SV molecular markers for identifying *Termitomyces albuminosus* strain Nongchanggen 2 and their applications

By using SV molecular markers and their specific primer pairs developed through high-throughput sequencing technology, combined with PCR and electrophoresis methods, rapid and accurate identification of the Zhongnong Changgen No. 2 strain was achieved, solving the problems of mixed strains and intellectual property disputes, and improving the efficiency of strain protection.

CN121294730BActive Publication Date: 2026-04-03INST OF URBAN AGRI CHINESE ACADEMY OF AGRI SCI +1
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-15
Publication Date
2026-04-03

Smart Images

  • Figure CN121294730B_ABST
    Figure CN121294730B_ABST
Patent Text Reader

Abstract

This invention discloses the SV molecular marker for identifying the black-skinned chicken-of-the-woods strain Zhongnong Changgen 2 and its application, belonging to the field of edible fungi strain identification technology. It aims to solve the problem of strain contamination caused by the lack of rapid and accurate identification methods in the production and promotion of superior black-skinned chicken-of-the-woods strains. This invention also discloses a method for identifying the black-skinned chicken-of-the-woods strain Zhongnong Changgen 2, using the primer pair shown in SEQ ID NO:2 and 3 as primers and the genomic DNA of the black-skinned chicken-of-the-woods sample as a template for PCR amplification; if two specific bands appear in the amplification product, the sample is determined to be strain Zhongnong Changgen 2. This invention also discloses the application of SV molecular markers, specific primer pairs, or kits in the identification of the black-skinned chicken-of-the-woods strain Zhongnong Changgen 2. This invention is used for rapid molecular identification of strain Zhongnong Changgen 2, strain purity detection, early screening of breeding materials, and market product traceability, providing a reliable technical means for strain protection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of edible fungi strain identification technology, and relates to an SV molecular marker for identifying the black-skinned chicken mushroom strain Zhongnongchanggen No. 2 and its application. Background Technology

[0002] Black-skinned chicken mushroom, scientifically known as *Oudemansiella raphanipes*, is a rare edible fungus with high economic value in the market. Its fruiting body has a tender texture and unique flavor, rich in protein, amino acids, vitamins, and other nutrients. Studies have also confirmed its effects in lowering blood pressure and inhibiting tumors, thus giving it both edible and medicinal value. Currently, this strain has been preliminarily cultivated in facility-based factories in Shandong Province and other regions (strain code Or034). In contrast, although Sichuan Province ranks among the top in the country in terms of black-skinned chicken mushroom production, its factory cultivation is still in its early stages, especially lacking superior varieties suitable for factory production.

[0003] To address the shortage of varieties, researchers successfully bred the superior strain "Zhongnong Changgen No. 2" (Or001) using multispore hybridization breeding techniques with *Termitomyces albuminosus* Or005 and Or010 as parents. This strain demonstrated a significant yield advantage in comparative trials in Guihua Town, Pengzhou City, Chengdu, showing broad prospects for industrial application. However, the promotion and commercialization of this superior strain urgently requires supporting variety identification and protection technologies. Without rapid and accurate identification methods, disputes such as strain mixing and counterfeiting are highly likely to occur in the production and distribution stages, hindering the healthy development of the industry.

[0004] With the rapid development of high-throughput sequencing technology, especially long-read sequencing technology, researchers are now able to systematically analyze large-scale sequence variations in the genome. Structural variations (SVs) refer to DNA sequence changes longer than 50 bp in the genome, mainly including insertions, deletions, inversions, translocations, and copy number variations. Based on whole-genome resequencing or de novo assembly data, by comparing the genomes of different individuals, specific genomic regions with structural differences can be accurately identified, and molecular markers that can specifically detect these variations, i.e., SV markers, can be developed.

[0005] Compared to traditional molecular markers (such as SNPs and SSRs), SV markers are typically co-dominant, revealing richer genome-wide polymorphisms. This technology does not rely on the operator's subjective experience and can objectively and accurately analyze large-scale structural variations across the entire genome in a single experiment, providing a more direct and efficient technical approach for species identification, variety rights protection, and the localization of genes for important traits. Summary of the Invention

[0006] One object of the present invention is to solve at least the above-mentioned problems and / or defects, and to provide at least the advantages described below.

[0007] Another objective of this invention is to improve the SV molecular marker for identifying the black-skinned chicken mushroom strain Zhongnongchanggen 2 (or001 strain, which has obtained the Sichuan Province Non-Major Crop Variety Identification Certificate, Identification No.: Chuanrenjun 2025021). This invention addresses common issues of strain mixing and intellectual property disputes during the promotion of edible fungi strains, and serves as a complementary protection for the or001 strain. In practical applications, the SV molecular marker provided by this invention only requires PCR and agarose gel electrophoresis, resulting in low cost, high throughput, and high specificity, making it suitable for breeding and production practices.

[0008] Therefore, the present invention provides the following technical solution:

[0009] The SV molecular marker for identifying the black-skinned Termitomyces strain Zhongnongchanggen 2 is shown in SEQ ID NO:1. The molecular marker type is insertion (underlined part), and Zhongnongchanggen 2 exhibits heterozygous insertion.

[0010] SEQ ID NO:1:

[0011] TAAGAAAATATGAAATGTACACTGGAGCCTTAAGCGAGAGAGACCTGAAAGAAGGCAAGTCAGAATATTA GTATTTCGACCATAGGTTCACGGGTTGTGACCTGTGACCTCATGAACATGTTGAGTGG CATGACTAATGACTATCCAATTTAGCACTCACAGATGGCAGAAATCACATTCTCCATGCCTCTAAAGCTCGTCAGTGGGCGGAATGAGTCTACTGTCTAGGTTCAAGGGCAAACATGCGAGAAGAAACTGTGGATGATGATGATAGAAGACGAACCATCAATGTC ACATTTCCGATTGTAACCGGTGAAATGTGCCTGACTAATCGCACCGCAATTTAGCCAAGAGATTTTTGTGCGCCATCACCGTATCTTACACCAATCATACCAAAATCATATAGAAATACATGCCCACAAGCCATTCAGTCCGTTTTCCATACAGGAAAGTACTTCA

[0012] A specific primer pair for identifying the black-skinned chicken mushroom strain Nongchanggen 2, the nucleotide sequences of which are shown in SEQ ID NO:2 and SEQ ID NO:3, respectively.

[0013] F: 5'-TAAGCGAGAGAGACCTGAAA-3' (SEQ ID NO: 2)

[0014] R: 5'-ATGGAAAACGGACTGAATGG-3' (SEQ ID NO: 3)

[0015] A kit for identifying the black-skinned chicken mushroom strain Nongchanggen 2, comprising the aforementioned specific primer pair.

[0016] A method for identifying the *Termitomyces albuminosus* strain Nongchanggen No. 2 includes the following steps:

[0017] a) Extract genomic DNA from the black-skinned chicken mushroom sample to be tested;

[0018] b) Using the primer pair shown in SEQ ID NO:2 and SEQ ID NO:3 as primers, and the genomic DNA extracted in step a) as a template, perform PCR amplification reaction;

[0019] c) Perform electrophoretic detection on the PCR amplification products obtained in step b);

[0020] d) Identification based on electrophoresis results: If two specific bands appear in the amplification product, with the larger band being 413 bp and the smaller band being 355 bp, then the sample to be tested is determined to be the Zhongnong Changgen No. 2 strain.

[0021] Preferably, in the method described, the PCR amplification reaction procedure in step b) is as follows: preheating at 95°C for 3-5 minutes; performing 30-35 cycles, each cycle including 95°C for 10-30 seconds, 55°C for 10-30 seconds, 72°C for 20-40 seconds; and finally extending at 72°C for 3-8 minutes.

[0022] Preferably, in the method, the PCR amplification reaction program is as follows: preheating at 95°C for 3 minutes; 30 cycles: 95°C for 15 seconds, 55°C for 15 seconds, 72°C for 30 seconds; and a final extension at 72°C for 5 minutes.

[0023] Preferably, in the method described, the electrophoresis detection in step c) is performed using an agarose gel with a concentration of 2% to 3% and electrophoresis at a voltage of 80-120V for 30-50 minutes.

[0024] Preferably, the method further includes the following steps:

[0025] At least one primer from the primer pairs shown in SEQ ID NO:2 and SEQ ID NO:3 was fluorescently labeled. Using the fluorescently labeled primer pairs, PCR amplification was performed using the genomic DNA of the black-skinned chicken mushroom sample as a template.

[0026] The obtained PCR amplification products were analyzed by capillary electrophoresis to obtain the specific peak values ​​and signal intensity values ​​of the two alleles of the SV molecular marker corresponding to SEQ ID NO:1.

[0027] The relative content of Zhongnong Changgen No. 2 strain in the test sample was evaluated based on the signal intensity ratio of two specific peaks. When the signal intensity ratio of the two peaks was 1:1, it indicated that the test sample was a pure culture of Zhongnong Changgen No. 2. When the ratio deviated significantly from 1:1, it indicated that the test sample was a mixed sample and that Zhongnong Changgen No. 2 strain was a non-dominant component.

[0028] Preferably, the signal intensity ratio is converted into the estimated mass percentage or genomic DNA percentage of the Zhongnong Changgen 2 strain in the mixed sample using a standard curve.

[0029] The application of the SV molecular marker, the specific primer pair, or the kit in the identification of Nongchanggen 2 strain of black-skinned chicken mushroom.

[0030] The present invention has at least the following beneficial effects:

[0031] The test black-skinned chicken mushrooms were identified using the special primers provided by this invention. The results showed that only the PCR amplification product of strain Or001 showed a specific band, while the PCR amplification products of other black-skinned chicken mushrooms did not show a specific band. This indicates that the primers designed by this invention can amplify and distinguish the specific gene fragment of Or001.

[0032] Therefore, the dedicated primers provided by this invention can be applied to the rapid identification and detection of Or001. These dedicated primers not only provide more accurate identification results than conventional morphological methods, but also offer shorter detection times and higher accuracy compared to other detection methods. The detection time is only 3 hours, while the fruiting experiment requires 3-4 months.

[0033] Other advantages, objectives and features of the present invention will become apparent in part from the following description, and in part from those skilled in the art through study and practice of the invention. Attached Figure Description

[0034] Figure 1 This is an agarose gel electrophoresis result from one embodiment of the present invention.

[0035] Figure 2 This is a sequence diagram of the SV molecular marker obtained in Example 1 of the present invention. Detailed Implementation

[0036] The present invention will now be described in further detail so that those skilled in the art can implement it based on the description.

[0037] It should be understood that terms such as “having,” “comprising,” and “including” as used herein do not imply the presence or addition of one or more other elements or combinations thereof.

[0038] It should be noted that, unless otherwise specified, the experimental methods described in the following implementation plan are all conventional methods, and the reagents and materials described are all commercially available unless otherwise specified.

[0039] According to one embodiment of the present invention, the present invention uses the published genome data of black-skinned chicken mushroom as a reference, and uses high-throughput sequencing technology to obtain the whole genome data of the strain to be tested. Then, based on the reference genome, a set of specific primers were designed and synthesized to establish a method for specific identification of Or001, and the effectiveness of the established method was evaluated by an experiment.

[0040] To achieve the aforementioned objectives, this invention employs high-throughput sequencing technology to sequence the tested strains of *Termitomyces albuminosus*. By comparing the sequences of these strains with a reference genome, a specific molecular marker was identified. Primers were developed using this specific molecular marker to perform PCR amplification on total DNA extracted from different *Termitomyces albuminosus* species. The PCR products were then subjected to agarose gel electrophoresis to identify a specific band capable of specifically identifying Or001.

[0041] F: 5'-TAAGCGAGAGAGACCTGAAA-3'

[0042] R: 5'-ATGGAAAACGGACTGAATGG-3'

[0043] Finally, the present invention provides a method for identifying Or001. The method described in the present invention uses primers developed using the above-mentioned Or001-specific molecular marker to identify black-skinned chicken mushroom. The Or001 amplification product obtained by PCR should show a specific band after electrophoresis.

[0044] According to one embodiment of the present invention, an SV molecular marker for identifying the black-skinned chicken mushroom strain Zhongnong Changgen 2 is provided, the nucleotide sequence of which is shown in SEQ ID NO:1. This molecular marker is a specific structural variation region identified by comparing the whole genome data of the test strain obtained through high-throughput sequencing with a reference genome. Specifically, after extracting genomic DNA from the black-skinned chicken mushroom sample, PCR amplification and electrophoresis are performed using this SV molecular marker. If two specific bands appear, the strain is identified as Zhongnong Changgen 2. The same operation was performed on other black-skinned chicken mushroom strains such as Or005 or Or010. The results showed that only Zhongnong Changgen 2 produced two bands, while other strains did not have this characteristic, proving the specificity of the SV molecular marker. Traditional identification methods rely on morphological observation or simple molecular markers such as SSRs, which are easily affected by subjective factors and have low accuracy. In contrast, the SV molecular marker is based on large-scale sequence variations at the genome level and can objectively identify strain-specific differences. The present invention provides a rapid and accurate identification method, effectively solving the problems of mixed strains and intellectual property disputes, and improving the efficiency of strain protection.

[0045] According to one embodiment of the present invention, a specific primer pair for identifying the black-skinned chicken mushroom strain Zhongnong Changgen 2 is provided. The nucleotide sequences of the primer pair are shown in SEQ ID NO:2 and SEQ ID NO:3, respectively. PCR amplification is performed using this primer pair, with genomic DNA from the black-skinned chicken mushroom sample as a template. A standard PCR procedure is followed, such as preheating at 95°C for 3 minutes, 30 cycles including 95°C for 15 seconds, 55°C for 15 seconds, 72°C for 30 seconds, and a final extension at 72°C for 5 minutes. The presence of two specific bands in the amplified product upon electrophoresis confirms Zhongnong Changgen 2. This primer pair is directly developed for the SV molecular marker, ensuring high specificity amplification. The specific primer pair simplifies the identification process, reduces operational complexity, and improves detection throughput and reliability, making it suitable for rapid screening in production practice.

[0046] According to one embodiment of the present invention, a kit for identifying the *Termitomyces albuminosus* strain *Nongchanggen 2* comprises the aforementioned specific primer pair. The kit also includes PCR reaction buffer, DNA polymerase, and an electrophoresis detection component. Users only need to extract DNA from the sample to be tested and perform PCR and electrophoresis according to the instructions to complete the identification. Compared to conventional molecular identification kits, which lack specific primers, require additional optimization steps and produce unstable results, this kit is simple to operate and yields consistent results. This kit integrates specific primer pairs, enabling one-stop detection, improving the convenience and standardization of identification, supporting large-scale application and market supervision, and promoting strain quality control and standardized industrial development.

[0047] According to one embodiment of the present invention, a method for identifying the Nongchanggen No. 2 strain of black-skinned chicken mushroom includes the following steps:

[0048] a) Extract genomic DNA from the black-skinned chicken mushroom sample to be tested;

[0049] b) Using the primer pair shown in SEQ ID NO:2 and SEQ ID NO:3 as primers, and the genomic DNA extracted in step a) as a template, perform PCR amplification reaction;

[0050] c) Perform electrophoretic detection on the PCR amplification products obtained in step b);

[0051] d) Identification based on electrophoresis results: If two specific bands appear in the amplification product, the sample to be tested is determined to be Zhongnong Changgen No. 2 strain.

[0052] Optionally, in one specific embodiment, genomic DNA is first extracted from the mycelium or fruiting body of *Termitomyces albuminosus* using a modified CTAB method. Using this DNA as a template, PCR amplification is performed using specific primer pairs. The PCR reaction program is set to preheat at 95°C for 3 minutes, followed by 30 cycles, each cycle consisting of 95°C for 15 seconds, 55°C for 15 seconds, and 72°C for 30 seconds, with a final extension at 72°C for 5 minutes. After amplification, the product is electrophoresed on a 3% agarose gel at 100V for 40 minutes. After staining, the gel is observed under UV light; strain 2 (Zhongnong Changgen 2) clearly shows two distinct bands of different sizes.

[0053] Traditional morphological identification methods were used to distinguish samples of black-skinned termite mushrooms from the same batch. This method relies on the observation and comparison of phenotypic traits such as fruiting body morphology and mycelial growth characteristics. Morphological methods are not only time-consuming (up to several months), but also have limited ability to differentiate closely related strains and are easily affected by environmental factors, leading to misjudgments.

[0054] Traditional strain identification mainly relies on fruiting tests and morphological observations. These methods take three to four months and require subjective judgment by professionals, resulting in unsatisfactory stability and reproducibility. In contrast, the molecular identification method described in this embodiment is based entirely on objective detection of genomic DNA, shortening the identification cycle to just a few hours and significantly improving identification efficiency.

[0055] The method described in this embodiment solves the problem of mixed strains caused by the lack of rapid and accurate identification methods in production and promotion. This method has a standardized operation process and provides intuitive and clear results interpretation, effectively overcoming the two major technical bottlenecks of traditional methods: long cycle time and strong subjectivity. It provides reliable technical support for strain purity detection, early screening of breeding materials, and market product traceability, and is of great value for protecting strain intellectual property rights and the healthy development of the industry.

[0056] According to one embodiment of the present invention, preferably, the PCR amplification reaction procedure in step b) of the method for identifying the black-skinned chicken mushroom strain Nongchanggen No. 2 is as follows: preheating at 95°C for 3-5 minutes; performing 30-35 cycles, each cycle including 95°C for 10-30 seconds, 55°C for 10-30 seconds, 72°C for 20-40 seconds; and finally extending at 72°C for 3-8 minutes.

[0057] Specifically, the PCR program was used to amplify the genomic DNA of *Zhongnong Changgen No. 2* strain. First, the reaction system was preheated at 95℃ for 5 minutes to ensure sufficient denaturation of the template DNA. Then, 35 cycles of amplification were performed, with each cycle consisting of denaturation at 95℃ for 30 seconds, annealing at 55℃ for 30 seconds, and extension at 72℃ for 40 seconds. After each cycle, a final extension was performed at 72℃ for 8 minutes. Electrophoresis of the PCR products obtained using this program revealed two clear and highly specific bands with no non-specific amplification background.

[0058] The PCR reaction procedure defined in this embodiment effectively solves the problem of detection failure or misjudgment caused by mismatched amplification conditions by precisely controlling the preheating time, number of cycles, and temperature and duration of each step. This optimized procedure ensures that the amplification reaction for SV molecular markers has high efficiency and strong specificity, making the identification method stable and reliable under different experimental conditions, and improving the overall success rate and repeatability of detection.

[0059] According to one embodiment of the present invention, preferably, the method for identifying the black-skinned chicken mushroom strain Nongchanggen No. 2, the PCR amplification reaction program is as follows: preheating at 95°C for 3 minutes; 30 cycles: 95°C for 15 seconds, 55°C for 15 seconds, 72°C for 30 seconds; and finally extension at 72°C for 5 minutes.

[0060] This embodiment provides more specific limitations on the PCR amplification reaction procedure and offers the optimal reaction parameters. Specifically, the reaction procedure involves preheating at 95°C for 3 minutes, followed by 30 cycles, each cycle consisting of 95°C for 15 seconds, 55°C for 15 seconds, 72°C for 30 seconds, and a final extension at 72°C for 5 minutes.

[0061] This optimized procedure was used to amplify the DNA of *Zhongnong Changgen No. 2* strain. The reaction mixture was precisely preheated at 95°C for 3 minutes, followed by 30 cycles of amplification. The denaturation, annealing, and extension times for each cycle were strictly controlled to 15 seconds, 15 seconds, and 30 seconds, respectively, with a final extension at 72°C for 5 minutes. The PCR products obtained under this procedure showed two clear and sharp specific bands, indicating high amplification efficiency and a clean background.

[0062] The optimal PCR reaction procedure defined in this embodiment significantly improves detection speed while ensuring amplification specificity and efficiency by precisely shortening the time of each step and optimizing the number of cycles. This procedure achieves rapid cyclic amplification, shortening the entire PCR process to approximately 1.5 hours, greatly improving the efficiency of identification work, while maintaining the stability and reliability of the results, and providing convenience for large-scale sample screening.

[0063] According to one embodiment of the present invention, preferably, in the method for identifying the black-skinned chicken mushroom strain Nongchanggen 2, the electrophoretic detection in step c) is performed using an agarose gel with a concentration of 2% to 3% at 80-120V for 30-50 minutes.

[0064] Specifically, a 3% agarose gel was prepared, and after loading the PCR amplification products, electrophoresis was performed at a constant voltage of 100 volts for 40 minutes. Under these conditions, the two specific bands were ideally separated, with clear and sharp bands, accurate size determination, and uniform distribution of molecular weight standard bands, facilitating result analysis. The optimized electrophoresis conditions, by optimizing the three key parameters of gel concentration, voltage, and time, effectively solved the problems of poor separation of small DNA fragments and low band resolution. These optimized conditions ensured that the two specific bands generated by the SV molecular markers were clearly separated and easily identified, greatly improving the accuracy and reproducibility of the identification results and providing a reliable guarantee for the intuitive interpretation of the results.

[0065] According to one embodiment of the present invention, preferably, the method for identifying the Nongchanggen No. 2 strain of black-skinned chicken mushroom further includes the following steps:

[0066] At least one primer from the primer pairs shown in SEQ ID NO:2 and SEQ ID NO:3 was fluorescently labeled. Using the fluorescently labeled primer pairs, PCR amplification was performed with the genomic DNA of the black-skinned chicken mushroom sample as a template.

[0067] The obtained PCR amplification products were analyzed by capillary electrophoresis to obtain the specific peak values ​​and signal intensity values ​​of the two alleles of the SV molecular marker corresponding to SEQ ID NO:1.

[0068] The relative content of Zhongnong Changgen No. 2 strain in the test sample was evaluated based on the signal intensity ratio of two specific peaks. When the signal intensity ratio of the two peaks was 1:1, it indicated that the test sample was a pure culture of Zhongnong Changgen No. 2. When the ratio deviated significantly from 1:1, it indicated that the test sample was a mixed sample and that Zhongnong Changgen No. 2 strain was a non-dominant component.

[0069] In practice, at least one primer pair shown in SEQ ID NO: 2 and SEQ ID NO: 3 is first fluorescently labeled. Using this labeled primer pair, PCR amplification is performed with the genomic DNA of the sample to be tested as a template. The amplification products are then analyzed by capillary electrophoresis to obtain the specific peaks and signal intensity values ​​corresponding to the two alleles of the SV molecular marker described in SEQ ID NO: 1. By analyzing the ratio of the signal intensity of the two peaks, the relative content of Zhongnong Changgen 2 strain in the sample to be tested can be assessed. A ratio of 1:1 indicates a pure culture; a ratio significantly deviating from 1:1 indicates a mixed sample, and that Zhongnong Changgen 2 is not the dominant component.

[0070] In one embodiment, primers labeled with the FAM fluorescent group were used to detect samples of Zhongnong Changgen No. 2 with known purity. The capillary electrophoresis results showed that the signal intensity ratio of the two peaks was close to 1:1. However, when detecting artificially prepared mixed samples, the signal intensity ratio deviated significantly.

[0071] A quantitative identification method was developed by introducing fluorescent labeling and capillary electrophoresis. This method effectively solves the problem that traditional techniques cannot distinguish between pure cultures and mixed samples, and can accurately assess the relative content of target strains in samples, providing a new technical means for strain purity control and quality supervision.

[0072] According to one embodiment of the present invention, preferably, the method for identifying the black-skinned chicken mushroom strain Zhongnong Changgen 2 converts the signal intensity ratio into the estimated mass percentage or genomic DNA percentage of the Zhongnong Changgen 2 strain in the mixed sample by establishing a standard curve.

[0073] In practice, a series of samples with known percentages of mass or genomic DNA of the Zhongnong Changgen No. 2 strain are used beforehand, such as a series of standard samples of 100%, 75%, 50%, 25%, and 0%. These samples are then tested according to the method described in this embodiment, and their signal intensity ratios are recorded. A standard curve is established by plotting the known percentages on the x-axis and the measured signal intensity ratios on the y-axis using linear regression analysis. Subsequently, for any unknown sample, simply substituting its measured signal intensity ratio into this standard curve allows for the calculation of the estimated percentage of mass or genomic DNA of the Zhongnong Changgen No. 2 strain.

[0074] Specifically, a standard curve was established using the aforementioned series of standard samples to correlate the signal intensity ratio with the percentage of strains. Subsequently, an unknown mixed sample was tested, and its measured signal intensity ratio was substituted into the standard curve to directly calculate that the sample contained approximately 40% of the Zhongnong Changgen No. 2 strain, achieving rapid quantification.

[0075] By introducing a standard curve quantitative conversion model, the problem of discrepancy between molecular detection data and actual strain content is effectively solved. It transforms relative electrophoretic signal values ​​into intuitive percentage contents, making the identification results more comparable and instructive, and significantly enhancing the practical application value of this method in strain production, market supervision, and intellectual property protection.

[0076] The application of the SV molecular marker, the specific primer pair, or the kit described herein in the identification of the black-skinned chicken mushroom strain Zhongnong Changgen 2. This aims to solve the technical problem of the lack of molecular identification tools specifically for the Zhongnong Changgen 2 strain in existing technologies, which makes it difficult to quickly and accurately identify and protect this strain in production, promotion, and the market.

[0077] In one specific embodiment, after extracting genomic DNA from the black-skinned chicken mushroom sample, sequencing analysis was performed directly on the SV molecular marker region shown in SEQ ID NO: 1. By comparing the obtained sequence with a standard sequence, if a heterozygous insertion feature is present at a specific position, the sample can be identified as the Zhongnong Changgen No. 2 strain. This application provides the most fundamental molecular basis for the identification of this strain. The sequence diagram is shown below. Figure 2 As shown.

[0078] In another embodiment, the primer pair shown in SEQ ID NO: 2 and SEQ ID NO: 3 was used to perform PCR amplification on the DNA of multiple samples of black-skinned chicken mushroom. Electrophoresis revealed that only the Zhongnong Changgen No. 2 sample showed two clear, specific bands, while other strains such as Or005 or Or010 did not exhibit this amplification characteristic, fully demonstrating the high specificity of this primer pair in strain identification.

[0079] This embodiment clarifies the specific application of the SV molecular marker, specific primer pairs, and reagent kit in identification, providing a complete molecular solution for solving the identification problem of the Zhongnong Changgen 2 strain. Its beneficial effect lies in transforming abstract molecular discoveries into concrete and implementable identification tools, providing a direct technical approach and intellectual property protection foundation for the rapid molecular identification of this strain, strain purity detection, early screening of breeding materials, and market product traceability, thus strongly supporting the industrialization and standardized development of superior strains.

[0080] Specifically, the method for identifying Or001 according to the present invention includes:

[0081] a) Extract total genomic DNA from the test samples of black-skinned chicken mushroom strains or fruiting bodies;

[0082] b) Perform PCR amplification on the extracted total DNA using the primers to obtain PCR amplification products;

[0083] c) Perform agarose gel electrophoresis to specifically identify Or001.

[0084] The preferred PCR amplification program of this invention is as follows: preheating at 95°C for 3 min; 30 cycles: 95°C for 15 s, 55°C for 15 s, 72°C for 30 s; and a final extension at 72°C for 5 min.

[0085] The preferred electrophoresis procedure of this invention is as follows: 3% agarose, constant voltage mode, 100V, 80mA, 40mins.

[0086] In one specific embodiment, the direct application of this SV molecular marker is demonstrated. After extracting genomic DNA from the *Termitomyces albuminosus* sample, sequencing analysis was performed directly on the SV molecular marker region shown in SEQ ID NO: 1. By comparing the obtained sequence with a standard sequence, if a heterozygous insertion feature is present at a specific location, the sample can be identified as *Zhongnong Changgen 2* strain. This application provides the most fundamental molecular basis for identifying this strain.

[0087] In another embodiment, a typical application of the specific primer pair is demonstrated. Using the primer pair shown in SEQ ID NO: 2 and SEQ ID NO: 3, DNA from multiple samples of *Termitomyces albuminosus* (black-skinned matsutake mushroom) was amplified by PCR. Electrophoresis revealed that only the *Zhongnong Changgen 2* sample exhibited two clear, specific bands, while other strains such as Or005 or Or010 did not show this amplification characteristic, fully demonstrating the high specificity of this primer pair in strain identification.

[0088] PCR amplification and sequencing of the same series of samples were performed using standard universal ITS primers. Although ITS sequences of all black-skinned chicken mushroom strains could be obtained, these sequences showed very little difference between closely related strains, making it impossible to effectively distinguish Zhongnong Changgen 2 from other black-skinned chicken mushroom strains and thus failing to achieve accurate identification.

[0089] Compared to existing technologies, the identification of edible fungi strains generally relies on methods such as morphological observation, fruiting tests, or universal DNA barcoding. These methods either take months to complete or lack sufficient resolution to distinguish between similar strains, failing to meet the market and industry demands for efficient and specific intellectual property protection for specific superior strains.

[0090] This invention clarifies the specific application of the SV molecular marker, specific primer pairs, and reagent kit in identification, providing a complete molecular solution for solving the identification problem of the Zhongnong Changgen 2 strain. Its beneficial effect lies in transforming abstract molecular discoveries into concrete and implementable identification tools, providing a direct technical approach and intellectual property protection foundation for the rapid molecular identification of this strain, strain purity detection, early screening of breeding materials, and market product traceability, thus strongly supporting the industrialization and standardized development of superior strains.

[0091] Example 1

[0092] Genomic DNA extraction from *Termitomyces albuminosus*. After 8 days of mycelial culture, the mycelia were collected, and total DNA was extracted using a modified CTAB method.

[0093] Primer design

[0094] The Wuhan Hope Group was commissioned to perform second-generation genome sequencing on the *Termitomyces albuminosus* mycelial samples obtained in Example 1. After quality control using FastQC software, the sequencing data was compared one-to-one with the reference genome using BWA (Burrows-Wheeler Aligner) software. Then, GATK (Genome Analysis Toolkit, 4.2.6.1) software was used to screen and filter variant information, eliminating variant sites with low confidence. Finally, IGV (Integrative GenomicsViewer, 2.6.3) software was used to identify the heterozygous variant site unique to Or001 that distinguishes it from other *Termitomyces albuminosus* species, as well as variant sites from other *Termitomyces albuminosus* species. Primers were developed using the SV site at position 1746169 of GWHBRAH00000003 in *Termitomyces albuminosus*. The inventors selected the following primers (Primerpair 6) from the designed 10 primer sets for use:

[0095] F: 5'-TAAGCGAGAGAGACCTGAAA-3'

[0096] R: 5'-ATGGAAAACGGACTGAATGG-3'

[0097] PCR amplification and identification of the fungi to be tested. The fungi to be tested were used to extract total DNA using a modified CTAB method. The extracted total DNA was amplified by PCR using the specific primers designed in Example 1. The PCR amplification system is as follows.

[0098] PCR system: 20 μL 2xMix, 2 μL F primer, 2 μL R primer, 25 μL ddH2O, 1 μL DNA

[0099] PCR program: Preheat at 95℃ for 3 min; 30 cycles: 95℃ for 15 s, 55℃ for 15 s, 72℃ for 30 s; final extension at 72℃ for 5 min.

[0100] The concentration of the primers was 100 µM. Figure 1 As shown, the results were detected using a gel imaging system after 3% agarose gel electrophoresis. The black-skinned chicken mushroom strain Or001 exhibited a heterozygous deletion, displaying two specific bands, while other black-skinned chicken mushroom strains only showed one band. Therefore, Or001 can be rapidly identified using the simple operation of this invention.

[0101] Although the embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. They can be applied to various fields suitable for the present invention. For those skilled in the art, other modifications can be easily made. Therefore, without departing from the general concept defined by the claims and their equivalents, the present invention is not limited to the specific details.

Claims

1. A specific primer pair for identifying the *Termitomyces albuminosus* strain Nongchanggen 2, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID NO:2 and SEQ ID NO:3, respectively.

2. A kit for identifying the Nongchanggen No. 2 strain of *Termitomyces albuminosus*, characterized in that, It includes the specific primer pair as described in claim 1.

3. A method for identifying the *Termitomyces albuminosus* strain Nongchanggen No. 2, characterized in that, Includes the following steps: a) Extract genomic DNA from the black-skinned chicken mushroom sample to be tested; b) Using the primer pair shown in SEQ ID NO:2 and SEQ ID NO:3 as primers, and the genomic DNA extracted in step a) as a template, perform PCR amplification reaction; c) Perform electrophoretic detection on the PCR amplification products obtained in step b); d) Identification based on electrophoresis results: If two specific bands appear in the amplification product, the sample to be tested is determined to be Zhongnong Changgen No. 2 strain.

4. The method for identifying the *Termitomyces albuminosus* strain Nongchanggen No. 2 according to claim 3, characterized in that, The PCR amplification reaction procedure described in step b) is as follows: preheat at 95°C for 3-5 minutes; perform 30-35 cycles, each cycle including 95°C for 10-30 seconds, 55°C for 10-30 seconds, 72°C for 20-40 seconds; and finally extend at 72°C for 3-8 minutes.

5. The method for identifying the *Termitomyces albuminosus* strain Nongchanggen No. 2 according to claim 4, characterized in that, The PCR amplification reaction procedure was as follows: preheating at 95°C for 3 minutes; 30 cycles: 95°C for 15 seconds, 55°C for 15 seconds, 72°C for 30 seconds; and a final extension at 72°C for 5 minutes.

6. The method for identifying the *Termitomyces albuminosus* strain Nongchanggen No. 2 according to claim 3, characterized in that, The electrophoresis detection described in step c) involves using an agarose gel with a concentration of 2% to 3% and electrophoresis at 80-120V for 30-50 minutes.

7. The method for identifying the *Termitomyces albuminosus* strain Nongchanggen No. 2 according to claim 3, characterized in that, It also includes the following steps: At least one primer from the primer pairs shown in SEQ ID NO:2 and SEQ ID NO:3 was fluorescently labeled. Using the fluorescently labeled primer pairs, PCR amplification was performed using the genomic DNA of the black-skinned chicken mushroom sample as a template. The obtained PCR amplification products were analyzed by capillary electrophoresis to obtain the specific peak values ​​and signal intensity values ​​of the two alleles of the SV molecular marker corresponding to SEQ ID NO:

1. The relative content of Zhongnong Changgen No. 2 strain in the test sample was evaluated based on the signal intensity ratio of two specific peaks. When the signal intensity ratio of the two peaks was 1:1, it indicated that the test sample was a pure culture of Zhongnong Changgen No.

2. When the ratio deviated significantly from 1:1, it indicated that the test sample was a mixed sample and that Zhongnong Changgen No. 2 strain was a non-dominant component.

8. The method for identifying the *Termitomyces albuminosus* strain Nongchanggen No. 2 according to claim 7, characterized in that, The signal intensity ratio was converted into the estimated mass percentage or genomic DNA percentage of the Zhongnong Changgen No. 2 strain in the mixed sample by establishing a standard curve.

9. The application of the specific primer pair as described in claim 1 or the kit as described in claim 2 in the identification of the black-skinned chicken mushroom strain Zhongnongchanggen 2, the identification is based on the electrophoresis results: if two specific bands appear in the amplification product, the sample to be tested is determined to be Zhongnongchanggen 2 strain.

Citation Information

Patent Citations

  • Cultivation method of oudemansiella radicata strain

    CN112369275A

  • Primer pair and method for identifying new Oudemansiella oosporium strain HCS

    CN119530440A