Application of ZmSNAC06 protein and related biological materials thereof in regulation and control of plant drought resistance

By introducing the ZmSNAC06 protein-coding gene, the expression and activity of proteins in plants were regulated, which solved the problem of insufficient drought resistance in plants, improved the survival ability and physiological indicators of plants under drought conditions, and enhanced their adaptability under drought stress.

CN121227768APending Publication Date: 2025-12-30INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410844608.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-06-27
Publication Date
2025-12-30

AI Technical Summary

Technical Problem

Existing technologies have failed to effectively improve the drought resistance of plants, especially under drought stress, which affects maize yield in agricultural production.

Method used

By introducing the ZmSNAC06 protein-coding gene or related biological materials, the expression and activity of proteins in plants can be regulated, thereby improving the drought resistance of plants and enhancing their survival ability under drought stress.

Benefits of technology

It significantly improved the drought resistance of plants, enhanced their survival rate under drought conditions, increased proline content and superoxide dismutase activity, while reducing malondialdehyde content and improving the plant's ability to adapt to drought stress.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004915360280000111
    Figure BDA0004915360280000111
  • Figure BDA0004915360280000151
    Figure BDA0004915360280000151
  • Figure BDA0004915360280000161
    Figure BDA0004915360280000161
Patent Text Reader

Abstract

The invention discloses application of ZmSNAC06 protein and related biological materials thereof in regulation and control of plant drought resistance, and belongs to the technical field of genetic engineering. The technical problem to be solved by the invention is how to improve the drought resistance of plants. In order to solve the technical problem, the invention provides application of the protein or a substance for regulating and controlling the expression of the protein coding gene or a substance for regulating and controlling the activity or content of the protein in regulating and controlling the drought resistance of the plant, and the protein is the protein with the amino acid sequence as shown in the 1st-359th sites of SEQ ID NO.1. The invention excavates and verifies the application of the ZmSNAC06 protein and the coding gene thereof in regulation and control of plant drought resistance for the first time. Results show that the ZmSNAC06 protein and the coding gene thereof can significantly improve the drought resistance of plants, and have important application value in drought-resistant plant breeding and plant drought stress regulation mechanism research.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and particularly relates to application of ZmSNAC06 protein and biological materials related thereto in regulating drought resistance of plants. BACKGROUND

[0002] With the continuous change of global climate, sudden droughts frequently occur in major grain-producing areas in temperate, tropical and subtropical zones, and agricultural production worldwide is severely affected (Christian et al., 2021). When plants are subjected to drought stress, they will adopt various adaptive strategies through a complex regulatory network, including avoiding drought, resisting drought and tolerating drought (Ribaut et al., 2009). Plant drought tolerance is a complex trait that interacts through different tissues and various metabolic pathways. In the regulatory network of plant response to stress, transcription factors are located upstream of the response regulatory network, and activate or inhibit the expression of target genes by binding to cis-acting elements in the promoter region of the target genes. The interaction between transcription factors and cis-acting elements is a switch for regulating the spatiotemporal / environmental specific expression of genes (Todaka et al., 2012).

[0003] NAC transcription factors are a class of transcription factors specific to plants, and the N-terminal thereof has a conserved sequence of about 160 amino acid residues, which is referred to as a NAC conserved domain (Aida et al., 1997). The NAC domain can be further divided into five subdomains (A-E). Among them, subdomains C and D belong to the DNA binding region (Ernst et al., 2004), subdomain D belongs to the nuclear localization signal region, and subdomain A belongs to the oligomerization site region (Puranik et al., 2012). The C-terminal of NAC protein is a transcriptional regulation region. NAC transcription factors can be involved in plant growth and development and stress response processes, and are widely distributed in various plant genomes. At present, a large number of NAC genes have been found in Arabidopsis, rice, tobacco, soybean and corn genomes (Riechmann et al., 2000; Xiong et al., 2005; Rushton et al., 2008; Le et al., 2011; Shiriga et al., 2014).

[0004] According to statistics, the total corn yield in 2020 was 1.163 billion tons, which has become the highest yield crop in the world (FAO, 2020). A large amount of water resources is needed in the process of corn production, and it is predicted that the supply of fresh water will decrease by 50% by 2050 (Gupta et al., 2020). Therefore, it is of great significance to study the drought tolerance of corn for agricultural production. SUMMARY

[0005] The technical problem to be solved by the present application is how to improve the drought resistance of plants.

[0006] To solve the above technical problem, the present application provides the use of a protein or a substance for regulating the expression of a gene encoding the protein or a substance for regulating the activity or content of the protein in any one of the following,

[0007] A1), in regulating the drought resistance of plants;

[0008] A2), in preparing a product for regulating the drought resistance of plants;

[0009] A3), in regulating the proline content under drought stress conditions in plants;

[0010] A4), in preparing a product for regulating the proline content under drought stress conditions in plants;

[0011] A5), in regulating the activity of superoxide dismutase under drought stress conditions in plants;

[0012] A6), in preparing a product for regulating the activity of superoxide dismutase under drought stress conditions in plants;

[0013] A7), in regulating the content of malondialdehyde under drought stress conditions in plants;

[0014] A8), in preparing a product for regulating the content of malondialdehyde under drought stress conditions in plants;

[0015] A9), in plant breeding or assisted plant breeding;

[0016] A10), in preparing a product for plant breeding or assisted plant breeding;

[0017] The protein can be any one of the following proteins:

[0018] a1), a protein with an amino acid sequence of SEQ ID NO. 1 1-359 or SEQ ID NO. 1;

[0019] a2), a protein obtained by substitution, deletion and / or addition of amino acid residues to the amino acid sequence of a1), which has more than 90% identity with the amino acid sequence of a1) and is a protein for drought resistance in plants;

[0020] a3), a fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of a1) or a2).

[0021] In the application, the regulation can be improvement or promotion or up-regulation.

[0022] In the application described, the regulation may also be reduced, suppressed, or downregulated.

[0023] In this application, the protein may be derived from corn.

[0024] In this application, SEQ ID NO.1 consists of 1210 amino acid residues.

[0025] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0026] a3) The connection can be made via peptide bonds.

[0027] The protein tag refers to a polypeptide or protein fused with a target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag protein tag, His protein tag, MBP protein tag, HA protein tag, myc protein tag, GST protein tag, and / or SUMO protein tag, etc.

[0028] In this application, the purpose of plant breeding may be to obtain a target plant with lower drought resistance than the parent plant.

[0029] In this application, the evaluation indicators for plant breeding include the plant's drought resistance.

[0030] In the aforementioned application, the substance that regulates the activity or content of the protein may be a substance that enhances the expression of the gene encoding the protein.

[0031] In the application described, the substance regulating gene expression may be a substance that performs at least one of the following six types of regulation: 1) regulation at the gene transcription level; 2) post-transcriptional regulation of the gene (i.e., regulation of splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (i.e., regulation of mRNA transport of the gene from the nucleus to the cytoplasm); 4) regulation of gene translation; 5) regulation of mRNA degradation of the gene; and 6) post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).

[0032] Furthermore, in the aforementioned applications, the substance regulating the expression of the protein-coding gene or the substance regulating the activity or content of the protein is a biological material, which may be any of the following:

[0033] B1) Nucleic acid molecules that encode the above proteins;

[0034] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0035] B3) A recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2);

[0036] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0037] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3);

[0038] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3);

[0039] B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2), or transgenic plant organs containing the recombinant vector described in B3).

[0040] Furthermore, in the aforementioned application, the nucleic acid molecule described in B1) can be any one of the following DNA molecules described in g1)-g3):

[0041] g1) The coding sequence of the coding strand is the DNA molecule of SEQ ID NO.2;

[0042] g2) The nucleotide sequence of the coding strand is the DNA molecule of SEQ ID NO.3;

[0043] g3) is a DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and regulates plant drought resistance.

[0044] Furthermore, in the aforementioned application, the expression cassette described in B2) refers to DNA capable of expressing the protein in a host cell, which may include not only a promoter for initiating transcription of a protein-coding gene, but also a terminator and / or enhancer sequence for terminating transcription of a protein-coding gene.

[0045] In some embodiments of this application, the recombinant vector described in B3) may be pCAMBIA1303-ZmSNAC06. pCAMBIA1303-ZmSNAC06 can express a protein with the amino acid sequence of SEQ ID NO.1. The structure of pCAMBIA1303-ZmSNAC06 is as follows: a DNA molecule with the nucleotide sequence of SEQ ID NO.2 is inserted between the SpeI restriction enzyme sites of the pCAMBIA1303 vector, while keeping the other nucleotide sequences of the pCAMBIA1303 vector unchanged.

[0046] Furthermore, in the aforementioned applications, the recombinant microorganisms described in B4) can specifically be yeast, bacteria, algae, and fungi.

[0047] Furthermore, in the aforementioned applications, the plant tissue described in B6) may be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos, and anthers.

[0048] Furthermore, in the aforementioned applications, the transgenic plant organs described in B7) can be the roots, stems, leaves, flowers, fruits, and seeds of the transgenic plant.

[0049] Furthermore, in the aforementioned applications, the transgenic plant cell lines, transgenic plant tissues, and transgenic plant organs may or may not include propagation material.

[0050] In this application, by introducing an expression vector containing the protein-coding gene, the expression level of the protein-coding gene in the plant is upregulated or the activity or content of the protein is increased, thereby improving the drought resistance of the plant, increasing the proline content in the plant under drought stress, increasing the superoxide dismutase activity in the plant, and reducing the malondialdehyde content in the plant under drought stress.

[0051] Furthermore, in the aforementioned applications, the plant is a dicotyledonous plant or a monocotyledonous plant.

[0052] Furthermore, the dicotyledonous plant may be selected from the Brassicaceae family.

[0053] Furthermore, the dicotyledonous plant may be selected from the Arabidopsis genus.

[0054] Furthermore, the dicotyledonous plant may be selected from Arabidopsis thaliana (L.) Heynh.

[0055] Furthermore, the monocotyledonous plant may be selected from the Poaceae family.

[0056] Furthermore, the monocotyledonous plant may be selected from the genus *Zea*.

[0057] Furthermore, the monocotyledonous plant may be selected from maize (Zea mays L.).

[0058] This application also provides a method for obtaining drought-resistant plants, the method comprising introducing the encoding gene of the above-mentioned protein into a recipient plant to obtain a target plant with higher drought resistance than the recipient plant.

[0059] Furthermore, in the method, the encoding gene can be any one of the following g1)-g3):

[0060] g1) The coding sequence of the coding strand is the DNA molecule of SEQ ID NO.2;

[0061] g2) The nucleotide sequence of the coding strand is the DNA molecule of SEQ ID NO.3;

[0062] g3) is a DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and regulates plant drought resistance.

[0063] Furthermore, in the method, the nucleic acid molecule is introduced into the recipient plant in the form of a vector.

[0064] Furthermore, in the method described, the carrier may be pCAMBIA1303-ZmSNAC06.

[0065] Furthermore, the plant may be a dicotyledonous plant or a monocotyledonous plant.

[0066] Furthermore, the dicotyledonous plant may be selected from the Brassicaceae family.

[0067] Furthermore, the dicotyledonous plant may be selected from the Arabidopsis genus.

[0068] Furthermore, the dicotyledonous plant may be selected from Arabidopsis thaliana (L.) Heynh.

[0069] Furthermore, the monocotyledonous plant may be selected from the Poaceae family.

[0070] Furthermore, the monocotyledonous plant may be selected from the genus *Zea*.

[0071] Furthermore, the monocotyledonous plant may be selected from maize (Zea mays L.).

[0072] This application also provides a method for regulating plant drought resistance. The method may include regulating the expression level of the encoding gene of the above-mentioned protein in the recipient plant to regulate the drought resistance of the recipient plant.

[0073] Furthermore, the method may include increasing the expression level of the gene encoding the aforementioned protein in the recipient plant to enhance the drought resistance of the recipient plant.

[0074] Furthermore, the method can increase the expression level of the protein-coding gene in the recipient plant by introducing the gene encoding the protein into the recipient plant.

[0075] Furthermore, in the method, the gene encoding the protein can be any one of the following g1)-g3):

[0076] g1) The coding sequence of the coding strand is the DNA molecule of SEQ ID NO.2;

[0077] g2) The nucleotide sequence of the coding strand is the DNA molecule of SEQ ID NO.3;

[0078] g3) is a DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and regulates plant drought resistance.

[0079] Furthermore, in the method, the encoding gene is introduced into the recipient plant in the form of a vector.

[0080] In some embodiments of this application, the carrier is pCAMBIA1303-ZmSNAC06.

[0081] Furthermore, the plant may be a dicotyledonous plant or a monocotyledonous plant.

[0082] Furthermore, the dicotyledonous plant may be selected from the Brassicaceae family.

[0083] Furthermore, the dicotyledonous plant may be selected from the Arabidopsis genus.

[0084] Furthermore, the dicotyledonous plant may be selected from Arabidopsis thaliana (L.) Heynh.

[0085] Furthermore, the monocotyledonous plant may be selected from the Poaceae family.

[0086] Furthermore, the monocotyledonous plant may be selected from the genus *Zea*.

[0087] Furthermore, the monocotyledonous plant may be selected from maize (Zea mays L.).

[0088] The aforementioned proteins and biological materials are also within the scope of protection of this application.

[0089] The improved drought resistance of plants described in this application, or the characteristics of drought-resistant plants, may include: higher survival rate under drought stress, increased proline content in plants under drought stress, increased superoxide dismutase activity in plants under drought stress, and / or decreased malondialdehyde content in plants under drought stress.

[0090] In this application, identity refers to the identity of amino acid sequences or nucleotide sequences. The identity of amino acid sequences (or nucleotide sequences) can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can be obtained.

[0091] The aforementioned 90% or higher degree of identity can be interpreted as 90% or 95% or higher degree of identity.

[0092] The aforementioned 80% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.

[0093] The 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 85% or more identity can be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 90% or more identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 95% or higher level of identity can be at least 95%, 96%, 97%, 98%, or 99% identity.

[0094] This study identified a transcription factor gene, ZmSNAC06, using transcriptome data. Gene expression analysis revealed that ZmSNAC06 is induced by drought stress, located in the cell nucleus, and functions as a transcription factor. Transgenic Arabidopsis thaliana overexpressing ZmSNAC06 exhibited enhanced drought tolerance. These results indicate that ZmSNAC06 plays a crucial regulatory role in drought stress response, providing important evidence for further research into its molecular regulatory mechanisms.

[0095] The beneficial technical effects obtained by the present application are as follows:

[0096] This application is the first to discover and validate the application of the ZmSNAC06 protein and its encoding gene in regulating plant drought resistance. The results show that the ZmSNAC06 protein and its encoding gene can significantly improve plant drought resistance, and have important application value in drought-resistant plant breeding and research on the regulatory mechanisms of plant drought stress. Attached Figure Description

[0097] Figure 1 Transcriptome analysis of four materials under drought stress. (a) Gene expression of the four materials under drought stress. (b) KEGG enrichment pathways of drought-upregulated genes in the four materials. (c) KEGG enrichment pathways of drought-downregulated genes in the four materials. (d) Venn diagram analysis of differentially expressed upregulated genes in the four materials under drought stress revealed that 64 genes were upregulated in both drought-resistant materials, Tie7922 and X178. (e) GO annotation and family analysis of the 64 genes revealed that several genes play important roles in transcriptional pathways.

[0098] Figure 2 The drought response of ZmSNAC06 in different materials is shown. (a) The drought stress response of ZmSNAC06-T01 / 3 / 4 / 5 in the roots of two materials. (b) The drought stress response of ZmSNAC06-T01 / 3 / 4 / 5 in the leaves of two materials. (c) The drought stress response of ZmSNAC06-T2 in the roots of two materials. (d) The drought stress response of ZmSNAC06-T2 in the leaves of two materials.

[0099] Figure 3 This document presents the structure diagram of the ZmSNAC06 gene, NAC domain comparisons, phylogenetic analysis, and promoter region analysis. (a) Transcript structure diagram of the ZmSNAC06 gene: blue represents the 5'UTR and 3'UTR, red represents exons, and black lines represent introns. (b) NAC domain sequence alignment of ZmSNAC06 with other NAC family members in plant species: identical amino acids are shown in dark blue, similar amino acids in pink or light blue, and the positions of the five highly conserved amino acid motifs (AEs) are indicated by black lines. (c) Phylogenetic relationship of ZmSNAC06 with other typical stress-responsive NAC proteins: multiple sequence alignment was performed using ClustalW software, and neighbor-joining was used to construct a tree using MEGA11.0 software. (d) Analysis of cis-acting elements in the promoter region.

[0100] Figure 4Subcellular localization and transcriptional activation activity of ZmSNAC06 were verified. (a) Subcellular localization of ZmSNAC06, (b) Verification of transcriptional activation activity of ZmSNAC06. In the figure, GFP: green fluorescent protein; mCherry: nuclear marker; Bright field: bright field; Merged: fusion; Scale bar = 10 μm.

[0101] Figure 5 To identify and analyze the germination rate of Arabidopsis thaliana overexpression lines. (a) Identification of Arabidopsis thaliana overexpression at the DNA level. (b) Identification of Arabidopsis thaliana overexpression at the RNA level. (c) Germination rate of Arabidopsis thaliana under normal and ABA treatments. (d) Statistical analysis of germination rate of Arabidopsis thaliana under normal and ABA treatments. Significant differences were determined by t-test. *P<0.05, **P<0.01.

[0102] Figure 6 To assess the phenotype, survival rate, and physiological parameters (Pro, SOD, MDA) of overexpressing Arabidopsis thaliana. (a) Drought tolerance of transgenic Arabidopsis thaliana overexpressing ZmSNAC06. (b) Statistical analysis of Arabidopsis thaliana survival rate after drought stress treatment. (ce) Measurement of Pro content, MDA content, and SOD activity in WT and the three overexpression lines under normal conditions or on day 10 after drought stress. Significant differences were determined by t-test. *P<0.05, **P<0.01.

[0103] Figure 7 The ZmSNAC06 sequence differences between the two materials are shown. (a) Gene region sequence differences. The red area represents the exon region, and the gray area represents the intron region. (b) Amino acid sequence differences. Detailed Implementation

[0104] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0105] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0106] pCAMBIA1303 is preserved in the laboratory of the Maize High-Quality Stress-Resistant Breeding Research Group, Institute of Crop Science, Chinese Academy of Agricultural Sciences. It is disclosed in the literature Wang N, Cheng M, Chen Y, Liu B, Wang X, Li G, Zhou Y, Luo P, Xi Z, Yong H, Zhang D, Li M, Zhang X, Vicente FS, Hao Z, Li X, 2021. Natural variations in the non-coding region of ZmNAC080308 contributes maintaining grain yield underdrought stress in maize. BMC Plant Biology, 21(1):305. DOI:10.1186 / s12870-021-03072-9. The public can apply to obtain the above biological material from the applicant. The obtained biological material can only be used for verification of the relevant content of this application and cannot be used for other purposes.

[0107] 1 / 2 MS medium was prepared from MS powder according to the product instructions. The MS powder was a product of CAISSON, catalog number MSP01-100LT.

[0108] The malondialdehyde (MDA) content detection kit, superoxide dismutase (SOD) activity detection kit, and proline (Pro) content detection kit are all products of Beijing Solarbio Science & Technology Co., Ltd., with product numbers MDA: BC0025; SOD: BC0175; and Pro: BC0295, respectively.

[0109] Unless otherwise specified, the quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0110] The following examples use GraphPad Prism statistical software to process the data. The experimental results are expressed as mean ± standard deviation. The t-test is used, and * (P < 0.05) indicates a significant difference, and ** (P < 0.01) indicates a highly significant difference.

[0111] Example 1: Discovery of the maize NAC family transcription factor ZmSNAC06

[0112] 1.1 Materials and Methods

[0113] 1.1.1 Plant material and stress treatment

[0114] Drought-tolerant maize inbred lines Tie7922 and X178, and drought-sensitive inbred lines Ji81162 and CA339, were used. The inbred lines and their drought tolerance evaluation were provided by the Maize High-Quality Stress-Resistant Breeding Group, Institute of Crop Science, Chinese Academy of Agricultural Sciences (Hao et al., 2011). Maize materials were sequenced after drought treatment starting at stage V10. Tassels developed under normal conditions and after drought treatment were collected up to stage V13 and sequenced using the Illumina HiSeq 2000 platform (Wang et al., 2018).

[0115] Seeds of surface-sterilized and germinated Tie7922 and Ji81162 inbred lines were rolled in filter paper and placed vertically in a distillation environment in the dark for 3 days. They were then hydroponically cultured in Hoagland nutrient solution at 26°C with 16 hours of light followed by 8 hours of darkness. When the maize reached the three-leaf stage, drought stress was simulated using 20% ​​PEG6000. Samples were taken at five time points: 0h, 1h, 3h, 6h, and 12h. All samples were immediately frozen in liquid nitrogen and stored at -80°C for RNA extraction.

[0116] 1.1.2 Transcriptome Data Analysis

[0117] Transcriptome data of four inbred lines (Tie7922, X178, Ji81162, and CA339) under normal and drought conditions were extracted. KEGG (Kyoto Encyclopedia of Genes and Genomes) enrichment analysis of drought responses in the four inbred lines was performed using TBtools to compare the similarities and differences in response regulatory pathways under drought stress (https: / / bioinfogp.cnb.csic.es / tools / venny / index.html). Regulatory genes in drought-resistant materials under drought stress were analyzed. GO (GeneOntology) enrichment analysis and gene family analysis were performed on upregulated response genes in drought-resistant materials after drought stress using TBtools. https: / / dycharts.com / appv2 / # / pages / home / chart-template ).

[0118] 1.1.3 Sequence Analysis of ZmSNAC06

[0119] The ZmSNAC06 gene and NAC member sequences from maize and other species were obtained from the database website ( https: / / maizegdb.org / ; https: / / ensembl.gramene.org / Zea_mays / Info / IndexDownload from [source], construct multiple alignments of amino acid sequences using ClustalW, construct gene phylogenetic trees using the Neighbor-joining method (NJ) with MEGA 11.0 software, and use the PlantPAN 4.0 website (http: / / plantpan.itps.ncku.edu.tw / plantpan4 / index.html) to predict cis-acting elements within 2,000 bp upstream of the translation start codon (ATG) of ZmSNAC06.

[0120] 1.1.4 RNA Extraction and Real-Time Quantitative PCR

[0121] Total RNA was extracted using TransZol UP reagent. The total RNA, meeting quality and concentration requirements, was reverse transcribed into cDNA using the FastQuant RT Kit (Tiangen, Beijing, China). Real-time quantitative PCR (qRT-PCR) was performed using an Applied Biosystems 7500 instrument, and the specificity of each primer pair was verified by melting curve analysis. TUB4 / Actin was selected as an internal control, and 2... -ΔΔCt Gene expression levels were calculated using the method, with each gene expression level measured in three biological replicates. The primer sequences (5'-3') used for qRT-PCR analysis are as follows:

[0122] Dl-T01-F: GACCTCATCTCCAAGCCTCT;

[0123] Dl-T01-R:TCGTACCGCTCGATAACACC;

[0124] Dl-T02-F: AGTGGTACTTCTTCTCGCCGC;

[0125] Dl-T02-R: TCGTGCATGATCCAGTTGGTC.

[0126] 1.1.5 Subcellular localization

[0127] The coding region of ZmSNAC06 without a stop codon (TGA) was amplified and inserted into the PAN580 vector digested with BamHI restriction enzyme to generate the ZmSNAC06-GFP fusion protein. Protoplasts of maize yellow flower seedlings were extracted using enzymatic digestion with cellulase and pectinase, and then processed through PEG-Ca... 2+The protoplasts were transferred into maize protoplasts using the same method. The protoplast extraction and transformation procedures were based on those for Arabidopsis thaliana (YOO et al., 2007). The PAN580 vector was used as a negative control. The protoplasts were incubated in the dark at room temperature for 12–16 h, and GFP fluorescence was observed using a confocal microscope.

[0128] The primer sequences (5'-3') for amplifying the coding region of ZmSNAC06 without the stop codon (TGA) are as follows:

[0129] Pan-T01-F: GGACCGGTCCCGGGGGATCC ATGGCCGGCGCAGAG;

[0130] Pan-T01-R: CTCGCCCTTGCTCACCAT GAACGGTTTGTGCAGGTACG;

[0131] Pan-T02-F: GGACCGGTCCCGGGGGATCC ATGGACTGCGGTGGCGC;

[0132] Pan-T02-R: CTCGCCCTTGCTCACCAT GAACGGTTTGTGCAGGTAC.

[0133] 1.1.6 Verification of transcriptional activation activity

[0134] The coding region of ZmSNAC06 was amplified and inserted into pGBKT7. The fusion plasmid was transformed into yeast Y2H competent cells according to the manufacturer's protocol. Transformants were screened on two-deficient medium (SD / -Trp-Leu), and positive clones were serially diluted 10-fold and plated on four-deficient medium (SD / -Trp-Leu-His-Ade, X-α-Gal) and incubated upside down at 30°C for 48-96 h.

[0135] The primer sequences (5'-3') for amplifying the coding region of ZmSNAC06 are as follows:

[0136] Pg-T01-F: ATGGAGGCCGAATTC ATGGCCGGCGCAGAG;

[0137] Pg-T01-R: CAGGTCGACGGATCC GAACGGTTTGTGCAGGTACG;

[0138] Pg-T02-F: ATGGAGGCCGAATTC ATGGACTGCGGTGGCGC;

[0139] Pg-T02-R: CAGGTCGACGGATCC GAACGGTTTGTGCAGGTAC.

[0140] 1.2 Results Analysis

[0141] 1.2.1 Discovery of the ZmSNAC06 gene

[0142] By analyzing transcriptome data from four different materials under drought stress and counting the number of differentially expressed genes in response to drought, it was found that numerous genes were upregulated / downregulated in the four materials (Tie7922, X178, CA339, and Ji81162) under drought stress. Figure 1 (a)

[0143] KEGG enrichment was performed on upregulated genes in four materials under drought stress. Analysis of the differences in regulatory pathways in response to drought stress between drought-tolerant and drought-sensitive materials revealed that upregulated genes were significantly enriched in signal transduction and stress metabolite synthesis pathways in drought-tolerant materials, while upregulated genes were significantly enriched in translation and energy metabolism pathways related to photosynthesis and respiration in drought-sensitive materials. Figure 1 (b) This indicates that there are significant differences in gene expression between drought-resistant and drought-sensitive materials after exposure to drought stress, suggesting that drought-resistant materials may adapt to drought stress through signal transduction and the synthesis of stress metabolites.

[0144] Further KEGG enrichment of downregulated genes in the four materials under drought stress was performed to analyze the differences in downregulated pathways in their drought response. Significant differences in gene expression were observed among the downregulated genes in different materials. Secondary metabolite pathways were prevalent in all four materials, but nitrogen metabolism pathways were enriched in the drought-resistant materials Tie7922 and X178. Figure 1 (c) Nitrogen metabolism pathways play an important role in the transition from vegetative to reproductive growth in plants. Downregulation of nitrogen metabolism pathway genes indicates that drought-resistant materials have an active regulatory pathway for reproductive growth under drought stress to avoid irreversible damage. This regulatory pathway was not enriched in drought-sensitive materials.

[0145] By observing the number of gene responses, the drought response of different materials was observed (Table 1). It was found that the drought-resistant material Tie7922 and the drought-sensitive material Ji81162 had a large number of gene responses to drought stress in the MAPK signal transduction pathway, environmental information processing, and signal transduction pathway. However, the translation and energy metabolism pathways of Tie7922 were stable, while Ji81162 required the regulation of a large number of gene expression to maintain the stability of translation and energy metabolism.

[0146] Table 1. Number of genes expressing drought response pathways in four materials.

[0147]

[0148] Analysis of upregulated genes in four materials under drought stress revealed that 64 genes were upregulated in the drought-resistant materials. These 64 genes were drought-stress-induced, ignoring background differences, and made significant contributions to the drought resistance of the materials. Among them, 4 genes belong to the NAC family, 3 genes belong to the kinase family, 2 genes belong to the phosphatase family, and 1 gene belongs to the WRKY family. These genes play important functions at the transcriptional regulatory level. Figure 1 (d, e). Among them, the genes belonging to the SNAC family are GRMZM2G347043 (ZmSNAC02, ZmSNAC1, ZmNAC49) (Xiang et al., 2021a; et al., 2021b); GRMZM2G014653 (ZmSNAC04, ZmNAC33, NAC109) (Thatcher et al., 2016; Liu et al., 2019); and GRMZM2G068973 (ZmSNAC13, ZmNAC080308) (Luo et al., 2022; Wang et al., 2021), all of which play important roles in responding to abiotic stress. In addition, there is the ZmSNAC06 gene (GRMZM2G123667), which is the focus of this study and has not yet been characterized. The genomic sequence of the ZmSNAC06 gene is SEQ ID NO.3.

[0149] 1.2.2 The expression of the ZmSNAC06 gene is induced by drought stress.

[0150] ZmSNAC06 has five transcripts in the V5 sequence annotation. To investigate the differences in the drought response of ZmSNAC06 among different materials, Tie7922 and Ji81162, which showed significant differences in drought tolerance, were selected as experimental materials. We extracted maize seedlings treated with 20% PEG-6000 for real-time quantitative PCR. The results showed that the response patterns of the ZmSNAC06 gene differed between drought-tolerant and drought-susceptible materials. Both transcripts of the ZmSNAC06 gene were co-upregulated in Tie7922, while the response in Ji81162 was far less pronounced than in Tie7922. Furthermore, the ZmSNAC06 gene response to drought stress occurred significantly earlier in the roots than in the leaves. Figure 2 This indicates that the ZmSNAC06 gene is induced by drought stress, and that its upregulation under drought stress is significantly higher in the drought-resistant material Tie7922 than in the drought-sensitive material Ji81162.

[0151] 1.2.3 Sequence Characterization of the ZmSNAC06 Gene

[0152] Analysis of the ZmSNAC06 gene structure revealed that the differences among multiple transcripts of ZmSNAC06 ultimately resulted in only two isoforms of the protein PO1 and PO2. Figure 3 (a, b) The P02 isoform protein is translated from the T02 transcript, which has an open reading frame of 1080 bp, three exons, and encodes 359 amino acids. P02 possesses a typical NAC domain. The P01 isoform protein is translated from four transcripts (T01 / T03 / T04 / T05), with an open reading frame of 750 bp, two exons, and encodes 250 amino acids. The P01 isoform protein only contains the E subdomain of the NAC domain. Phylogenetic analysis revealed that ZmSNAC06 is more closely related to the OsNAC5 gene, which has been reported to respond to drought stress. Figure 3 (c). These findings suggest that ZmSNAC06 may be a member of the NAC transcription factor family.

[0153] In Tie7922 and Ji81162, the ZmSNAC06 T02 transcript shows significant differences in the gene region, including insertions, deletions, and single-base mutations; the gene also exhibits three amino acid differences in the coding region. Figure 7 However, the promoter sequences were completely identical. Therefore, analysis of the cis-regulatory elements in the ZmSNAC06 promoter region revealed three transposon insertions and numerous binding sites for stress responses and plant reproductive growth-related transcription factors. Figure 3 (d) Six recognition motifs for NAC transcription factors were found in the promoter region of ZmSNAC06, two of which are located within transposon elements. These transposon elements also contained numerous recognition motifs for transcription factors, including NAC, bZIP, bHLH, and HD-ZIP. This result suggests that ZmSNAC06 may play an important role in maize's response to drought stress.

[0154] 1.2.4 ZmSNAC06 is a transcription factor located in the cell nucleus.

[0155] Transcription factors are typically located in the cell nucleus, where they perform DNA binding and transcriptional activation. To determine the subcellular localization of ZmSNAC06, the empty PAN580-GFP vector and ZmSNAC06-GFP were transformed into maize protoplasts. Subcellular localization of the ZmSNAC06-P01 / P02 proteins was performed. It was found that ZmSNAC06-P01 was localized in the cell membrane, nucleus, and cytoplasm, while ZmSNAC06-P02 was localized only in the nucleus. This indicates that the NAC domain of the ZmSNAC06 protein influences its subcellular localization. Figure 4 (a)

[0156] When the BD (binding domain) of the pGBKT7 vector was fused with ZmSNAC06-P01 / P02 and co-transformed with the AD (activation domain) vector of pGADT7 in a tetra-deficient medium containing X-α-Gal, the proteins grew normally and turned blue, indicating that both ZmSNAC06-P01 / P02 proteins have activating ability. Figure 4 (b)

[0157] Example 2: Functional Verification of the ZmSNAC06 Gene

[0158] 2.1 Test Methods

[0159] 2.1.1 Transformation of Arabidopsis thaliana

[0160] Using the maize inbred line Tie7299 as material, the coding region of ZmSNAC06 was extracted and amplified by reverse transcription, and inserted into the pCAMBIA1303 vector to obtain a recombinant expression vector named pCAMBIA1303-ZmSNAC06. pCAMBIA1303-ZmSNAC06 was transformed into Escherichia coli DH5α competent cells and plated on LB solid medium containing kanamycin for 48 hours. Single colonies were picked, further cultured, and the cells were collected. pCAMBIA1303-ZmSNAC06 was then transformed into Arabidopsis ecotype Col-0 using the flower-dipping method. The obtained T0 generation seeds were sown on 1 / 2 MS medium containing hygromycin to screen for T1 generation transgenic positive plants. The T1 generation seeds were then sown on 1 / 2 MS medium containing hygromycin to screen for T2 generation transgenic positive plants. The T2 generation seeds were then sown on 1 / 2 MS medium containing hygromycin to screen for T3 generation transgenic positive plants. The homozygous T3 generation lines OE1, OE3, and OE5 were used for subsequent studies.

[0161] The structure of pCAMBIA1303-ZmSNAC06 is as follows: a DNA molecule with the nucleotide sequence of SEQ ID NO.2 is inserted between the SpeI restriction enzyme sites of the pCAMBIA1303 vector, while keeping the other nucleotide sequences of the pCAMBIA1303 vector unchanged. The full sequence of pCAMBIA1303-ZmSNAC06 is shown in Table 1. Specifically, positions 20-1096 of the pCAMBIA1303-ZmSNAC06 sequence encode the ZmSNAC06 gene, positions 1103-2908 encode the GUS gene, positions 2912-3622 encode the mgfp5 gene, and positions 3629-3646 encode the His tag gene. The amino acid sequence that pCAMBIA1303-ZmSNAC06 can express is the ZmSNAC06 fusion protein of SEQ ID NO.1. In SEQ ID NO.1, positions 1-359 represent the amino acid sequence of the ZmSNAC06 protein, positions 362-963 represent the amino acid sequence of the GUS protein, positions 965-1201 represent the amino acid sequence of the mgfp5 protein, and positions 1204-1209 represent the amino acid sequence of the His tag. The ZmSNAC06 fusion protein is transcribed by the CaMV 35S promoter.

[0162] The primer sequences (5'-3') for amplifying the coding region of ZmSNAC06 are as follows:

[0163] OE-F: GGTAGATCTGACTAGT ATGGACTGCGGTGGCGC;

[0164] OE-R: CAGGACGTAAACTAGT GAACGGTTTGTGCAGGTAC.

[0165] The method for identifying transgenic positive Arabidopsis thaliana is as follows: genomic DNA is extracted from the transgenic plant, and PCR amplification is performed using Jd-F and Jd-R primers. The PCR products are then detected by gel electrophoresis, with wild-type Arabidopsis thaliana and water used as controls. Transgenic positive Arabidopsis thaliana shows a band around 1500 bp.

[0166] The Jd-F and Jd-R sequences (5'-3') are as follows:

[0167] Jd-F: TGGAGAGAACACGGGGGACT;

[0168] Jd-R: CGGCGAACTGATCGTTAAAA.

[0169] 2.1.2. Identification of drought tolerance in transgenic Arabidopsis thaliana and determination of drought response physiological indicators.

[0170] Wild-type (WT) and transgenic (T3 generation OE1, OE3, and OE5) seedlings germinated and grown on 1 / 2 MS medium for one week were transferred to culture pots containing vermiculite: nutrient soil at a ratio of 3:1. The experiment consisted of a drought treatment and a normal treatment. The drought-treated seedlings grew under normal growing conditions for two weeks, followed by a two-week watering halt. Survival rates of the transgenic and wild-type lines were recorded three days after rehydration (day 4 after rehydration). Arabidopsis thaliana grown under normal growing conditions served as a control. Sixteen plants of each type (WT and T3 generation OE1, OE3, and OE5) were used in each treatment, with three replicates. The day of watering halt was designated as day 0, the day of rehydration (day 15 after watering halt) as day 0, and the day after rehydration (day 4 after rehydration) was designated as day 4.

[0171] To detect changes in plant physiological parameters under drought stress, we collected leaves from plants on the 10th day of drought treatment. The contents of malondialdehyde (MDA), superoxide dismutase (SOD), and proline (Pro) were measured using the corresponding kits according to the product instructions.

[0172] 2.1.3 Germination Test

[0173] One hundred overexpressing Arabidopsis thaliana seeds and wild-type seeds were sown separately on 1 / 2 MS medium containing / without 1 μM ABA (abscisic acid). The 1 / 2 MS medium treatment group containing 1 μM ABA was named the 1 μM ABA treatment group, and the 1 / 2 MS medium treatment group without ABA was named the control group. Each treatment group was set up in 3 replicates.

[0174] Seeds were placed on a plate and treated at 4℃ for 3 days to achieve uniform germination potential. Then, they were placed in a culture room for germination (culture temperature set at 22℃, photoperiod set at 16h light and 8h darkness). The seed germination rate was recorded after 7 days.

[0175] 2.2 Results Analysis

[0176] 2.2.1 Overexpression of ABA makes Arabidopsis thaliana more sensitive during germination.

[0177] The significant expression of ZmNAC06 under drought stress prompted us to analyze its potential role in drought resistance. Since multiple transcripts of ZmSNAC06 encode the P01 / P02 isoforms with identical C-termini, differing only in the presence or absence of the N-terminus (POC domain), and the P02 isoform protein structure essentially includes P01, we selected the major pattern T02 transcript of ZmSNAC06 for overexpression. Based on expression levels, three independent transgenic lines (OE1, OE3, and OE5) were selected for further research. Figure 5 (b)

[0178] To investigate the sensitivity of transgenic plants to ABA, wild-type and transgenic Arabidopsis thaliana were sown on 1 / 2 MS medium containing 1 μM ABA and control medium, respectively, for germination. Germination rates were compared after 7 days. The results showed that in normal medium, the germination rates of the three overexpression lines OE1 / OE3 / OE5 were not different from those of the wild type. Under 1 μM ABA treatment, the germination rates of the overexpression lines were 0.48–0.6, while the germination rate of the wild type was 0.78. Figure 5 (d). ABA can inhibit seed germination, and it is speculated that the ZmSNAC06 gene can participate in the ABA pathway, thus aggravating the inhibitory effect of ABA.

[0179] 2.2 Overexpression of ZmSNAC06 enhances drought resistance in transgenic Arabidopsis thaliana.

[0180] To investigate the drought tolerance of transgenic Arabidopsis thaliana, we analyzed the survival rates of wild-type and three overexpression lines (OE1 / OE3 / OE5) after drought treatment. We found that the survival rates of wild-type lines ranged from 0.32 to 0.36, while those of the overexpression lines ranged from 0.56 to 0.77. The survival rates of the overexpression lines were significantly higher than those of the wild-type lines, with OE1 and OE5 showing highly significant differences. Figure 6 (b) This indicates that the ZmSNAC06 gene can improve the survival rate of overexpressed lines under drought stress, suggesting that the ZmSNAC06 gene may play a role in regulating plant adaptation to drought in maize. Furthermore, comparing the growth and development of drought-treated and normally growing Arabidopsis thaliana reveals that drought stress significantly promotes the transition from vegetative growth to reproductive growth in plants.

[0181] After 10 days of drought treatment, the physiological and biochemical parameters of the Arabidopsis thaliana lines were measured, including wild-type and three overexpression lines (OE1 / OE3 / OE5). Figure 6(Ce). Under drought stress, plants synthesize large amounts of proline to increase osmotic pressure and maintain cell water potential. Simultaneously, the large amount of reactive oxygen species accumulated within the cells is cleared through enzymatic systems, producing malondialdehyde (MDA) which damages the membrane system. Therefore, three physiological indicators—proline (Pro), superoxide dismutase (SOD), and malondialdehyde (MDA) content—were selected for measurement. The results showed that, compared to wild-type Arabidopsis, the overexpressing lines exhibited increased proline content, enhanced SOD activity, and decreased MDA content, demonstrating from a physiological and biochemical perspective that the ZmSNAC06 gene improved the drought tolerance of transgenic plants.

[0182] The above results indicate that overexpression of ZmSNAC06 in recipient plants can improve plant survival under drought stress. Physiological and biochemical studies have shown that overexpression of ZmSNAC06 in recipient plants can increase proline content and / or superoxide dismutase activity in plants under drought stress, and decrease malondialdehyde content in plants under drought stress.

[0183] Table 1 Sequences in this application

[0184]

[0185]

[0186]

[0187]

[0188]

[0189]

[0190] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. Use of a protein or a substance for regulating expression of a gene encoding the protein or a substance for regulating activity or content of the protein in any of the following, A1) use in regulating drought resistance of a plant; A2) use in preparing a product for regulating drought resistance of a plant; A3) use in regulating proline content under drought stress condition of a plant; A4) use in preparing a product for regulating proline content under drought stress condition of a plant; A5) use in regulating superoxide dismutase activity under drought stress condition of a plant; A6) use in preparing a product for regulating superoxide dismutase activity under drought stress condition of a plant; A7) use in regulating malondialdehyde content under drought stress condition of a plant; A8) use in preparing a product for regulating malondialdehyde content under drought stress condition of a plant; A9) use in plant breeding or plant assisted breeding; A10) use in preparing a product for plant breeding or plant assisted breeding; the protein is any of the following: a1) a protein having an amino acid sequence shown in SEQ ID NO. 1 or 1-359 of SEQ ID NO. 1; a2) a protein having an amino acid sequence shown in a1) with 90% or more identity to the amino acid sequence shown in a1) and being related to drought resistance of a plant, the protein being obtained by substitution and / or deletion and / or addition of amino acid residues to the amino acid sequence shown in a1); a3) a fusion protein obtained by linking a tag to N terminal and / or C terminal of a1) or a2).

2. Use according to claim 1, characterized in that, the substance for regulating expression of a gene encoding the protein or the substance for regulating activity or content of the protein is a biological material, the biological material is any of the following: B1) a nucleic acid molecule encoding the protein as claimed in claim 1; B2) an expression cassette containing the nucleic acid molecule as claimed in B1); B3) a recombinant vector containing the nucleic acid molecule as claimed in B1) or containing the expression cassette as claimed in B2); B4) a recombinant microorganism containing the nucleic acid molecule as claimed in B1) or containing the expression cassette as claimed in B2) or containing the recombinant vector as claimed in B3); B5) a transgenic plant cell line containing the nucleic acid molecule as claimed in B1) or containing the expression cassette as claimed in B2) or containing the recombinant vector as claimed in B3); B6) a transgenic plant tissue containing the nucleic acid molecule as claimed in B1) or containing the expression cassette as claimed in B2) or containing the recombinant vector as claimed in B3); B7) a transgenic plant organ containing the nucleic acid molecule as claimed in B1) or containing the expression cassette as claimed in B2) or containing the recombinant vector as claimed in B3).

3. Use according to claim 2, characterized in that, the nucleic acid molecule as claimed in B1) is a DNA molecule as claimed in any of g1) to g3): g1) a DNA molecule having a coding sequence of the coding strand being SEQ ID NO. 2; g2) a DNA molecule having a nucleotide sequence of the coding strand being SEQ ID NO. 3; and g3) a DNA molecule having a nucleotide sequence of the coding strand being SEQ ID NO.

4. g3) a DNA molecule having 80% or more identity to the DNA molecule of g1) or g2), and which regulates drought resistance in a plant.

4. Use according to any one of claims 1 to 3, characterized in that, The plant is a dicotyledonous plant or a monocotyledonous plant.

5. A method of obtaining a drought resistant plant, characterized in that, The method comprises introducing a gene encoding the protein of claim 1 into a recipient plant to obtain a plant of interest having higher drought resistance than the recipient plant.

6. A method of modulating drought resistance in a plant, comprising, The method comprises regulating the expression level of a gene encoding the protein of claim 1 in a recipient plant to regulate the drought resistance of the recipient plant.

7. The method of claim 6, wherein, The method comprises increasing the expression level of a gene encoding the protein of claim 1 in a recipient plant to increase the drought resistance of the recipient plant.

8. The method of claim 7, wherein, The expression level of a gene encoding the protein of claim 1 in a recipient plant is increased by introducing a gene encoding the protein into the recipient plant.

9. The method according to any one of claims 6-8, characterized in that, The gene encoding the protein is any one of the following g1) to g3): g1) a DNA molecule whose coding sequence of the coding strand is SEQ ID NO. 2; g2) a DNA molecule whose nucleotide sequence of the coding strand is SEQ ID NO. 3; g3) a DNA molecule having 80% or more identity to the DNA molecule of g1) or g2), and which regulates drought resistance in a plant.

10. The protein of any one of claims 1 to 4 and a biomaterial.