin, promoting immune escape and peritoneal metastasis, while simultaneously reshaping the tumor immune microenvironment and enhancing tumor invasiveness and drug resistance. Clinical studies have shown that high expression of MUC16 often indicates ovarian cancer progression and poor prognosis; therefore, it is not only significant in diagnosis and efficacy monitoring but also serves as an important target for novel immunotherapies such as antibody drugs, bispecific antibodies, CAR-T cells, and vaccines.

[0007] Currently, there are no reports on the development of saRNA tumor vaccines using saRNA expressing MUC16-related immune peptides. Designing the saRNA sequence to achieve efficient and sustained expression of the target antigen will be a key challenge in developing saRNA tumor vaccines expressing MUC16. Summary of the Invention

[0008] The technical problem to be solved by this invention is that the self-replication element of existing saRNA is cytotoxic and can induce a natural immune response in vivo, leading to a decrease in the expression of the target gene mRNA, which in turn affects the efficacy of vaccines and drug treatments.

[0009] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: a self-replicating element is provided, wherein the self-replicating element is taken from the VEEV_TC83 strain, and the non-structural protein nsP2 of the strain is directionally mutated to the sequence shown in SEQ ID NO.1, specifically: cysteine ​​at position 14 is mutated to arginine, glycine at position 151 is mutated to arginine, phenylalanine at position 659 is mutated to serine, proline at position 713 is mutated to glycine, and glutamine at position 739 is mutated to leucine.

[0010] SEQ ID NO.1 Nucleotide sequence of nsP2 after mutation of VEEV_TC83 strain

[0011]

[0012] The present invention also provides a self-replicating RNA molecule, which comprises, from the 5' end to the 3' end, the following in sequence: a T7 promoter, a 5'UTR, a gene sequence of nsP1, a gene sequence of the mutated nsP2, a gene sequence of nsp3, a gene sequence of nsp4, a subgene promoter, a target gene sequence, a 3'UTR, and a PolyA tail.

[0013] In the aforementioned self-replicating RNA molecule, the gene sequence of nsP1 is shown in SEQ ID NO.3, the gene sequence of nsP3 is shown in SEQ ID NO.4, and the gene sequence of nsP4 is shown in SEQ ID NO.5; the nucleotide sequence of the promoter is shown in SEQ ID NO.6, the nucleotide sequence of the 5'UTR is shown in SEQ ID NO.7, the nucleotide sequence of the subgene promoter is shown in SEQ ID NO.8, the nucleotide sequence of the 3'UTR is shown in SEQ ID NO.9, and the nucleotide sequence of the PolyA tail is shown in SEQ ID NO.10.

[0014] Gene sequence of SEQ ID NO.3 nsP1

[0015]

[0016] Gene sequence of SEQ ID NO.4 nsP3

[0017]

[0018] Gene sequence of SEQ ID NO.5 nsP4

[0019]

[0020] Nucleotide sequence of the promoter of SEQ ID NO.6

[0021] TAATACGACTCACTATA.

[0022] Nucleotide sequence of SEQ ID NO.7 5'UTR

[0023] ATGGGCGGCGCATGAGAGAAGCCCAGACCAATTACCTACCCAAA.

[0024] Nucleotide sequence of the subgene promoter of SEQ ID NO.8

[0025] CCTGAATGGACTACGACATAGTCTAGTCCGCCAAGTTCTAGAGCCACC.

[0026] Nucleotide sequence of SEQ ID NO.9 3'UTR

[0027] GAATTGGCAAGCTGCTTACATAGAACTCGCGGCGATTGGCATGCCGCCTTAAAATTTTTATTTTATTTTTTCTTTTCTT TTCCGAATCGGGATTTTGTTTTTAATATTTC.

[0028] nucleotide sequence of SEQ ID NO.10 PolyA tail

[0029] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA.

[0030] In the aforementioned self-replicating RNA molecule, the target gene sequence is a MUC16-specific immune peptide gene sequence, an EGFP gene sequence, or a luciferase Luc gene sequence.

[0031] Furthermore, the MUC16-specific immune peptide gene sequence is shown in SEQ ID NO.2, the EGFP gene sequence is shown in SEQ ID NO.12, and the luciferase Luc gene sequence is shown in SEQ ID NO.13.

[0032] SEQ ID NO.2 MUC16 specific immune peptide gene sequence

[0033] ATGGTGAGCTTCACCATCAGCAACCTGCCCGGCTCCATCAACTTCACCATCACAAACCTGCCCGGAAGCTTCACAATCTCCAACCTGCCTTACCTGCCCGGCTCTATCAACTTCACAGTGACAAACCTGCCAGGCTCCAAGACCATCCCTAACGTGAACACCCTGCCTGGCTCCATCAATTTCACAATCATCAACCTGCCTGGCAGCGTGAACTTCACAATCAACAACCTGCCTGGAAGCTTCACCGTGACCAACGTGAACACAATCCCCGGCAGCTCCGCCATCTTCAACAGCACAGAGAACGTGCTGCCTGGCTCTAGCTCCCTGGACTTCCTGGCCGCCCTGCCTGGCAGTAGCCTGTACTCCAACTGTAGGCTGGCCAGCCTGAGGCCCAAGAAGAACGGCACCGCCACAGGCGTGAACGCCATCTGCTCCTACCACCAGAACCCCGGCTCCACCCTGGATAGGAAGTCCGTGTTCGTGGATGGCTACAGCCAGAACAGAGACGACCCCGGCAGCAAGAGCTACTTCAGCGACTGCCAGGTGCTGGCCTTCAGAAGCGTGAGCAACAACAACAACCACACCGGCGTGGATAGCCTGTGCAACTTCAGCCCCTTGCCTGGCAGCAACTTCTCCCCTCTGGCCAGAAGAGTGGACAGAGTGGCCATCTACGAGGAGCCCGGCTCCACACTGGACAGAAAGAGCGTGTTCGTGGACGGCTACAGCCAAAACAGGGACGATCCTGGCTCCGGCTACAGCCAGAATAGAGACGATGATGTGATGAAGAACAGCGGCCTGCCTTTCTGGGCCCTCGAG。

[0034] SEQ ID NO.12 EGFP gene sequence

[0035] GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA。

[0036] SEQ ID NO.13 Luciferase Luc gene sequence

[0037]

[0038] Using the aforementioned target gene as an example, this application verifies that the self-replicating RNA molecule of this application can enhance the expression of the target gene in vivo. However, it is not limited to the aforementioned target gene. The self-replicating RNA molecule of this application can also bind to other target genes to promote the expression of other target genes in vivo.

[0039] The present invention also provides a nucleic acid encoding the above-mentioned self-replicating element or self-replicating RNA molecule.

[0040] Furthermore, the present invention also provides a vector comprising the above-described encoded nucleic acid.

[0041] Preferably, the nucleotide sequence of the vector is shown in SEQ ID NO.11.

[0042] Furthermore, the present invention also provides a cell comprising the above-described carrier.

[0043] The present invention also provides the use of the above-mentioned self-replicating element, self-replicating RNA molecule, encoding nucleic acid, vector or cell in the preparation of a pharmaceutical composition for the prevention or treatment of a disease.

[0044] Preferably, in the above-described uses, the pharmaceutical composition is a drug for the prevention or treatment of tumors. Further, the drug also includes pharmaceutically acceptable excipients.

[0045] Furthermore, the present invention also provides a self-replicating RNA vaccine, which is prepared by constructing a plasmid from the DNA sequence shown in SEQ ID NO.11, expressing and purifying it.

[0046] The present invention also provides the use of the above-described self-replicating RNA vaccine in the preparation of a medicament for the prevention or treatment of tumors.

[0047] Furthermore, in the above-mentioned uses, the tumor includes MUC16-positive tumors such as ovarian cancer.

[0048] The beneficial effects of this invention are as follows:

[0049] This invention, through specific mutations in the nsP2 region of the replication backbone in the saRNA vector, yielded an optimized self-replicating element, resulting in a highly efficient and persistent self-replicating RNA molecule that expresses antigens. The mutated self-replicating RNA molecule exhibits higher expression levels and longer duration of target genes (such as the MUC16 antigen and luciferase Luc), enabling more efficient translation of target genes and high-efficiency expression of target proteins. This provides fundamental support for the development of self-replicating mRNA vaccines. Furthermore, this invention provides a self-replicating mRNA vaccine expressing MUC16, demonstrating improved preventative and therapeutic effects against MUC16-positive tumors.

[0050] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions, or alterations can be made without departing from the basic technical concept of the present invention.

[0051] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description

[0052] Figure 1 nsP2 in Example 3 S14R,G151R,F659S,P713G,Q739L -MUC16-neoantigen-saRNA vector map;

[0053] Figure 2 For example 4, nsP2 after mutation, nsP2 S14R,G151R,F659S,P713G , Q739L Graph of EGFP-saRNA expression level in HeLa cells;

[0054] Figure 3 For example 5, live imaging detection of nsP2 S14R,G151R,F659S,P713G , Q739L - Expression level of Luc-saRNA in mice;

[0055] Figure 4 This is an experimental example of the present invention, 6nsP2. S14R,G151R,F659S,P713G,Q739L -Graph of protein expression levels of the MUC16-neoantigen-saRNA vaccine in cells;

[0056] Figure 5 This is an experimental example of the present invention, 7nsP2. S14R,G151R,F659S,P713G,Q739L-Graph showing the prophylactic effect of the MUC16-neoantigen-saRNA vaccine on colorectal cancer with overexpression of human-MUC16;

[0057] Figure 6 This is an experimental example of the present invention, 8nsP2. S14R,G151R,F659S,P713G,Q739L -Image showing the therapeutic effect of the MUC16-neoantigen-saRNA vaccine on colorectal tumors overexpressing human-MUC16. Detailed Implementation

[0058] The following specific embodiments will be provided to explain the solution of the present invention. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0059] In this invention, the nsP2 point mutation saRNA vector refers to the mutation of key sites of non-structural protein 2 (nsP2) of VEEV strain using genetic engineering and artificial intelligence-assisted technology, and finally screening to obtain the 5 sites with the highest mutation rate (as shown in Table 1).

[0060] Table 1 shows the different nsP2 mutation sites obtained after screening.

[0061] mutation Nucleotide mutation Amino acid mutation S14R AGC-AGA SR G151R GGG-CGG GR F659S TTC-TCC FS P713G CCC-GGC PG Q739L CAG-CTG QL

[0062] Example 1: Constructing a saRNA vector with site-directed nsP2 mutation and transcribing EGFP-saRNA.

[0063] In this embodiment, the EGFP gene fragment (as shown in SEQ ID NO:12) was cloned into a saRNA vector with five mutations at nsP2 to obtain a recombinant plasmid capable of expressing EGFP-saRNA. Then, it was transcribed to obtain saRNA expressing EGFP. The specific process is as follows:

[0064] 1.1 Plasmid Synthesis and Extraction

[0065] The plasmids were synthesized by General Biotech Co., Ltd., and plasmid extraction was performed using an endotoxin-free plasmid extraction kit (purchased from Tiangen Biotech Co., Ltd.). The extracted plasmids were then digested with restriction endonucleases to form linearized plasmids, which were used as transcription templates. The specific enzyme digestion steps for in vitro transcription to prepare saRNA are as follows:

[0066] 1.2 Preparation of Linearization Templates

[0067] Take 100 μg of the above-mentioned EGFP-saRNA recombinant plasmid carrying the nsP2 mutation, and prepare a 100 μL Mlu-1 restriction endonuclease (100 U) digestion system to linearize 10 μg of the plasmid. Incubate at 37℃ for 2 h.

[0068] 1.3 Purification of linearized plasmid DNA by phenol-chloroform precipitation method

[0069] After incubation, add 100 μL of phenol:chloroform extraction to the system, vortex, centrifuge at 13000 rpm for 1 min, and transfer the supernatant to a new nuclease-free centrifuge tube. Add another 100 μL of nuclease-free water to the original system, vortex, centrifuge at 13000 rpm for 1 min, discard the supernatant, and transfer it to the same centrifuge tube. Add 200 μL of chloroform to the EP tube, vortex, and centrifuge at 13000 rpm for 5 min. Transfer 200 μL of the supernatant to a new nuclease-free centrifuge tube. Then add 1 / 10 volume of 3M pH5.2 NaAc (20 μL) and 3 volumes of pre-chilled 100% ethanol (600 μL), and mix gently. Precipitate at -20°C for 20 minutes or overnight. Afterward, centrifuge at 13000 rpm for 15 min at 4°C, carefully remove the supernatant, and gently wash the precipitate with 1 mL of 75% ethanol. Centrifuge again at 13000 rpm for 15 min at 4°C, and remove all supernatant. Open the tube cap and let it stand for about 5-10 minutes to evaporate residual ethanol. Finally, add 15 μL of nuclease-free water to dissolve the precipitate, and determine the DNA concentration using Nanodrop. This is used for subsequent in vitro transcription.

[0070] 1.4 In vitro transcription

[0071] For the linearized template DNA sequence, vortex all components except for the T7 RNA Polymerase Mix, briefly centrifuge to collect the residue at the bottom of the tube, and store on ice for later use. Prepare the system according to Table 2. Here, "Template" refers to the purified linearized template described in 1.2. Use T7 RNA polymerase to generate mRNA on the linearized plasmid (the transcription system for the template DNA is shown in Table 2). Gently mix each component with a pipette, briefly centrifuge to collect the residue, and incubate at 37°C for 3 hours. Add 1 μL of DNase I to the reaction system and incubate at 37°C for 15 minutes to digest the transcribed DNA template. Purify using standard methods, specifically lithium chloride precipitation, to obtain the corresponding mRNA.

[0072] Table 2. Composition of the transcription system using linearized DNA template.

[0073] Reaction components Add volume T7 RNA polymerase mixture 2μL 10X Transcription Buffer 2μL Template 0.5-2μg ATP solution 2μL CTP solution 2μL GTP solution 2μL UTP solution 2μL Enzyme-free water Add to 20μL

[0074] 1.5saRNA capping and purification

[0075] The 5' cap is essential for mRNA to bind to the ribosome to initiate protein synthesis; the mRNA cap also helps protect mRNA from degradation by nucleases. In enzymatic capping, RNA from IVT is capped using specialized enzymes. saRNA is also capped enzymatically, specifically using vaccinia virus capping enzyme (VCE) and 2'O-methyltransferase. All saRNAs were analyzed by agarose gel electrophoresis after capping and stored frozen at -80°C.

[0076] The above mutations can promote the binding of nsP2 with nsP1, nsP3, and nsP4 to form polymerase complex RdRp while maintaining the normal function of nsP2, thereby increasing the expression of the target antigen.

[0077] 1.6 Encapsulation of saRNA-LNP

[0078] The EGFP-saRNA prepared above was conjugated with lipid nanoparticles (LNPs) for delivery. Lipid-ethanol solutions were prepared by dissolving cationic lipids (SM-102), auxiliary lipids (DSPC), cholesterol, and PEGylated lipids (such as DMG-PEG2000) in ethanol according to the molar percentages shown in Table 3.

[0079] EGFP-saRNA was diluted with citrate-sodium citrate buffer (pH=4.5) for later use. Further, using microfluidic technology, the organic phase containing lipid molecules (SM-102, DSPC, cholesterol, DMG-PEG2000) and the aqueous phase containing nucleic acid molecules (diluted with citrate-sodium citrate buffer (pH=4.5)) were thoroughly mixed, with an N:P ratio of 6 for the LNP and mRNA mixture. The organic solvent, nsP2, was then removed using ultrafiltration. S14R,G151R,F659S,P713G , Q739L -EGFP-saRNA.

[0080] Table 3. Components and proportions of LNP

[0081] Components mole percentage SM102 50％ DMG-PEG2000 1.5％ DSPC 10％ cholesterol 38.5％

[0082] Example 2 nsP2 S14R,G151R,F659S,P713G , Q739L -LUC-saRNA transcription and encapsulation

[0083] The construction of saRNA in this embodiment is the same as in Example 1, except that the EGFP gene is replaced with the expression Luc gene (sequence shown in SEQ ID NO:13), and the mRNA product is encapsulated using lipid nanoparticles (LNPs). The product in this embodiment is denoted as nsP2.S14R,G151R,F659S,P713G,Q739L -LUC-saRNA.

[0084] Example 3 nsP2 S14R,G151R,F659S,P713G,Q739L -MUC16-neoantigen-saRNA transcription and encapsulation

[0085] The construction of saRNA in this embodiment is the same as in Example 1, except that the EGFP gene is replaced with a gene expressing the MUC16-related immune peptide (SEQ ID NO.2). The constructed map is as follows. Figure 1 As shown. The product of this embodiment is denoted as nsP2. S14R ,G151R,F659S,P713G,Q739L -MUC16-neoantigen-saRNA vaccine.

[0086] In the following experiments, the samples used were prepared in accordance with Example 1, Example 2 or Example 3.

[0087] Experimental Example 4 nsP2 S14R,G151R,F659S,P713G , Q739L -EGFP-saRNA and nsP2 wt Comparison of EGFP expression levels in HeLa cells transfected with EGFP-saRNA

[0088] After HeLa cells were cultured to 70% confluence in 24-well plates, they were transfected with the following two groups of saRNAs using LNP encapsulation: (1) nsP2 S14R,G151R,F659S,P713G , Q739L -EGFP-saRNA (nsP2) mut (-EGFP-saRNA); (2) nsP2 wt -EGFP-saRNA. Biological replicates (n=3) were set up for each group. Samples were collected after 24h, 72h, and 120h of post-transfection culture for the following two parallel assays: fluorescence microscopy imaging and acquisition of representative images (with identical exposure and gain settings).

[0089] The test results are as follows Figure 2 As shown, the results indicate that the nsP2 provided in this application... mut -EGFP-saRNA compared to nsP2 made from unmutated nsP2 wt -EGFP-saRNA exhibits higher and more persistent expression levels.

[0090] Experimental Example 5 nsP2 S14R,G151R,F659S,P713G , Q739L -LUC-saRNA and nsP2 wt Comparison of expression levels and duration of -LUC-saRNA in mice

[0091] The experimental components of this experiment are: (1) nsP2 S14R,G151R,F659S,P713G,Q739L -LUC-saRNA (nsP2) mut (2) nsP2 wt -LUC-saRNA.

[0092] 5 female BALB / c mice (n=5) were intravenously injected into the tail portion with 5 μg nsP2. mut -LUC-saRNA or nsP2 wt -LUC-saRNA was injected, and changes in Luc expression in mice were observed at 5, 10, 15, and 20 days after injection. Luc expression was detected using a small animal in vivo imaging system (PerkinElmerIVIS Lumina III). 200 μL of fluorescein potassium salt (30 mg / mL) was injected intraperitoneally 10 minutes before measurement.

[0093] The test results are as follows Figure 3 As shown, the results indicate that the nsP2 provided by this invention... mut -LUC-saRNA compared to nsP2 made from unmutated nsP2 wt -LUC-saRNA exhibits higher and more persistent expression levels.

[0094] Experimental Example 6 nsP2 S14R,G151R,F659S,P713G,Q739L In vitro expression level detection of -MUC16-neoantigen-saRNA vaccine

[0095] The experimental components of this experiment are: (1) nsP2 S14R,G151R,F659S,P713G,Q739L -MUC16-neoantigen-saRNA, abbreviated as nsP2 mut -MUC16-neoantigen-saRNA); (2)nsP2 wt -MUC16-neoantigen-saRNA.

[0096] Prepare 12 mL of complete culture medium (DMEM (PM150210) + 10% FBS (164210-50) + 1% P / S (PB180120) beforehand. Seed HEK293T (human embryonic kidney cells) cells into 24-well plates. After culturing the next day, the cells reached 60% confluence. Add nsP2 to each well. S14R,G151R,F659S,P713G,Q739L -MUC16-neoantigen-saRNA and nsP2 wt Mix 1 μg of MUC16-neoantigen-saRNA into a 37°C incubator and incubate for 24 h, 72 h, and 120 h before extracting the protein.

[0097] The expression of the target protein was detected using Western blotting, and the specific method is as follows:

[0098] (1) Collect HEK293T expression cells from different groups into 1.5mL EP tubes, centrifuge at 1000rpm for 5min, wash once with PBS, and centrifuge at 1000rpm for 5min.

[0099] (2) Add 100 μL of RIPA (with added protease inhibitor) to each well, lyse on ice for 30 min, centrifuge at 12000 rpm and 4℃ for 10 min, and collect the supernatant into a 1.5 mL EP tube.

[0100] (3) Sample electrophoresis, sample preparation, add 5X sample loading buffer, 100℃ metal bath for 5 min; prepare electrophoresis buffer, protein sample loading, sample loading volume of 15 μL per well; 80V electrophoresis for 10 min, 150V electrophoresis for 40 min.

[0101] (4) Transfer membrane: pry open the electrophoresis gel plate, cut out the gel and put it into the transfer solution, prepare the PVDF membrane, and place one filter paper, gel, PVDF membrane and one filter paper in order from top to bottom. Assemble the transfer tank, add the transfer solution, and perform wet transfer at room temperature 400mA for 60 minutes.

[0102] (5) After the transfer is completed, cut the PVDF membrane and seal it with 5% skim milk at room temperature for 1 hour; rinse once with TBST for 5 minutes.

[0103] (6) Primary antibody was left to stand overnight at 4°C; TBST was used to rinse 3 times, 5 min each time.

[0104] (7) Secondary antibody shaker at room temperature for 2 hours; TBST rinse 3 times, 5 min each time.

[0105] (8) Color development: Mix solution A and solution B of ECL luminescent agent in a 1:1 ratio and add them dropwise to the PVDF film with protein side.

[0106] Exposure, development, photography, and data processing are all conducted in a darkroom.

[0107] The developed bands were processed and analyzed using ImageJ software, and the results are as follows: Figure 4 As shown, the results indicate that: with nsP2 wt Compared to the -MUC16-neoantigen-saRNA group, nsP2 mut -MUC16-neoantigen-saRNA can effectively increase the expression level of the target protein.

[0108] Experimental Example 7 nsP2 S14R,G151R,F659S,P713G,Q739L Efficacy verification of the -MUC16-neoantigen-saRNA vaccine in the treatment and prevention of melanoma

[0109] This experimental example provides nsP2 S14R,G151R,F659S,P713G,Q739L -MUC16-neoantigen-saRNA(nsP2 mut The experimental procedure for validating the therapeutic and preventive efficacy of the MUC16-neoantigen-saRNA vaccine in treating and preventing tumors is as follows:

[0110] Establishment of a subcutaneous MUC16-positive mouse melanoma model: Eighteen healthy 6-8 week old C57BL / 6 mice were selected and subcutaneously injected with 5 × 10⁶ human-MUC16-B16F10 cells. 5 / each, the cells overexpress human MUC16, and the number of mice in each group was 6.

[0111] In a tumor treatment experiment, C57BL / 6 mice were given the first dose on day 5 after inoculation with melanoma cells, followed by a second dose 7 days later, for a total of 3 doses. The control group received PBS, while the other two groups received nsP2. wt -MUC16-neoantigen-saRNA and nsP2 mut Immunotherapy with -MUC16-neoantigen-saRNA was administered at a volume of 50 μL (10 μg / mouse / treatment). Tumor size in mice was measured at regular intervals using calipers on days 8, 14, 17, 21, and 25. Results are as follows: Figure 5 As shown in a.

[0112] In the prevention experiment, C57BL / 6 mice were administered the drug once on days 7 and 14 before inoculation with human-MUC16-B16F10 cells. The control group was given PBS, while the other two groups were given nsP2. wt -MUC16-neoantigen-saRNA and nsP2 mut Immunotherapy with -MUC16-neoantigen-saRNA was administered at a volume of 50 μL (10 μg / mouse / dose). Tumor size in mice was measured at regular intervals using calipers on days 8, 14, 17, 21, and 25. Results are as follows: Figure 5 As shown in b.

[0113] The above experimental results show that, compared to the unmutated nsP2 wt -MUC16-neoantigen-saRNA vaccine, nsP2 made from a mutant saRNA vector. mut The -MUC16-neoantigen-saRNA vaccine can more effectively inhibit the development of MUC16-positive melanoma.

[0114] Experimental Example 8 nsP2 S14R,G151R,F659S,P713G,Q739L Efficacy verification of the MUC16-neoantigen-saRNA vaccine in the treatment and prevention of colorectal cancer

[0115] This experimental example provides nsP2 S14R,G151R,F659S,P713G,Q739L -MUC16-neoantigen-saRNA(nsP2 mut The experimental procedure for validating the therapeutic and preventive efficacy of the MUC16-neoantigen-saRNA vaccine in treating and preventing tumors is as follows:

[0116] Establishment of a subcutaneous MUC16-positive mouse model of colorectal cancer: Eighteen healthy 6-8 week old BALB / c mice were selected and subcutaneously injected with 1×10⁶ CT26 cells. 6 / each, the cells overexpress humanized MUC16, with 6 mice in each group.

[0117] BALB / c mice were first administered the drug on day 5 after being inoculated with human-MUC16-CT26 cells, and then administered it again 7 days later, for a total of 3 administrations. The control group received PBS, while the other two groups received nsP2. wt -MUC16-neoantigen-saRNA and nsP2 mut Immunotherapy with -MUC16-neoantigen-saRNA was administered at a volume of 50 μL (10 μg / mouse / treatment). Tumor size in mice was measured at regular intervals using calipers on days 8, 14, 17, 21, and 25. Results are as follows: Figure 6 As shown in a.

[0118] In the prevention experiment, BALB / c mice were administered the drug once 7 days and once 14 days before inoculation with human-MUC16-CT26 cells. The control group was given PBS, and the other two groups were given nsP2. wt -MUC16-neoantigen-saRNA and nsP2 mut Immunotherapy with -MUC16-neoantigen-saRNA was administered at a volume of 50 μL (10 μg / mouse / dose). Tumor size in mice was measured at regular intervals using calipers on days 8, 14, 17, 21, and 25. Results are as follows: Figure 6 As shown in b.

[0119] The above experimental results show that, compared to the unmutated nsP2 wt -MUC16-neoantigen-saRNA vaccine, nsP2 made from a mutant saRNA vector. mutThe MUC16-neoantigen-saRNA vaccine can more effectively inhibit the development of MUC16-positive colorectal tumors.

[0120] As can be seen from the above embodiments and experimental examples, constructing saRNA according to the scheme of the present invention can more efficiently and continuously express the target gene, and can also more effectively exert the tumor treatment and prevention efficacy of the prepared vaccine. Therefore, the present invention has good application prospects in drug and vaccine development.

Claims

1. A self-replicating element taken from the VEEV TC83 strain, characterized in that, The non-structural protein nsP2 of the strain is directed mutated to the sequence as shown in SEQ ID NO. 1, specifically: the 14th cysteine is mutated to arginine, the 151st glycine is mutated to arginine, the 659th phenylalanine is mutated to serine, the 713th proline is mutated to glycine, and the 739th glutamine is mutated to leucine.

2. A self-replicating RNA molecule, characterized in that, The DNA sequence comprises, from 5' end to 3' end in sequence: a T7 promoter, a 5' UTR, a gene sequence of nsP1, a gene sequence of the directed mutated nsP2 according to claim 1, a gene sequence of nsp3, a gene sequence of nsp4, a subgenomic promoter, a gene sequence of a target gene, a 3' UTR and a PolyA tail.

3. The self-replicating RNA molecule of claim 2, wherein: The gene sequence of the nsP1 is shown in SEQ ID NO. 3, the gene sequence of the nsP3 is shown in SEQ ID NO. 4, and the gene sequence of the nsP4 is shown in SEQ ID NO. 5; the nucleotide sequence of the promoter is shown in SEQ ID NO. 6, the nucleotide sequence of the 5' UTR is shown in SEQ ID NO. 7, the nucleotide sequence of the subgenomic promoter is shown in SEQ ID NO. 8, the nucleotide sequence of the 3' UTR is shown in SEQ ID NO. 9, and the nucleotide sequence of the PolyA tail is shown in SEQ ID NO.

10.

4. The self-replicating RNA molecule of claim 2, wherein: The gene sequence of the target gene is a MUC16-specific immunopeptide segment gene sequence, an EGFP gene sequence or a luciferase Luc gene sequence.

5. A nucleic acid encoding the self-replicating element of claim 1 or the self-replicating RNA molecule of any one of claims 2-4.

6. A vector comprising the nucleic acid of claim 5.

7. A cell comprising the vector of claim 6.

8. Use of the self-replicating element of claim 1, the self-replicating RNA molecule of any one of claims 2-4, the nucleic acid of claim 5, the vector of claim 6 or the cell of claim 7 in the manufacture of a pharmaceutical composition for preventing or treating a disease.

9. A self-replicating RNA vaccine, characterized in that: The vaccine is prepared by expressing and purifying the plasmid constructed from the DNA sequence shown in SEQ ID NO.

11.

10. Use of the self-replicating RNA vaccine of claim 9 in the manufacture of a medicament for preventing or treating a tumor.

Images