CeNF-YA3 gene, expression vector and its application in plant oil regulation
By isolating and constructing subcellular localization of the CeNF-YA3 gene, yeast hybridization, and plant overexpression vectors, its transcriptional activation function was demonstrated, solving the problem of insufficient oil regulation in tiger nuts and achieving a significant increase in oil content and accumulation.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-11
- Publication Date
- 2026-04-03
AI Technical Summary
The lack of cloning of the NF-Y transcription factor gene in tiger nuts and its functional identification in lipid regulation in the current technology leads to insufficient regulation of lipid accumulation.
The CeNF-YA3 gene in tiger nuts was isolated and identified. Subcellular localization, yeast hybridization, and plant overexpression vectors were constructed to demonstrate its transcriptional activation function in plant oil regulation and to increase oil content through gene overexpression.
It significantly increased the oil content of Arabidopsis seeds and leaves. Overexpression of the CeNF-YA3 gene can enhance oil content and accumulation, and has the potential for application in plant oil regulation.
Smart Images

Figure CN121294463B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology technology, specifically involving CeNF-YA3 Genes, expression vectors and their applications in the regulation of plant oils. Background Technology
[0002] Tiger nuts (scientific name: Cyperus esculentus Tigernut (also known as yellow nutsedge) belongs to the Cyperaceae family of the Poales order. It is a newly emerging herbaceous oilseed crop originating from Africa and the Mediterranean coast. It is characterized by its wide adaptability, great development potential, and high oil yield per acre. It is convenient to increase the supply of edible oil on desertified marginal land without crowding out grain and soybean production areas, thus alleviating the rigid demand for imported soybeans. At the same time, compared with traditional oilseed crops that accumulate oil in seeds, tigernut is the only crop known to date to accumulate oil at a high level (24%–35%) in tubers. This makes it an ideal model for studying the regulation of oil in vegetative tissues. Therefore, the discovery of key genes involved in tuber oil accumulation has important theoretical significance and application value.
[0003] The synthesis and accumulation of lipids are controlled by a multi-gene regulatory network, in which transcription factors play a key role. Currently known families of transcription factors involved in lipid regulation include AP2 / EREBP, B3, NF-Y, MYB, WRKY, DOF, and bZIP. WRI1 ( WRINKLED1 It belongs to the AP2 / ERF transcription factor family and is a key gene that has been shown to regulate lipid accumulation during the development of oilseeds. WRI1 The gene was first identified in the model plant Arabidopsis thaliana, and its mutant ( atwri1-1 The seeds of this mutant exhibit wrinkled seed coats and an 80% reduction in oil content. This is because the mutant is unable to effectively convert carbohydrates into precursors required for fatty acid synthesis. (Except for...) AtWRI1 In addition, Arabidopsis thaliana contains three homologous genes, namely AtWRI2-4 They are collectively referred to as WRI Gene-like structures. Based on previous research, we cloned three genes from tiger nuts. WRI Gene-like, i.e. CeWRI1-3 , respectively corresponding to AtWRI1 , AtWRI2 , AtWRI3 / 4 .in, CeWRI1 Two alleles have been identified and named... CeWRI1 and CeWRI1b Both have the function of regulating oil content; CeWRI2 and CeWRI3 They can also complement each other. atwri1-1 The mutant significantly increased the oil content of tobacco leaves.
[0004] NF-Y is a class of transcription factors ubiquitous in eukaryotes, comprising three subunits: NF-YA, NF-YB, and NF-YC. The NF-Y heterotrimeric complex specifically binds to the cis-acting element CCAAT, which is present in 25% of eukaryotic gene promoter regions. In mammals and yeast, each of the three NF-Y subunits is encoded by a single gene; however, in plants, the encoding genes have significantly expanded, forming three large gene families. The complex NF-Y complex then finely regulates plant growth and development. However, the cloning of tiger nut homologous genes and their functional identification in lipid regulation remain undiscovered. Summary of the Invention
[0005] The purpose of this invention is to provide CeNF-YA3 Genes, expression vectors and their applications in the regulation of plant oils.
[0006] This invention provides a method for separating from tiger nuts. CeNF-YA3 The application of genes in the regulation of plant oils, the CeNF-YA3 The nucleotide sequence of the gene is shown in SEQ ID NO.1; the plant includes Arabidopsis thaliana and / or tobacco.
[0007] Preferably, the regulation of plant oils includes:
[0008] By promoting the above-described technical solutions CeNF-YA3 After gene expression, the oil content in plant seeds or plant vegetative tissues is increased, or the accumulation of oil in plant seeds or plant vegetative tissues is enhanced.
[0009] Preferably, the plant vegetative tissues include one or more of leaves, tubers, and rhizomes.
[0010] The present invention provides the technical solution described above. CeNF-YA3 The CeNF-YA3 protein encoded by the gene, the amino acid sequence of which is shown in SEQ ID NO.11.
[0011] This invention provides a method for amplifying the aforementioned CeNF-YA3 Primer pairs for the gene, said primer pairs including CeNF-YA3F1 and CeNF-YA3R1;
[0012] The nucleotide sequence of CeNF-YA3F1 is shown in SEQ ID NO.2;
[0013] The nucleotide sequence of CeNF-YA3R1 is shown in SEQ ID NO.3.
[0014] This invention provides an expression vector, the expression vector comprising the aforementioned... CeNF-YA3 Gene.
[0015] Preferably, the expression vector includes one or more of the following: subcellular localization vector, yeast hybridization vector, and plant overexpression vector;
[0016] The subcellular localization vector is: pNC-Cam1304-CeNF-YA3;
[0017] The yeast hybridization vector is one or more of the following: pNC-GBKT7-CeNF-YA3F, pNC-GBKT7-CeNF-YA3N1, pNC-GBKT7-CeNF-YA3N2 and pNC-GBKT7-CeNF-YA3C;
[0018] The plant overexpression vector is pCAMBIA1301-CeNF-YA3.
[0019] This invention provides a method for increasing the oil content of plants or promoting the accumulation of plant oils, comprising the following steps:
[0020] The above technical solution is described CeNF-YA3 Genes are introduced into target plants to increase the oil content or promote oil accumulation in the target plants.
[0021] The target plants include: tobacco and / or Arabidopsis thaliana.
[0022] Beneficial effects:
[0023] This invention provides a method for separating from tiger nuts. CeNF-YA3 Genes, the ones mentioned CeNF-YA3 The nucleotide sequence of the gene is shown in SEQ ID NO.1, with a coding region of 864 bp. Transformation into Arabidopsis thaliana using the inflorescence immersion method confirmed... CeNF- YA3 Overexpression of the gene can significantly increase the oil content of Arabidopsis seeds and leaves; therefore, it can be used to increase the oil content of plant seeds and vegetative tissues.
[0024] This invention provides a product containing CeNF-YA3 Gene expression vectors. Through initial cloning... CeNF-YA3 The gene was developed and a series of vectors for its subcellular localization, yeast hybridization, and plant overexpression were constructed. For the first time, it was demonstrated that the CeNF-YA3 protein has transcriptional activation function and is located in the cell nucleus, which is consistent with the basic characteristics of transcription factors, providing scientific support for its application. Attached Figure Description
[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.
[0026] Figure 1 Provided by the present invention CeNF-YA3 PCR amplification results of the gene: M: DNA marker III; CK: blank control; 1: CeNF-YA3 ;
[0027] Figure 2 Provided by the present invention CeNF-YA3 BLASTN alignment of genes in the NCBI GenBank database;
[0028] Figure 3 Provided by the present invention CeNF-YA3 Schematic diagram of sequence characteristics and evolutionary analysis of encoded proteins: A: Conserved domain analysis of CeNF-YA3 protein; B: Multiple sequence alignment of CeNF-YA3 with EgNF-YA3 and AtNF-YA3; C: Evolutionary analysis of CeNF-YA3, EgNF-YA3 and NF-YA protein in Arabidopsis thaliana;
[0029] Figure 4 This is a diagram showing the subcellular localization of the CeNF-YA3 protein in tobacco leaf cells, as provided by this invention.
[0030] Figure 5 Figure showing the identification results of the transcriptional activation function of CeNF-YA3 protein in yeast provided by the present invention: pNC-GBKT7: empty vector; F: full-length coding region; N1: N-terminal sequence 1; N2: N-terminal sequence 2, which contains the CBFB-NFYA domain; C: C-terminal sequence, which is the downstream sequence of the CBFB-NFYA domain.
[0031] Figure 6 Provided by the present invention CeNF-YA3 The regulatory effect of transient overexpression of the gene on lipid accumulation in tobacco leaves: The horizontal axis represents different days after transformation, and the vertical axis represents the fold increase in triglycerides (TAG) in the treatment relative to the empty vector control. The results show the average of three biological replicates. Capital letters indicate the basis of the study. P The difference was significant (<0.01).
[0032] Figure 7 Provided by the present invention CeNF-YA3 The regulatory effect of gene overexpression on lipid accumulation in seeds (A) and leaves (B) in Arabidopsis thaliana is shown in the figure: the result is the average of three biological replicates, and "**" indicates the result based on... P The difference was statistically significant (<0.01). Detailed Implementation
[0033] The construction method of the expression vector described in this invention has no special requirements and can be constructed using methods known in the art. In a specific embodiment of this invention, the construction method of the subcellular localization vector pNC-Cam1304-CeNF-YA3 includes: using cDNA derived from tiger nut tubers as a template, and performing PCR amplification using CeNF-YA3F2 (SEQ ID NO.4) and CeNF-YA3R2 (SEQ ID NO.5) as primers to obtain... CeNF-YA3 Genes; the aforementioned CeNF-YA3 The gene was cloned into pNC-Cam1304-SubN to obtain the recombinant vector pNC-Cam1304-CeNF-YA3.
[0034] In a specific embodiment of the present invention, the method for constructing the yeast hybridization vector pNC-GBKT7-CeNF-YA3F includes: CeNF-YA3 The full-length coding region (SEQ ID NO.1) was cloned into the yeast two-hybrid bait vector pNC-GBKT7 to construct the recombinant vector pNC-GBKT7-CeNF-YA3F; the primers used to construct pNC-GBKT7-CeNF-YA3F include CeNF-YA3F2 (SEQ ID NO.4) and CeNF-YA3R2 (SEQ ID NO.5).
[0035] In a specific embodiment of the present invention, the method for constructing the yeast hybridization vector pNC-GBKT7-CeNF-YA3N1 includes: CeNF-YA3 The N1 end of the segmented sequence (i.e., 1-399 bp as shown in SEQ ID NO.1) was cloned into the yeast two-hybrid bait vector pNC-GBKT7 to construct the recombinant vector pNC-GBKT7-CeNF-YA3N1; the primers used to construct pNC-GBKT7-CeNF-YA3N1 include CeNF-YA3F2 (SEQ ID NO.4) and CeNF-YA3R3 (SEQ ID NO.6).
[0036] In a specific embodiment of the present invention, the method for constructing the yeast hybridization vector pNC-GBKT7-CeNF-YA3N2 includes: CeNF-YA3 The N2 end of the segmented sequence (i.e., 1-576 bp as shown in SEQ ID NO.1) was cloned into the yeast two-hybrid bait vector pNC-GBKT7 to construct the recombinant vector pNC-GBKT7-CeNF-YA3N2; the primers used to construct pNC-GBKT7-CeNF-YA3N2 include CeNF-YA3F2 (SEQ ID NO.4) and CeNF-YA3R4 (SEQ ID NO.8).
[0037] In a specific embodiment of the present invention, the method for constructing the yeast hybridization vector pNC-GBKT7-CeNF-YA3C includes: CeNF-YA3 The N1 end of the segmented sequence (i.e., 577-861 bp as shown in SEQ ID NO.1) was cloned into the yeast two-hybrid bait vector pNC-GBKT7 to construct the recombinant vector pNC-GBKT7-CeNF-YA3C; the primers used to construct pNC-GBKT7-CeNF-YA3C include CeNF-YA3F3 (SEQ ID NO.7) and CeNF-YA3R2 (SEQ ID NO.5).
[0038] In a specific embodiment of the present invention, the method for constructing the plant overexpression vector pCAMBIA1301-CeNF-YA3 includes: ... CeNF-YA3 The full-length coding region (SEQ ID NO.1) was cloned into the plant overexpression vector pCAMBIA1301 to construct the recombinant vector pCAMBIA1301-CeNF-YA3; the primers used to construct pCAMBIA1301-CeNF-YA3 include CeNF-YA3F4 (SEQ ID NO.9) and CeNF-YA3R5 (SEQ ID NO.10).
[0039] To further illustrate the present invention, the solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.
[0040] In this invention, it is used for CeNF-YA3 The primers used for gene cloning and vector construction are shown in Table 1.
[0041] Table 1 CeNF-YA3 Primers used for gene cloning and vector construction
[0042]
[0043] The present invention CeNF-YA3The nucleotide sequence of the gene is shown in SEQ ID NO.1, specifically: 5′-ATGGATCACAACTCGGTTCGCATGATACCGAATCTGATAAACAAGCTAGTTCACAAAACTCCCGATAAGGATTCCTGTTCGACACATTCAAGCCCCCGTTCTGTGCAGGAAGTTTCTGAAACCAGTGAAGGAAGCCTTAATGAGACTCATTCTGGTGATGGTGGCAATTATGGGAATTACGTGGGCCGATCAGGACTATCCATAGAAAATCGAGATGGGATTTTCGTGCCACAGAAGTTTGATTTTGCACCTGCTTTTTCCGGCATGAATCCTCCATATAATGATGGAACTTTTGCTAGTTTCTTGGCTTCATGCGGATCGAATTCCTTGAATCATCCGCAGATGGTGACTGTGGGGTTGCCGCCTCGCCTCCCACTTGTGCTTGATCCAATGGAGGAGCCTGTGTTCGTGAACCCAAAGCAGTACAACGCAATCCTTCGAAGAAGGCAGGCTCGTGCCAAGCTGGAGGCTCAGAACAAGCTTATCAAAGCTCGCAAGCCATACCTCCATGAATCACGCCATCGTCATGCAATGAAGCGGGCAAGGGGATCAGGTGGTCGGTTCCTGAACACAAAGCAGCAAAATAACCAGTCTTCCGCAAAAGAAAGCAGCGACAATGCAAAGACTAACCATTTCTATGAGATTAATTCATCTGGTACCCCAACTGGCTCTGACATTACTACCGTCTCGACCCATGCAGGCAAGCCAAATCAGCAAGAAAATATGGGTTTCTCACAAATAGAAATTGCGACTAATTGGGGAAATGGGGCGCACTACCGGTCCCATGGCATGGCTCATGACAGTGGGGTTATGGGAATAGGGCATGGTAACATGCTCTTTGGCAATTCATCCTTGGCTTTATGA-3′.
[0044] The amino acid sequence of the CeNF-YA3 protein described in this invention is shown in SEQ ID NO.11, specifically: MDHNSVRMIPNLINKLVHKTPDKDSCSTHSSPRSVQEVSETSEGSLNETHSGDGGNYGNYVGRSGLSIENRDGIFVPQKFDFAPAFSGMNPPYNDGTFASFLASCGSNSLNHPQMVTVGLPPRLPLVLDPMEEPVFVNPKQYNAILRRRQARAKLEAQNKLIKARKPYLHESRHRHAMKRARGSGGRFLNTKQQNNQSSAKESSDNAKTNHFYEINSSGTPTGSDITTVSTHAGKPNQQENMGFSQIEIATNWGNGAHYRSHGMAHDSGVMGIGHGNMLFGNSSLAL*.
[0045] Example 1 CeNF-YA3 Gene cloning and sequence analysis
[0046] (1) Total RNA was extracted from tubers of Tiger Pea No. 3 at 10 different developmental stages. The mRNA was reverse transcribed into cDNA and used as a template for PCR amplification. Based on the full-length cDNA obtained from the transcriptome, primers CeNF-YA3F1 (SEQ ID NO. 2) and CeNF-YA3R1 (SEQ ID NO. 3) were designed, and PCR amplification was performed according to the PCR amplification reaction system shown in Table 2. The PCR reaction program was: 98℃ for 3 min; 98℃ for 30 sec, 60℃ for 30 sec, 72℃ for 50 sec (35 cycles); 72℃ for 5 min; and stored at 4℃.
[0047] Table 2 PCR amplification reaction system
[0048]
[0049] Electrophoretic analysis of the PCR amplification products yielded the following results: Figure 1 As shown. Combined with Figure 1 It can be seen that after PCR amplification, a specific band of about 900 bp was obtained.
[0050] (2) After the target product was gelled and recovered, it was cloned into the pMD19-T cloning vector (catalog number 6013) of Takara Company, and the sequence was determined after blue-white screening and colony PCR verification.
[0051] Sequence analysis showed that CeNF-YA3The coding region (CDS) is 864 bp in length (its nucleotide sequence is shown in SEQ ID NO.1), with a GC content of 48%, and is predicted to encode 287 amino acids. Its theoretical molecular weight is 31.37 kDa, its isoelectric point (pI) is 9.32, its total average hydrophobicity index (GRAVY) is -0.739, its instability coefficient (II) is 47.82, and its aliphatic index (AI) is 58.82.
[0052] (3) BLASTN was used to compare the sequence against the NCBI GenBank database. No similar sequences were found. The results are shown in [see attached table]. Figure 2 Combining Figure 2 The results show that the cloned gene is a new gene.
[0053] (4) CeNF-YA3 CDD (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi?) analysis and sequence alignment were performed, and the results are shown below. Figure 3 A, Figure 3 B. (Combined) Figure 3 A, Figure 3 As can be seen from B, CeNF-YA3 contains a conservative CBFB_NFYA structure field.
[0054] (5) To further reveal the evolutionary characteristics of CeNF-YA3, a phylogenetic tree was constructed using MEGA6 (https: / / www.megasoftware.net / ) along with EgNF-YA3 and NF-YA proteins in Arabidopsis thaliana. The results are as follows: Figure 3 As shown in Figure C. (By...) Figure 3 As can be seen from C, CeNF-YA3 clusters with EgNF-YA3, AtNF-YA3, and AtNF-YA8, with sequence similarities of 44.53%, 43.73%, and 43.16%, respectively.
[0055] Example 2 Subcellular localization analysis of CeNF-YA3 protein
[0056] (1) WoLF PSORT (https: / / www.genscript.com / wolf-psort.html) analysis showed that CeNF-YA3 may be located in the cell nucleus.
[0057] (2) To confirm the above prediction results, primers CeNF-YA3F2 (SEQ ID NO.4) and CeNF-YA3R2 (SEQ ID NO.5) were designed near the start and stop codons of the sequencing gene.
[0058] (3) The PCR product in Example 1 was diluted 100 times as a template and CeNF-YA3F2 and CeNF-YA3R2 were used as primers for PCR amplification (the PCR amplification system and amplification program were the same as those in Example 1). After the PCR amplification was completed, the target fragment was cut and recovered from the gel and cloned into pNC-Cam1304-SubN using the NC kit (Hainan Nixing Biotechnology Co., Ltd.) to construct the fusion expression vector pNC-Cam1304-CeNF-YA3 with EGFP. The NC ligation system is shown in Table 3.
[0059] Table 3 NC Connection System
[0060]
[0061] (4) Transform the recombinant plasmid pNC-Cam1304-CeNF-YA3 into Agrobacterium tumefaciens strain GV3101 (containing pSoup-P19), the specific procedure is as follows:
[0062] (4-1) Add 1 μg of nuclear localization positive plasmids pNC-Cam1304-H2A and pNC-Cam1304-CeNF-YA3 to 100 μL of competent cells GV3101 and mix well by pipetting.
[0063] (4-2) Ice bath for 5 min, freeze in liquid nitrogen for 5 min, then water bath at 37℃ for 5 min, and stand on ice for 5 min;
[0064] (4-3) Add 700 μL of antibiotic-free LB medium and incubate at 28℃ and 200 rpm for 2 h with shaking.
[0065] (4-4) Spread the bacterial cells on solid LB medium supplemented with 50 mg / L kanamycin and 100 mg / L rifampin, and incubate at 28°C for 2-3 days;
[0066] (4-5) Select single clones for colony PCR detection, and select positive clones for genetic transformation experiments.
[0067] (5) The micro-injection method was used to transform 4-week-old tobacco leaves. The specific process is as follows:
[0068] (5-1) Inoculate the above-mentioned positive bacteria into 2 mL of LB liquid medium (50 mg / L rifampin) and incubate overnight at 28°C and 210 rpm;
[0069] (5-2) Take 1 mL of bacterial culture and add it to 30 mL of LB liquid medium. Incubate at 28°C and 210 rpm until the bacterial concentration reaches OD. 600 It is 0.8;
[0070] (5-3) Collect bacterial cells by centrifugation at 5000 rpm for 3 min, remove the supernatant, and add resuspension buffer (10 mmol / L MgCl2, 0.2 mmol / L acetylsalicylic acid (AS) and 10 mmol / L MES, with pH adjusted to 5.6 using KOH) to resuspend the bacterial cells. Repeat twice, adjusting the concentration of the resuspension to OD. 600 It is 0.6;
[0071] (5-4) After resuspending the bacterial solution, incubate it at 28°C for 3-5 h. Then, inject the bacterial solution into the lower epidermis of the tobacco plant using a 1 mL syringe with the needle removed (one gene is injected into multiple leaves of one tobacco plant). You can use the needle to slightly puncture the lower epidermis of the leaf before injection.
[0072] (5-5) After injection, the tobacco leaves were cultured in the dark for 2-4 days. The injected tobacco leaves were then used to prepare slides for fluorescence signal detection. The results are shown in [Figure number missing]. Figure 4 ;
[0073] (6) According to Figure 4 Laser confocal microscopy revealed that the fluorescence signals of the experimental group (green fluorescence) and the positive control (red fluorescence) were found in the cell nucleus and highly overlapped, indicating that CeNF-YA3 plays a role in the cell nucleus.
[0074] Example 3 Identification of the transcriptional activation function of CeNF-YA3 protein
[0075] (1) To identify the transcriptional activation function of CeNF-YA3 and the location of the activation domain, primers as shown in Table 1 were designed near the CBFB_NFYA domain;
[0076] (2) Using the PCR product diluted 100-fold in Example 1 as a template, CeNF-YA3F2 / CeNF-YA3R2, CeNF-YA3F2 / CeNF-YA3R3, CeNF-YA3F2 / CeNF-YA3R4, or CeNF-YA3F3 / CeNF-YA3R2 were used as primers to amplify the full-length coding region of CeNF-YA3, the N1 (1..399) end, the N2 (1..576, containing the CBFB_NFYA domain) end, and the C (577..861) end, respectively. (downstream of the CBFB_NFYA domain), after PCR amplification, the gel was excised and recovered, and then cloned into pNC-GBKT7 using the NC kit from Hainan Nixing Biotechnology Co., Ltd., to construct yeast two-hybrid bait vectors pNC-GBKT7-CeNF-YA3F, pNC-GBKT7-CeNF-YA3N1, pNC-GBKT7-CeNF-YA3N2 and pNC-GBKT7-CeNF-YA3C. The PCR amplification method and NC ligation system were the same as those in Example 2.
[0077] (3) The empty vector and four recombinant plasmids were transferred into Y2H-Gold yeast cells. The transformed yeast cells were then selected on tryptophan-deficient medium. Positive bacteria were selected and screened on tryptophan and histidine-deficient medium. Subsequently, the positive bacteria were subjected to X-α-gal colorimetric reaction. The results are as follows: Figure 5 As shown.
[0078] Combination Figure 5 The results showed that engineered bacteria transformed with pNC-GBKT7-CeNF-YA3F, pNC-GBKT7-CeNF-YA3N1, and pNC-GBKT7-CeNF-YA3N2 could survive on selective media and showed a blue color, while yeast cells transformed with empty vector and pNC-GBKT7-CeNF-YA3C failed to show β-galactosidase activity. This indicates that CeNF-YA3 has transcriptional activation function, and the activation domain is located upstream of the CBFB_NFYA domain.
[0079] Example 4 CeNF-YA3 Identification of lipid regulation function
[0080] For identification CeNF-YA3 To investigate its function in regulating plant oil content, Agrobacterium-mediated transformation of 4-week-old tobacco leaves was performed using a microinjection method. Samples were collected at 1, 3, and 5 days after transformation for oil content determination. Results are shown in [Figure number missing]. Figure 6 ;
[0081] Combination Figure 6The results of oil analysis showed that, compared with the control group which was converted to an empty vector, the TAG content in the experimental group increased by 1.50, 1.56 and 1.91 times after 1 day, 3 days and 5 days of conversion, respectively.
[0082] Example 5 CeNF-YA3 Application in the regulation of lipids in seeds and vegetative tissues
[0083] (1) For evaluation CeNF-YA3 The potential for application in lipid regulation was explored. The PCR product from Example 1 was diluted 100 times as a template and CeNF-YA3F4 (SEQ ID NO. 9) and CeNF-YA3R5 (SEQ ID NO. 10) were used as primers for PCR amplification. The target fragment was then recovered by gel extraction and cloned into the plant overexpression vector pCAMBIA1301 using homologous recombination.
[0084] (2) The empty vector pCAMBIA1301 and the plant overexpression vector pCAMBIA1301-CeNF-YA3 constructed above were transformed into GV3101 (containing pSoup-P19), and wild-type Arabidopsis thaliana was transformed by inflorescence staining method. The specific procedure is as follows:
[0085] (2-1) Positive bacteria were cultured overnight in LB liquid containing 50 mg / L kanamycin and 100 mg / L rifampin until OD reached. 600 The bacterial cells were collected by centrifugation at 12,000 rpm for 5 min to a value of 0.6.
[0086] (2-2) Resuspend in staining buffer (1 / 2 MS solution containing 5% sucrose and 0.02% Silwet-77) and adjust to OD. 600 It is 0.8;
[0087] (2-3) Place the Arabidopsis thaliana upside down in the infusion solution and soak for half a minute. Try to avoid getting the leaves in the infusion solution. You can use a pipette to draw the solution and then drip it onto the inflorescence.
[0088] (2-4) After the inoculation is completed, spray a small amount of water and cover the inflorescence with a black plastic bag for dark culture. After 1 day, remove the plastic bag and culture normally.
[0089] (2-5) To improve the efficiency of the infiltration, the infiltration can be repeated one or two times (once a week), and the seeds can be harvested under the same conditions.
[0090] (2-6) T1 seeds were screened for resistance on MS solid plate medium with 25 µg / mL hygromycin to obtain T2 generation positive transgenic plants. After they matured, they were screened for resistance again to obtain stable T3 generation positive transgenic plants.
[0091] (3) To analyze the effect of gene overexpression on seed oil regulation, oil content was measured in T3 generation transgenic Arabidopsis seeds. The results are shown in […]. Figure 7 A.
[0092] Combination Figure 7 The results showed that the oil content of the transgenic seeds was 31.21%, which was significantly higher than the 27.50% of the untransgenic seeds.
[0093] (4) For evaluation CeNF-YA3 The application value of this study in regulating oil content in plant vegetative tissues was investigated by collecting leaves of the aforementioned T3 generation transgenic Arabidopsis thaliana for oil content determination. The results are shown below. Figure 7 B.
[0094] Combination Figure 7 As can be seen from B, compared with the control group that was switched to no-load, CeNF-YA3 Overexpression increased the oil content of the leaves by 3.39 times.
[0095] In conclusion, CeNF-YA3 It has the function of promoting oil accumulation and shows its application prospect in increasing the oil content of seeds and nutrient tissues.
[0096] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A type of extract isolated from tiger nuts CeNF-YA3 Genes or containing CeNF-YA3 The application of gene overexpression vectors in the regulation of plant oils is characterized by, The CeNF-YA3 The nucleotide sequence of the gene is shown in SEQ ID NO. 1; The plants mentioned are: Arabidopsis thaliana and / or tobacco; The regulation of plant oils is achieved by overexpressing [a specific substance] in plants. CeNF-YA3 After gene therapy, the oil content in plant seeds or plant vegetative tissues is increased, or the accumulation of oil in plant seeds or plant vegetative tissues is enhanced. The plant's vegetative tissue is the leaf.
2. The application according to claim 1, characterized in that, The CeNF-YA3 The gene encodes the CeNF-YA3 protein; The amino acid sequence of the CeNF-YA3 protein is shown in SEQ ID NO.
11.
3. The application according to claim 1, characterized in that, contain CeNF-YA3 The gene overexpression vector is: pCAMBIA1301-CeNF-YA3.
4. A method for increasing the oil content of plants or promoting the accumulation of plant oils, characterized in that, Includes the following steps: The as described in claim 1 CeNF-YA3 Genes are introduced into target plants to increase the oil content or promote oil accumulation in the target plants. The target plants are: tobacco and / or Arabidopsis thaliana.