Kit for cat infectious peritonitis virus and application thereof

Abstract

The invention relates to a kit for feline infectious peritonitis virus and application of the kit, and relates to the field of detection of feline infectious peritonitis virus. The kit comprises an amplification system, a detection system and a detection card, the amplification system is used for amplifying a target sequence, the target sequence is selected from SEQ ID NO.1, the amplification system comprises a primer group, the primer group comprises an upstream primer and a downstream primer, the upstream primer is as shown in SEQ ID NO.2, and the downstream primer is as shown in SEQ ID NO.8. The amplification system of the kit can specifically amplify the target sequence of the feline infectious peritonitis virus, can distinguish the feline infectious peritonitis virus from other viruses, and does not have cross reaction with other viruses.

Description

Technical Field

[0001] This invention relates to the field of feline infectious peritonitis virus (FIP) detection, and in particular to a kit for FIP and its application. Background Technology

[0002] Feline infectious peritonitis (FIP) is a highly contagious, deadly, and difficult-to-treat disease. FIPV can infect not only domestic cats but also endangered wild animals such as leopard cats and tigers. Felines of different regions, ages, and sexes can be infected, but it commonly affects young felines under two years old. Social felines are more susceptible. Based on the presence or absence of exudate in the pleural or peritoneal cavity, the disease is classified into exudative FIP and non-exudative FIP. The virus is classified into serotype I and serotype II. Early symptoms of FIP are generally similar, including decreased appetite, lethargy, fever, dehydration, and weight loss; diarrhea may also occur. Male felines are prone to orchitis, while female cats are prone to abortion. Clinically, some cases of FIP may present with both exudative and non-exudative FIP symptoms simultaneously, or non-exudative FIP may develop into exudative FIP later. In recent years, FIP has become widespread worldwide, with infection rates on the rise, but effective detection methods are scarce. A definitive diagnosis of FIP requires a comprehensive analysis of multiple indicators, including the animal's medical history, clinical manifestations, laboratory tests, imaging assessments, and histopathological examinations. If exudate is present in the animal's body cavities, FIP detection is often performed by analyzing the exudate. Cats do not develop antibodies until 18–21 days after infection with FCoV; therefore, detection methods for FIPV, such as indirect immunofluorescence, enzyme-linked immunosorbent assay (ELISA), and virus neutralization assays, have low accuracy, and early detection is prone to false negatives. A rapid, accurate, and low-trace detection method is currently lacking in the market.

[0003] Recombinase polymerase amplification (RPA), a novel isothermal amplification technique, primarily utilizes recombinases, single-stranded binding proteins, and polymerases to mimic in vivo DNA (or RNA) amplification. Under isothermal conditions, it can rapidly, sensitively, efficiently, and specifically amplify target fragments. This method boasts advantages such as high sensitivity, strong specificity, short reaction time, and high amplification efficiency. The CRISPR / Cas system, an acquired immune system in prokaryotes, resists invasion by exogenous bacteriophages or plasmid genetic elements. It is now widely used in genetic engineering and nucleic acid detection. CRISPR / Cas12a, a variant of the CRISPR-Cas system, also known as Cpf1, possesses DNA cleavage capabilities, enabling the cleavage of specific single-stranded DNA probes for rapid nucleic acid detection. In RPA-amplified double-stranded DNA, guided by crRNA, Cas12a cleaves the double-stranded template DNA and fluorescently labeled probe. The probe is hydrolyzed, releasing a fluorescent signal; the presence or absence of the target nucleic acid fragment is determined by detecting the intensity of the fluorescence signal. However, to date, there have been no reports of applying the CRISPR system to the detection of feline infectious peritonitis virus. Furthermore, most RPA / CRISPR detection methods involve multiple manual operations to transfer amplified products in an open system, which may increase the risk of residual contamination. Summary of the Invention

[0004] To address the aforementioned problems, this invention provides a kit for feline infectious peritonitis virus (FIP). The amplification system of this kit can specifically amplify the target sequence of FIP, distinguish FIP from other viruses, and does not cross-react with other viruses.

[0005] To achieve the above objectives, the present invention provides a kit for feline infectious peritonitis virus, comprising an amplification system, a detection system, and a microfluidic system;

[0006] The amplification system is used to amplify a target sequence, the target sequence being selected from SEQ ID NO.1. The amplification system includes a primer set, which includes an upstream primer and a downstream primer, the upstream primer being shown in SEQ ID NO.2 and the downstream primer being shown in SEQ ID NO.8.

[0007] The target sequence is located in the N protein gene of feline infectious peritonitis virus (FIPV). It has a linear structure, lacks complex structures such as hairpins, and has a low GC content, making it easy to dissociate and amplify. Primer combinations designed and optimized based on this target sequence are particularly effective in distinguishing FIPV (including recombinant viruses with the N gene sequence) from other coronaviruses or other feline viruses, superior to other primer combinations used in the experiment. This allows the amplification system of the kit to specifically amplify the target sequence of FIPV without cross-reactivity with other viruses, and the limit of detection can reach 100 copies / μL. Based on this amplification system, a kit was constructed for the detection of FIPV, enabling rapid detection with high sensitivity and specificity, low labor and equipment costs, and a short cycle time of no more than 2 hours. This rapid detection technology can be widely applied to the epidemiological investigation and epidemic monitoring of FIPV in wild felines such as tigers and leopard cats, possessing significant practical value and broad market prospects.

[0008] In one embodiment, the target sequence is SEQ ID NO.18.

[0009] In one embodiment, the detection system includes a Cas enzyme, crRNA, and an ssDNA probe, wherein the crRNA is shown in SEQ ID NO.14 and the ssDNA probe has the sequence TTATT.

[0010] In one embodiment, the Cas enzyme is Cas12a.

[0011] In one embodiment, the 5' end of the ssDNA probe is labeled with FAM, and the 3' end of the ssDNA probe is labeled with BHQ1.

[0012] In one embodiment, the amplification system is an RPA amplification system, which further includes RPA amplification reagents; the detection system is a CRISPR / Cas12a detection system, which further includes CRISPR / Cas12a recognition and cleavage reagents.

[0013] In one embodiment, the microfluidic system includes an amplification material chamber, an amplification reaction chamber, a detection reaction chamber, and a detection material chamber connected in sequence.

[0014] In one embodiment, the amplification material chamber is used to hold the amplification system, and the detection material chamber is used to hold the detection system. Both the amplification material chamber and the detection material chamber are made of deformable material.

[0015] The aforementioned amplification material chamber and detection material chamber are made of deformable material. Operators can send the materials pre-stored in the amplification material chamber and detection material chamber into the amplification reaction chamber and detection reaction chamber by squeezing or other pressure application methods. Operators can also drive the reaction liquid to flow in the microfluidic system by repeatedly applying pressure.

[0016] In one embodiment, the amplification reaction chamber is provided with a conduit, one end of which is connected to the detection reaction chamber, and the other end of which faces the top of the amplification reaction chamber.

[0017] The reagent kit based on the above-described test card structure can complete the test without opening the cap, avoiding contamination from aerosols and improving the accuracy of the test.

[0018] The present invention also provides a biomarker for detecting feline infectious peritonitis virus, wherein the biomarker is the target sequence in the kit.

[0019] The present invention also provides a recombinant vector, comprising the vector and the target sequence in the kit.

[0020] In one embodiment, the vector includes the pUC57 vector.

[0021] This invention also provides a method for detecting feline infectious peritonitis virus (FIP) for non-diagnostic purposes. The method includes the following steps: extracting RNA from the sample to be tested, reverse transcribing it into cDNA as template DNA, amplifying the template DNA using the amplification system in the kit to obtain amplification products, and detecting the amplification products using the detection system in the kit.

[0022] In one embodiment, the method includes the following steps:

[0023] RNA was extracted from the sample to be tested and reverse transcribed into cDNA as template DNA. The template DNA was added to the RPA amplification system and mixed well. The RPA amplification reaction was carried out using a primer set to obtain the amplification product. The conditions for the RPA amplification reaction included: amplification temperature of 37℃ and amplification time of 35 min.

[0024] The amplification product was mixed with the CRISPR / Cas12a detection system to perform the Cas12a fluorescence detection reaction. The conditions for the Cas12a fluorescence detection reaction included incubation at 37°C in a real-time PCR instrument, collecting fluorescence signals once every 30 seconds, for a total of 90 cycles.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] This invention relates to a kit for feline infectious peritonitis virus (FIPV) and its application. The amplification system of this kit can specifically amplify the target sequence of FIPV, distinguishing it from other viruses. It can detect only FIPV, while failing to detect civet-borne influenza virus (CivIV), SADS coronavirus (SADS-CoV), feline calicivirus (FCV), and feline parvovirus (FPV), which are easily confused with FIPV. The kit achieves 100% accuracy in detecting FIPV, accurately detecting the target substance and reducing the probability of false positives or false negatives. The limit of detection is 10-1. 2 This kit offers high efficiency, completing the test and reporting within 2 hours, outperforming quantitative RT-PCR and loop-mediated isothermal amplification (LCA). The kit is easy to operate, requiring no specialized personnel, and offers rapid testing. Results can be interpreted visually under UV light, saving time and manpower. It is also economical; compared to traditional methods, this kit eliminates the need for large instruments, resulting in lower costs and facilitating mass production and widespread application. Furthermore, its compact design makes it easy to carry and store, suitable for use in animal hospitals, veterinary clinics, and large-scale outdoor screenings. The unique design of the test card eliminates the need for repeated sample loading, avoiding aerosol contamination that could lead to false positives or false negatives. Compared to the traditional 87% accuracy, this kit achieves 100% accuracy, significantly improving accuracy. The overall detection method is also more environmentally friendly, using non-toxic raw materials and reducing the risk of environmental pollution. Attached Figure Description

[0027] Figure 1 Image of standard plasmid;

[0028] Figure 2 This is a gel electrophoresis image of PRA amplification products. Lanes 1-8 represent RPA amplification primer combinations 1-8, negative control, and no standard template was added.

[0029] Figure 3 This is a graph showing the fluorescence intensity of crRNA.

[0030] Figure 4 Fluorescence images of the reaction system for crRNA screening experiments;

[0031] Figure 5 Top view of the microfluidic system;

[0032] Figure 6 This is a cross-sectional view of a microfluidic system.

[0033] Figure 7The figure shows the results of the RPA reaction temperature optimization experiment. Figure 7 A represents the fluorescence value at different RPA reaction temperatures. Figure 7 B shows the color fluorescence results at different RPA reaction temperatures. Figure 7 C shows the black-and-white fluorescence results at different RPA reaction temperatures. Figure 7 D shows the results of Western blotting proteins at different RPA reaction temperatures. (For ease of observation...) Figure 7 C interception Figure 7 B consists of the first 5 tubes from left to right;

[0034] Figure 8 The figure shows the results of the RPA reaction time optimization experiment, where, Figure 8 A represents the fluorescence value at different RPA reaction times. Figure 8 B shows the color fluorescence results for different RPA reaction times. Figure 8 C represents the Western blot results for different RPA reaction times. Figure 8 D shows the black-and-white fluorescence results for different RPA reaction times, for ease of observation. Figure 8 D interception Figure 8 C consists of the first 5 tubes from left to right;

[0035] Figure 9 The figure shows the results of the CRISPR / Cas12a reaction temperature optimization experiment. Figure 9 A represents the fluorescence values ​​at different CRISPR / Cas12a reaction temperatures. Figure 9 B shows the color fluorescence results at different CRISPR / Cas12a reaction temperatures. Figure 9 C represents the black-and-white fluorescence results at different CRISPR / Cas12a reaction temperatures;

[0036] Figure 10 The figure shows the results of the experiment to optimize the concentration of LbCas12a enzyme. Figure 10 A represents the fluorescence values ​​at different LbCas12a enzyme concentrations. Figure 10 B shows the fluorescence results for different LbCas12a enzyme concentrations;

[0037] Figure 11 The figure shows the results of the crRNA concentration optimization experiment. Figure 11 A represents the fluorescence value corresponding to different crRNA concentrations. Figure 11 B shows the color fluorescence results for different crRNA concentrations. Figure 11 C shows the black-and-white fluorescence results corresponding to different crRNA concentrations;

[0038] Figure 12 The figure shows the results of the experiment to optimize the concentration of ssDNA Reporter. Figure 12A represents the fluorescence value corresponding to different ssDNAReporter concentrations. Figure 12 B. Figure 12 C shows the fluorescence results corresponding to different ssDNA Reporter concentrations;

[0039] Figure 13 This is the standard curve for RT-PCR;

[0040] Figure 14 The image shows the fluorescence values ​​used to verify the sensitivity of RT-RPA-CRISPR / Cas12a.

[0041] Figure 15 The graph shows the results of the sensitivity verification test for RT-RPA-CRISPR / Cas12a, with a detection limit of 100 copies / μL.

[0042] Figure 16 The results of the system sensitivity confirmation experiment are shown in the figure below, which are the results of three parallel experiments from top to bottom.

[0043] Figure 17 The results of the system sensitivity verification are shown in the graphs, which are the results of three parallel experiments from left to right.

[0044] Figure 18 The results of the specificity verification experiment are shown in the figure. In the figure, 1 is the nucleic acid of FIPV clinical pathogens; 2-5 are the nucleic acid of SADS-CoV, FCV, FPV and CivIV clinical pathogens, respectively. Detailed Implementation

[0045] To facilitate understanding of the present invention, a more complete description will be given below with reference to the accompanying drawings. Preferred embodiments of the invention are shown in the drawings. However, the invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the invention.

[0046] It should be noted that when a component is said to be "fixed to" another component, it can be directly on the other component or there may be an intervening component. When a component is said to be "connected to" another component, it can be directly connected to the other component or there may be an intervening component.

[0047] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0048] source:

[0049] Unless otherwise specified, all reagents, materials, and equipment used in this embodiment are commercially available; unless otherwise specified, all experimental methods are conventional experimental methods in this field.

[0050] Example

[0051] 1. Instruments and reagents.

[0052] DNA Isothermal Rapid Amplification Kit (Basic Type), Anpu Future (Changzhou) Biotechnology Co., Ltd., Plasmid Extraction Kit (Shanghai Biotechnology Co., Ltd.), DNA Extraction Kit (Shanghai Biotechnology Co., Ltd.), DNA Marker (Shanghai Biotechnology Co., Ltd.), Agarose (Shanghai Biotechnology Co., Ltd.), Green-2-Go 2×qPCR ROX Premix (Shanghai Biotechnology Co., Ltd.), LbCas12a Nuclease (Guangzhou Aidi Gene Co., Ltd.), LbCas12aCleavage Buffer (Guangzhou Aidi Gene Co., Ltd.), ssDNA-FQ Type (Guangzhou Aidi Gene Co., Ltd.), NanoDrop2000 Ultra-Micro Spectrophotometer, 7500 Real-Time PCR Instrument, MyCycler PCR Instrument, WD-9403E UV Spectrometer, BIO-RAD Gel Imaging Analyzer.

[0053] 2. Sample.

[0054] This invention uses five pathogens, including feline infectious peritonitis virus (FIPV), porcine acute diarrhea syndrome coronavirus (SADS-CoV), feline parvovirus (FPV), tiger-derived feline calicivirus (FCV), and civet-derived influenza virus H1N1 (CivIV), all of which were preserved in the Guangzhou Zoo laboratory for the purpose of verifying the specificity of FIPV.

[0055] 3. Design and synthesis of primers and crRNA.

[0056] The genome sequences of feline infectious peritonitis virus (FIPV), SADS-CoV, SAR-CoV-2, canine enteric coronavirus (CCoV), and MERS-CoV were downloaded from the NCBI database and compared using MEGA 6.06 biological software. A fragment of the N protein gene (27242-27801) of the FIPV SM strain isolated by our team was selected as the target gene for primer design. NCBI BLAST analysis showed that this region was completely identical to the N protein gene (27196-27755) sequence region of the FIPV DF-2 strain (NCBI accession number JQ408981.1).

[0057] The sequence of the N protein gene region 27242-27801 of the above-mentioned FCoV SM strain is shown below:

[0058] ACAGATCTCAATCTAGAGGAAGACACCATTCCAATAACCAGAATAATAATGTTGAGGATA

[0059] CAATTGTAGCCGTGCTTGAAAATTAGGTGTTACTGACAAACAAAGGTCACGTTCTAAA

[0060] CCTAGAGAACGTAGTGATTCCAAACCTAGGGACAACACCTAAGAATGCCAACAAAC

[0061] ACACCTGGAAGAAAACTGCAGGCAAGGGAGATGTGACAACTTTCTATGGTGCTAGAAG

[0062] TAGTTCAGCTAACTTTGGTGATAGTGATCTCGTTGCCAATGGTAACGCTGCCAAATGCTA

[0063] CCCTCAGATAGCTGAATGTGTTCCATCAGTGTCTAGCATAATCTTTGGCAGTCAATGGTCT

[0064] GCTGAAGAAGCTGGTGATCAAGTGAAAGTCACGCTCACTCACCTACTACCTGCCAA

[0065] AGGATGATGCCAAAACTAGTCAATTCCTAGAACAGATTGACGCTTACAAGCGACCTTCT

[0066] GAAGTGGCTAAGGATCAGAGGCAAAGAAGATCCCTTTCTAAGTCTGCTGATAAGAAGCCTGAGGAGTTGTCTGTAACTCTTGTGGAG(SEQ ID NO.1)。

[0067] Using primer design software and following the Twist primer design principles: the 5' end 3-5 nucleotides of the primer should avoid polyguanine; the terminal 3 bases of guanine and cytosine help stabilize polymerase binding and improve primer amplification performance; special sequences, such as long polypurine or polypyrimidine sequences, should be avoided in the primers; excessively high (>70%) or low (<30%) GC content is not conducive to RPA amplification; in addition, primer design should avoid sequences that easily form secondary structures, primer-primer interactions, or hairpin structures to reduce primer dimer formation. RPA amplification primers were designed according to the above principles (Table 1). After BLAST comparison with NCBI confirmed that all results were feline infectious peritonitis virus and its recombinant virus, they were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Simultaneously, specific crRNA (Table 3) and fluorescent probes for guiding Cas12a were designed based on the DNA fragments amplified by RPA and synthesized by Guangzhou Aidi Gene Co., Ltd. The RPA amplification primer sequences, RPA amplification primer combinations, crRNA sequences, and fluorescent probes are shown below.

[0068] Table 1 RPA amplification primer sequences

[0069] serial number Primer name Sequence 5'-3' SEQ ID NO.2 F1 TAGTGATTCCAAACCTAGGGACACAACACC SEQ ID NO.3 F2 AACACCTAAGAATGCCAACAAACACACCTG SEQ ID NO.4 F3 ACACACCTGGAAGAAAACTGCAGGCAAGGG SEQ ID NO.5 F4 TTCCAATAACCAGAATAATAATGTTGAGGA SEQ ID NO.6 F5 CAGATAGCTGAATGTGTTCCATCAGTGTCTAGC SEQ ID NO.7 R1 TTGACTGCCAAAGATTATGCTAGACACTGATGG SEQ ID NO.8 R2 CTTTCACTTGATCACCAGCTTCTTCAGCAG SEQ ID NO.9 R3 CATAGAAAGTTGTCACATCTCCCTTGCCTG SEQ ID NO.10 R4 CTCAGGCTTCTTATCAGCAGACTTAGAAAGGGATC

[0070] Table 2. RPA amplification primer combinations

[0071] Serial Number RPA primer combination 1 F1R1 2 F1R2 3 F2R1 4 F2R2 5 F3R1 6 F3R2 7 F5R4 8 F4R3 Negative F4R3

[0072] Table 3. Designed crRNA Sequences

[0073]

[0074]

[0075] Note: The sequences in the table above are RNA sequences, where T is the letter representation in the WIPOSequence list, and actually represents uracil (U).

[0076] The nucleotide sequence of the ssDNA probe is TTATT. The 5' end of the ssDNA probe is labeled with FAM and the 3' end is labeled with BHQ1, specifically: 5'-FAM-TTATT-BHQ1-3'.

[0077] 4. Plasmid preparation.

[0078] The target genes were ligated into the pUC57 vector to synthesize a plasmid (see figure for standard plasmid). Figure 1 (As shown), it was transformed into Top10 for propagation, and positive clones were selected to extract plasmids, obtaining the recombinant plasmid pUC57-FIPVN standard.

[0079] The OD of pUC57-FIPVN was measured. 260 / OD 280 The pH value is between 1.8 and 2.0, meeting the purity requirements, and the plasmid concentration is 180 ng / μL, approximately 4.067 × 10⁻⁶. 10 copies / μL, diluted to 10 with ddH2O 10 Copies / μL were then serially diluted 10-fold to prepare plasmid standards for later use.

[0080] 5. Screening of RPA primer pairs.

[0081] The FIPV recombinant plasmid (pUC57-FIPVN) was diluted to 10... 10 Copies / μL were used as standards, prepared according to the following RPA reaction system, reacted at 37℃ for 35 min, and then analyzed by gel electrophoresis.

[0082] Table 4 RPA Reaction System

[0083] Element Volume (μL) A buffer 11.76 Forward primer (10μM) 0.8 Reverse primer (10μM) 0.8 <![CDATA[DEPC H2O]]> 4.64 Target (500 copies) 1 B buffer 1 Total 20

[0084] 10 μL of the reaction product was extracted and verified by electrophoresis. The results are as follows: Figure 2 As shown. By Figure 2 It can be seen that the second pair of amplification primers (F1R2) has better amplification efficiency and more uniform bands (the uniformity of the eighth pair of amplification primers is not as good). Therefore, primer pair F1R2 should be selected for the next experiment.

[0085] 6. crRNA screening.

[0086] The FIPV recombinant plasmid (pUC57-FIPVN) was diluted to 10... 10 As a standard, copies / μL were prepared according to the following crRNA reaction system, placed in a Bio-Rad CFX96 fluorescence PCR instrument, and the reaction temperature was set to 37℃, the reaction time to 35 min, and the fluorescence signal was collected once per minute to record the changes in fluorescence signal.

[0087] Table 5. CrRNA Screening Reaction System

[0088] Element Volume (μL) Cleavage Buffer 3 LbCas12a 1 crRNA 1 DNA Reporter 1.2 Standard product (5.5nM) 1 <![CDATA[DEPC H2O]]> 22.8 Total 30

[0089] The experimental results yielded a crRNA fluorescence intensity map. Figure 3 ) and fluorescence images of the reaction system ( Figure 4 The results showed that crRNA4 had the best fluorescence intensity, so crRNA4 was selected.

[0090] 4. Template preparation.

[0091] Nucleic acid was extracted from FIPV, SADS-CoV, FPV, FCV, and CivIV using a viral RNA nucleic acid extraction kit, strictly following the kit instructions.

[0092] 5. Construction of the reaction system.

[0093] Step 1: Construction of the RT-RPA reaction system.

[0094] Prepare a reaction premix (50 μL system) in a clean EP tube: 29.4 μL Primer Free Rehydration buffer, 2 μL Forward Primer (F1, as shown in SEQ ID NO.2), 2 μL Reverse Primer (R2, as shown in SEQ ID NO.8), and 9.1 μL ddH2O. Mix well and add to an EP tube containing lyophilized enzyme. Add 5 μL template DNA (100 ng / mL), and finally add 2.5 μL MgOAc activator to the cap. After vortexing and centrifugation, heat in a 37°C water bath for 35 min. The amplified product (nucleic acid sequence as shown in SEQ ID NO.18) is purified and the experimental results are observed by gel electrophoresis.

[0095] Primer F1R2 amplifies the target fragment:

[0096] TAGTGATTCCAAACCTAGGGACACAACACCTAAGAATGCCAACAAACACACCTGGAAGAAAACTGCAGGCAAGGGAGATGTGACAACTTTCTATGGTGCTAGAAGTAGTTCAGCTAACTTTGGTGATAG TGATTCCGTTGCCAATGGTAACGCTGCCAAATGCTACCCTCAGATAGCTGAATGTGTTCCATCAGTGTCTAGCATAATCTTTGGCAGTCAATGGTCTGCTGAAGAAGCTGGTGATCAAGTGAAAG(SEQ ID NO.18).

[0097] Note: GTTGCCAATGGTAACGCTGC is the crRNA4 splicing site.

[0098] Step 2: Construction of the RT-RPA-CRISPR / Cas12a system.

[0099] Establishment of the RT-RPA-CRISPR / Cas12a system (30 μL system): In a sterile PCR tube, add 3 μL of 10×Cleavage Buffer, 1 μL of LbCas12a Nuclease (final concentration 10 nM–50 nM), 1.2 μL of fluorescent reporter probe (ssDNA-FQ type) (final concentration 300 nM–1.2 μM), 1 μL of crRNA (crRNA fragment as shown in SEQ ID NO.14) (final concentration 10 nM–50 nM), and 18.8 μL of DEPC H2O. After mixing, add 5 μL of RT-RPA amplification product. After mixing and centrifugation, incubate in a real-time PCR instrument at 37°C. Collect fluorescence signals every 30 seconds for a total of 90 cycles. Add DEPCH2O as a template for the negative control.

[0100] The reaction results can be interpreted by visually observing the fluorescence intensity of the reaction solution under ultraviolet light and by statistically analyzing the fluorescence values ​​in the quantitative PCR instrument. Specifically, in constructing the RPA-CRISPR / Cas12a fluorescence system, the initial concentration of LbCas12aNuclease was 1 μM, diluted to a final concentration of 10 nM–50 nM before use; the initial concentration of ssDNA-FQ was 2 μM, diluted to a final concentration of 300 nM–1.2 μM before use; and the initial concentration of crRNA was 100 μM, diluted to a final concentration of 10 nM–50 nM before use.

[0101] 6. Establishment of microfluidic system.

[0102] A top view of the microfluidic system is shown below. Figure 5 As shown, the sectional view is as follows Figure 6 As shown.

[0103] The microfluidic system includes blister packs 1, 2, 5, and 6 (blister packs 1 and 2 are amplification chambers, and blister packs 5 and 6 are detection chambers), an RPA reaction chamber 3 (i.e., the amplification reaction chamber, which is an EP tube in this embodiment), and a CRISPR / Cas12a reaction chamber 4 (i.e., the detection reaction chamber, which is an EP tube in this embodiment). Blister packs 1 and 2, RPA reaction chamber 3, CRISPR / Cas12a reaction chamber 4, and blister packs 5 and 6 are connected sequentially. Blister packs 1 and 2 are connected to RPA reaction chamber 3 via blister pack tubing 10, and blister packs 5 and 6 are connected to CRISPR / Cas12a reaction chamber 4 via blister pack tubing 9. RPA reaction chamber 3 and CRISPR / Cas12a reaction chamber 4 are connected via tubing 8. RPA reaction chamber 3 has an internal tube 7 with a volume of 5 μL. One end of tube 7 is connected to tubing 8, and the other end of tube 7 faces the top of RPA reaction chamber 3.

[0104] Bubbles 1, 2, 5, and 6 are all squeezeable blister packs. Bubble pack 1 contains 11.76 μL of A buffer, 0.8 μL of each primer pair's upstream and downstream primers, and 3.64 μL of DEPC H2O. Repeated squeezing will push the liquid inside blister pack 1 into RPA reaction chamber 3. Bubble pack 2 contains 1 μL of B buffer. Repeated squeezing will push the liquid inside blister pack 2 into RPA reaction chamber 3. CRISPR / Cas12a reaction chamber 4 contains 3 μL of Cleavage Buffer and 1 μL of LbCas12a Nuclease at a concentration of 10 nM–50 nM. Bubble pack 5 contains 1.2 μL of ssDNA-FQ at a concentration of 300 nM–700 nM. Bubble pack 6 contains 1 μL of crRNA at a concentration of 10 nM–70 nM and 18.8 μL of DEPC H2O.

[0105] Operating procedure of the microfluidic system: Repeatedly squeeze blister 1 to push the liquid inside the blister into RPA reaction chamber 3. Open the lid of reaction chamber 3 and add template cDNA. Then, repeatedly squeeze blister 2 to push the pre-stored reagent into RPA reaction chamber 3. Mix thoroughly and heat in a 37°C water bath for 35 minutes. Invert RPA reaction chamber 3 to transfer the amplification reaction product originally at the bottom of RPA reaction chamber 3 to the top of RPA reaction chamber 3. Due to the specific orientation of the built-in tube 7, the amplification product located at the top of RPA reaction chamber 3 can be aspirated. The reaction product is then turned over, and after the amplified reaction product fills the built-in tube 7, the folded sealing film of the tubing 8 is untied, so that the tubing 8 is connected to the CRISPR / Cas12a reaction chamber 4. The liquid in the built-in tube 7 enters the CRISPR / Cas12a reaction chamber 4 through the tubing 8. Then, the blister packs 5 and 6 are squeezed repeatedly to allow the liquid in the blister packs 5 and 6 to enter the CRISPR / Cas12a reaction chamber 4 through the tubing 9. After thorough mixing, the mixture is heated in a 37°C water bath for 35 minutes. The product is then removed and the detection results are read under ultraviolet light.

[0106] Using the microfluidic system of the present invention for amplification and detection, the entire process only requires opening the lid of the RPA reaction chamber 3 once when adding the template cDNA. Subsequent reactions do not require opening the lid again. Therefore, the amplification reaction and CRISPR reaction are carried out inside the microfluidic system, avoiding aerosol contamination caused by opening the lid and transferring the amplification reaction products.

[0107] 7. Optimization of reaction conditions.

[0108] (1) Optimization of RPA reaction temperature.

[0109] After determining the reaction primers, the RPA system reaction temperature was optimized. FIPV was amplified by RPA at 35℃, 37℃, 39℃, and 41℃ for 30 min. The amplification products at different temperatures were processed according to the procedure for constructing the RPA-CRISPR / Cas12a fluorescence system. The negative control was performed at the kit-recommended temperature of 39℃. The RPA reaction system was optimized. The temperature selection was based on amplification efficiency, and the optimal reaction temperature was determined by observing the gel electrophoresis bands, visually observing the fluorescence intensity after probe cleavage, and the fluorescence value of the qPCR reaction.

[0110] The results show ( Figure 7 The fluorescence intensity is strongest at 37°C, therefore 37°C will be used for subsequent reactions.

[0111] (2) Optimization of RPA reaction time.

[0112] RPA amplification time can affect the amplification efficiency of the reaction to some extent. Within a certain range, the gel electrophoresis bands and the fluorescence value of the CRISPR / Cas12a system will increase with the extension of RPA amplification time. FIPV RPA amplification was performed at 20 min, 25 min, 30 min, and 35 min, respectively, with the negative control performed at the kit-recommended 30 min. The amplified product was used as a template, and ddH2O was used as a negative control for CRISPR / Cas12a reaction. The optimal amplification time was selected by observing the gel electrophoresis bands of the RPA product, the fluorescence value of the qPCR instrument, and the fluorescence intensity observed visually.

[0113] The results show ( Figure 8 The fluorescence intensity was strongest and reached its peak at 35 min, therefore the optimal reaction time thereafter was 35 min.

[0114] (3) Optimization of CRISPR / Cas12a reaction temperature.

[0115] The incubation temperature of the CRISPR / Cas12a system affects the activity of crRNA and LbCas12a enzyme, thus influencing the efficiency of probe cleavage. To facilitate visualization of the results, the temperature of the CRISPR / Cas system was optimized in this study. Four reaction tubes were set up at 35℃, 37℃, 39℃, and 41℃, along with one negative control tube. The negative control was operated at 37℃ as recommended by the kit. The RT-RPA-CRISPR / Cas12a fluorescence system was constructed according to the method described for the RT-RPA-CRISPR / Cas12a system. The optimal reaction temperature was determined by visually observing the fluorescence intensity of each reaction tube under UV light and the fluorescence value in the PCR instrument.

[0116] The results show ( Figure 9The fluorescence intensity is strongest at 37℃, therefore the optimal reaction time is 37℃.

[0117] (4) Optimization of LbCas12a enzyme concentration.

[0118] The RPA-CRISPR / Cas12a fluorescence detection method, constructed using the RT-RPA-CRISPR / Cas12a system, optimized the LbCas12a enzyme concentration in the reaction system. The enzyme concentrations were set at 10 nM, 30 nM, and 50 nM, with a negative control tube included for comparison. The negative control was performed at the recommended 30 nM concentration. The cleavage reaction was carried out at the optimal reaction temperature selected under optimized CRISPR / Cas12a reaction conditions. After the reaction, the fluorescence intensity of the reaction solution was observed under UV light, and the fluorescence values ​​at different concentrations were compared with those in the PCR instrument to determine the optimal enzyme concentration.

[0119] The results show ( Figure 10 The highest fluorescence value can be achieved with 30 nM LbCas12a nuclease, and no higher fluorescence signal is obtained after increasing the concentration of LbCas12b to 50 nM.

[0120] (5) Optimization of crRNA concentration.

[0121] Three concentration gradients of crRNA were set up: 10 nM, 30 nM, and 50 nM. Using the optimized enzyme concentration, an RPA-CRISPR / Cas12a fluorescence system was constructed according to the RPA-CRISPR / Cas12a system construction method. The cleavage reaction was performed at the optimal temperature. A negative control was performed at the recommended 30 nM concentration. Results were interpreted using qPCR fluorescence values ​​and intensities.

[0122] The results show ( Figure 11 The highest fluorescence value can be achieved with 30 nM crRNA nuclease, and no higher fluorescence signal is obtained after increasing the concentration of crRNA to 50 nM.

[0123] (6) Optimization of ssDNA Reporter concentration.

[0124] After obtaining the optimal reaction temperature, Cas12a enzyme, and crRNA concentrations through the above operations, the amount of reporter probe in the reaction system was optimized. ssDNA-FQ was set to the following eight concentration gradients: 300 nM, 400 nM, 500 nM, 600 nM, 700 nM, 800 nM, 1 μM, and 1.2 μM. The negative control was performed at the recommended 400 nM. The reaction tubes were placed in a qPCR instrument, and fluorescence signals were acquired every 60 seconds at 37°C for 90 cycles. The fluorescence values ​​at each concentration were recorded.

[0125] The results show ( Figure 12 The fluorescence intensity of ssDNA Reporter gradually increases with increasing probe concentration between 300 and 600 nM. At 700 nM, the fluorescence value, both visually and instrumentally measured, decreases slightly, while peak fluorescence values ​​are observed at 1 μM and 1.2 μM. Considering both visual inspection and the cost-effectiveness of the raw materials, the probe concentration can be selected between 300 nM and 1.2 μM. Since the difference in fluorescence brightness is imperceptible to the naked eye at probe concentrations ≥700 nM, a probe concentration of 600 nM is sufficient from a cost perspective.

[0126] 8. Sensitivity verification.

[0127] (1) Dilute the FIPV recombinant plasmid (pUC57-FIPVN) to 10 10 As a standard, copies / μL were used, and the standard was further diluted to 1000 copies / μL, 100 copies / μL, and 10 copies / μL. The RPA reaction system was prepared according to the table below (Table 6), and the reaction program was: 37℃, 35 min. After RPA amplification, 5 μL of RPA product was added to the digestion system (Table 7). The system was placed in a Bio-Rad CFX96 fluorescence PCR instrument, with the reaction temperature set to 37℃ and the reaction time to 35 min. Fluorescence signals were collected every minute, and changes in fluorescence signals were recorded.

[0128] Table 6 Sensitivity Test RPA Amplification System

[0129] Element 1× system A buffer 5.88 Forward primer (10μM) 0.4 Reverse primer (10μM) 0.4 <![CDATA[DEPC H2O]]> 1.82 Standards (1000, 100, 10, 0 copies / μL) 1 B buffer 0.5 Total 10

[0130] Table 7 Sensitivity Test of CRISPR / Cas12a Cutting Reaction System

[0131] Components Volume / μL 10×Cleavage Buffer 3 1μM LbCas12a Nuclease 1 1μM crRNA 1 10μM ssDNA Reporter 1.2 RPA amplification products 5 <![CDATA[DEPC H2O]]> 18.8 Total 30

[0132] The detection limit of RT-PCR reaction is determined by plotting an RT-PCR standard curve (RT-PCR standard curve, e.g., ...). Figure 13 As shown in the figure, the difference in sensitivity between the two methods was finally determined.

[0133] The results are as follows Figure 14 , Figure 15 As shown, the RT-PCR detection method involves designing RT-PCR primers for the N gene, with a minimum detection limit of 10. 3 copies / μL.

[0134] F: 5'-ACACAACACCTAAGAATGCCAAC-3' (SEQ ID NO.19)

[0135] R: 5'-TGGCAACGAGATCACTATCACC-3' (SEQ ID NO. 20)

[0136] The lowest detection rate of the RT-RPA-CRISPR / Cas12a of this invention is 10. 2 copies / μL.

[0137] (2) Confirmation of system sensitivity.

[0138] The target was diluted from its original concentration to 100 copies / μL, and the experiment was repeated three times, with two reactions each time. The reaction system and procedure were the same as above, and the test results were as follows. Figure 16 , Figure 17 As shown.

[0139] As shown in the figure, fluorescence values ​​can be detected for all 100 copies / μL of target, thus confirming that the final sensitivity of this system can reach 100 copies / reaction.

[0140] 9. Specificity verification.

[0141] Using extracted FIPV, SADS-CoV, FCV, FPV, and CivIV nucleic acids as templates, FIPV primers were added for recombinase polymerase amplification. The amplification products were used as templates to construct CRISPR / Cas12a fluorescence systems. The fluorescence intensity was observed by the naked eye, and the fluorescence value was detected by a qPCR instrument for result interpretation. The results were compared with the RT-PCR method to evaluate the specificity of the method.

[0142] The results are as follows Figure 18 As shown, the qPCR fluorescence values ​​and RPA-CRISPR / Cas12a results for FCV, FPV, CivIV, and SADS-CoV were all negative, with both methods exhibiting 100% specificity. This result indicates that the RT-RPA-CRISPR / Cas12a fluorescence value interpretation method has good specificity.

[0143] 10. The accuracy of microfluidic system testing.

[0144] One hundred clinically obtained FIPV-positive lung and intestinal tissue samples were collected, and nucleic acids were extracted from each sample. Fifty samples were amplified with FIPV RPA primers using recombinase polymerase. The amplified products were then used as templates for subsequent CRISPR / Cas12a cleavage reactions to observe the results. FIPV standard plasmids were used as positive controls, and DEPC H2O was used as a negative control. Another 50 samples were reacted in a microfluidic system to evaluate the accuracy of the method under the two conditions (microfluidic and open system).

[0145] The results showed that the detection rate of positive samples in the microfluidic system was 100%, while the detection rate of positive samples in the open system was 87%. The main reason for the poor performance in the open system was sample or aerosol contamination, which affected fluorescence interpretation.

[0146] Table 8. Detection accuracy of RT-RPA-CRISPR / Cas12a for FIPV in microfluidic and open systems.

[0147] Sample type Yang Ben Shu System type accuracy Cat FIPV positive lung sample 50 microfluidics 100％ FIPV positive colon sample from cat 50 microfluidics 100％ Cat FIPV positive lung sample 50 Open system 90％ FIPV positive colon sample from cat 50 Open system 84％

[0148] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0149] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. A kit for use in feline infectious peritonitis virus, characterized in that, The kit comprises an amplification system, a detection system and a microfluidic system. The amplification system is used for amplifying a target sequence selected from SEQ ID NO. 1, and comprises a primer set comprising an upstream primer and a downstream primer, wherein the upstream primer is shown as SEQ ID NO. 2, and the downstream primer is shown as SEQ ID NO.

8.

2. The kit of claim 1, wherein The target sequence is SEQ ID NO.

18.

3. The kit of claim 1, wherein The detection system comprises a Cas enzyme, a crRNA shown as SEQ ID NO. 14 and a ssDNA probe with a sequence of TTATT.

4. The kit of claim 3, wherein The 5' end of the ssDNA probe is labeled with FAM, and the 3' end of the ssDNA probe is labeled with BHQ1.

5. The kit according to any one of claims 1 to 4, characterized in that, The microfluidic system comprises, in sequence, an amplification material chamber, an amplification reaction chamber, a detection reaction chamber and a detection material chamber.

6. The kit of claim 5, wherein The amplification material chamber is used for placing the amplification system, and the detection material chamber is used for placing the detection system.

7. The kit of claim 5, wherein The amplification material chamber and the detection material chamber are made of a deformable material.

8. A biomarker for the detection of feline infectious peritonitis virus, characterized in that, The amplification reaction chamber is internally provided with a pipeline, one end of the pipeline is in communication with the detection reaction chamber, and the other end of the pipeline is directed to the top of the amplification reaction chamber.

9. A recombinant vector, characterized in that, The biomarker is a target sequence in the kit of any one of claims 1-7.

10. A method of detecting feline infectious peritonitis virus for non-diagnostic purposes, characterized in that, The kit comprises a carrier and a target sequence in the kit of any one of claims 1-7. The method comprises the following steps: extracting RNA of a sample to be tested, reverse transcribing the RNA into cDNA as template DNA, using the amplification system in the kit of any one of claims 1-7 to perform an amplification reaction on the template DNA to obtain an amplification product, and using the detection system in the kit of any one of claims 1-7 to perform a detection reaction on the amplification product.

Images