Kazakstein saccharomycetes and culture method and application of Kazakstein saccharomycetes for synthesizing flavor ester

By isolating and culturing Kazakhstani yeast NW717, the problem of unclear flavor ester synthesis mechanism in baijiu fermentation has been solved, and the flavor of baijiu has been improved. In particular, by synthesizing phenylethyl propionate, the floral and sweet aromas of baijiu have been enhanced.

CN121320118APending Publication Date: 2026-01-13WULIANGYE +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511749862.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-26
Publication Date
2026-01-13

AI Technical Summary

Technical Problem

Existing technologies make it difficult to clarify the contribution of Kazakhstani yeasts to flavor compounds, especially the synthesis mechanism of flavor esters, during the later stages of baijiu fermentation.

Method used

A Kazakhstani yeast strain (Kazachstania gamospora) NW717, isolated from sorghum mash and yielding high phenylethyl propionate, with accession number GDMCC No: 67029, was provided. The flavor ester phenylethyl propionate was synthesized by culturing it in sorghum saccharification and fermentation broth in the presence of phenylalanine.

Benefits of technology

The role of Kazakh yeast in the synthesis of flavor compounds was clarified, which improved the flavor quality of baijiu, especially by synthesizing phenylethyl propionate, which has floral and sweet aromas, thus enhancing the flavor experience of baijiu.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121320118A_ABST
    Figure CN121320118A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of microbial culture, and particularly relates to Kazachstania gamopora as well as a culture method and an application of the Kazachstania gamopora for synthesizing flavor ester of the Kazachstania gamopora. In order to clarify the effect of Kazakstein saccharomycetes on flavor substances produced by metabolism and provide an optimal microbial resource for synthesis of flavor esters in a white spirit fermentation process, the invention provides Kazakstein saccharomycetes NW717 which is separated from fermented grains and has high yield of phenethyl propionate, and the preservation number is GDMCC No: 67029. The strain can utilize phenylalanine to synthesize phenethyl propionate with flower fragrance and sweet fragrance, and is of great significance to the field of food brewing, especially to improvement of white spirit flavor in white spirit brewing.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of microbial culture, and particularly relates to a Kazakhstan Saccharomycopsis sp. (Kazakhstan Saccharomycopsis sp.), Kazachstania gamospora and a culture method and application thereof for synthesizing flavor esters. BACKGROUND

[0002] In the complex microbial fermentation process of liquor brewing, yeast plays an important role, not only as the key to converting sugar into alcohol, but also as the key strain for the metabolic synthesis of flavor substances related to the rich aroma and mellow taste of liquor. Specifically, its core role mainly reflects in the following aspects: Firstly, yeast is the absolute main force of alcohol fermentation. Through its intracellular rich enzyme system, brewer's yeast metabolizes the fermentable sugars such as glucose in the raw materials anaerobically, and the main products are ethanol and carbon dioxide. This process provides the basic liquor skeleton and driving force for liquor, which is a prerequisite for liquor to be called "wine".

[0003] Secondly, yeast is the core factory for generating flavor compounds. While performing alcohol fermentation, the metabolic activities of yeast also produce a large number of secondary metabolites, which constitute the basis of liquor flavor compounds. Among them, ester compounds are important components of pleasant aroma such as "pit cellar aroma" and fruity aroma of liquor, for example, ethyl hexanoate, ethyl acetate, ethyl lactate, etc., which jointly determine the typical aroma type and quality of liquor. In addition, the high alcohols produced by yeast metabolism can increase the mellow taste of liquor when in appropriate amount, and organic acids (such as lactic acid and acetic acid) can harmonize the liquor body, give it a refreshing taste and enhance the sweetness. These hundreds of flavor substances such as acids, alcohols, esters, and aldehydes form a complex and harmonious aroma and taste in a delicate balance.

[0004] Thirdly, the synergistic effect of different yeast strains determines the aroma type of liquor. Liquor brewing is not a pure fermentation of a single yeast, but a result of the synergistic effect of a large microbial system composed of multiple yeasts (such as ester-producing Torulopsis, Pichia kudriavzevii, and alcohol-producing Saccharomyces cerevisiae) and molds, bacteria. For example, in the pit mud of strong-flavor liquor, bacteria such as hexanoic acid bacteria produce hexanoic acid, and yeast combines it with ethanol to form ethyl hexanoate, which gives strong-flavor liquor its soul. This "division of labor and cooperation" among microbial communities is the fundamental reason for the different styles of different aroma types of liquor (such as Maotai-flavor, strong-flavor, and Fen-flavor).

[0005] The activities of yeast also run through the entire brewing process, especially in the later fermentation stage, which has an important contribution to ester production and aroma enhancement, dynamically shaping the style of the final product. In the fermentation process of liquor, Kazakhstan Saccharomycopsis sp. accounts for 30-60% of the abundance of fungal microorganisms, Kazachstania), not only throughout the whole process of pit fermentation production, but also with high abundance, is an important fermentation functional strain (Food Science, 2024, 45(07): 111-118; Food and Fermentation Industries, 2025, DOI: 10.13995 / j.cnki.11-1802 / ts.042432). However, the current research has not clearly shown the role of Kazakhstan yeast in metabolizing flavor substances, making it difficult to objectively analyze the contribution of yeast to flavor substances in the later stage of liquor fermentation. SUMMARY

[0006] In order to clarify the role of Kazakhstan yeast in metabolizing flavor substances and provide optimal microbial resources for the synthesis of flavor esters in the fermentation process of liquor, the present application provides a Kazakhstan yeast (Saccharomyces cerevisiae) isolated from fermented grains with high yield of phenethyl propionate Kazachstania gamospora ) NW717, with a preservation number of GDMCC No: 67029. The preservation time is September 25, 2025, the preservation center is Guangdong Microbial Culture Collection Center, located at No. 59, Building 5, 100, Martyrs' Road, Guangzhou, with a postcode of 510070. The classification name is Kazachstania gamospora .

[0007] To achieve the above application purposes, the technical solutions adopted by the present application are as follows: In a first aspect, the present application provides a Kazakhstan yeast (Saccharomyces cerevisiae) producing flavor esters Kazachstania gamospora ) NW717, with a preservation number of GDMCC No: 67029.

[0008] Among them, the biological characteristics of the Kazakhstan yeast NW717 are: round, milky white, regular edge, and slightly raised center.

[0009] Among them, the ITS nucleotide sequence of the Kazakhstan yeast NW717 is shown in SEQ ID NO: 1.

[0010] SEQ ID NO: 1: ITS nucleotide sequence of the Kazakhstan yeast NW717: CTGCCTTGATTAAGATTAGTAATTTGGAGACGTTTGTTTAGAGAGAGATTGGTAATGGGACAGCCTGCGCTTAACTGCGCGGTTGGACTGAGACTGGTTGTTAATTTCTTTAGGCGTGTTTCTATATTACACTACACTGTGGAGTTTTTTTCTTTACAACTATTTTTTTTCTTTGGGCTTTTGGGCCCAGAGTGCACAAACACAAACAATTTTGTAATTTTTACAAGTCAATCATGCTTTTTATTAAGCAAAACCAAAATATTCAAAACTTTCAACAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTTCTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACAACTTTGTTTGGTTGTGAGTGACACTCTGTTTATGCAGAGTTAACTTGAAATTGTTAGCTGTTTAGATTTTTGTCTAAATTCAATTTCCCAAAAGGATATTCTCAGTGAGAGTTGATTTTTTGTCGTATTAGGTTTTACCAACTTCGACGGTGATCAGTCTTGAGCTTTGGATGTTAAAGTTCTCTTGGTGAAGATGTTTTTACAAACCAGTCTTGGCGAACAATACTCTTTAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAACCCGGAGGAAA.

[0011] wherein the Saccharomyces cerevisiae NW717 can metabolically synthesize phenethyl propionate in the presence of phenylalanine.

[0012] In a second aspect, the present application provides a microbial inoculant containing the Saccharomyces cerevisiae NW717.

[0013] In a third aspect, the present application provides a culture method for synthesizing flavor ester by the Saccharomyces cerevisiae NW717, comprising the following steps: inoculating the Saccharomyces cerevisiae NW717 into a highland barley saccharification fermentation broth containing phenylalanine, and then culturing; the flavor ester is phenethyl propionate.

[0014] The inoculation amount of the Kazakhstani yeast NW717 is 1–10% v / v.

[0015] The culture temperature is 28–32℃.

[0016] The cultivation time is 2 to 5 days.

[0017] The concentration of phenylalanine is 0.1–20 g / L.

[0018] The sorghum saccharification and fermentation broth is obtained by adding liquefying enzyme and saccharifying enzyme sequentially to gelatinized sorghum for liquefaction and saccharification, and then adjusting the sugar content.

[0019] Fourthly, the present invention provides the application of the above-mentioned Kazakhstani yeast NW717 or microbial inoculants in winemaking.

[0020] The wine is at least one of distilled wine, fermented wine, or blended wine.

[0021] Preferably, the alcoholic beverage is selected from at least one of the following: baijiu, brandy, whiskey, vodka, rum, gin, tequila, fruit spirits, huangjiu, beer, wine, fruit wine, sake, or milk wine.

[0022] More preferably, the liquor is at least one of the following: soy sauce aroma type, strong aroma type, light aroma type, or rice aroma type.

[0023] Fifthly, the present invention provides the application of the above-mentioned Kazakhstani yeast NW717 or microbial inoculant in the preparation of fermented mash, yeast starter or food fermentation liquid containing phenylethyl propionate.

[0024] Beneficial effects: This invention isolates, screens, and identifies a Kazakhstani yeast strain that produces high levels of phenylethyl propionate from baijiu mash. Kazachstania gamospora NW717, with accession number GDMCC No: 67029, is a strain that can synthesize phenylethyl propionate with floral (rose) and sweet aromas from phenylalanine. This is of great significance for the food brewing industry, especially for improving the flavor of baijiu (Chinese liquor). Attached Figure Description

[0025] Figure 1 The images show (A) and (B) microscopic images of Kazakhstani yeast NW717 in Example 2 of this invention. Figure 2 The images show the original gas chromatograms and mass spectrometry qualitative identification results of phenylethyl propionate synthesized from Kazakhstani yeast NW717 in Example 3 of this invention; where (A) is the original gas chromatogram of the fermentation broth without phenylalanine and (B) is the original gas chromatogram of the fermentation broth with phenylalanine; and (C) is the mass spectrometry qualitative detection result of phenylethyl propionate. Figure 3A graph for quantitative analysis of the yield of phenethyl propionate at different phenylalanine addition concentrations in Example 3 of the present application.

[0026] Preservation of the Kazakhstan yeast NW717 of the present application: The Kazakhstan yeast NW717 was preserved on September 25, 2025, in the Guangdong Microbial Culture Collection Center, located at No. 59, Building 5, 100, Martyrs' Road, Guangzhou, with a postal code of 510070. The classification name is Kazachstania gamospora , and the preservation number is GDMCC No: 67029. DETAILED DESCRIPTION

[0027] In order to make the technical problems, technical solutions and beneficial effects of the present application more clear, the present application will be further described in detail below in combination with the embodiments. Unless otherwise defined, all technical terms used herein have the same meanings as understood by those skilled in the art.

[0028] In an embodiment of the present application, a Kazakhstan yeast NW717 was screened, isolated and identified from the fermented grains of baijiu, and the preservation number thereof is GDMCC No: 67029.

[0029] The Kazakhstan yeast NW717 described above is first cultured in a YPD solid culture medium to form a single colony, and then its colony morphology is observed, and molecular biology identification is combined to determine the ITS nucleotide sequence thereof as shown in SEQ ID NO: 1. The genetic sequence is compared in the EzBioCloud database to determine that it is a Kazakhstan yeast Kazachstania gamospora .

[0030] In an embodiment of the present application, phenylalanine is added when preparing the fermentation liquor of the Kazakhstan yeast NW717, which can improve the ability of the Kazakhstan yeast NW717 to metabolically synthesize phenethyl propionate, and the yield thereof is the highest when the concentration of phenylalanine is 5 g / L.

[0031] The following specific examples will be listed to explain the scheme of the present application. Those skilled in the art will understand that the following examples are only used to illustrate the present application, and should not be regarded as limiting the scope of the present application. If the specific technology or condition is not specified in the examples, the technology or condition described in the literature in the art or according to the product instruction is used. If the reagent or instrument is not specified by the manufacturer, it is a conventional product that can be obtained by purchase.

[0032] The composition of the sorghum saccharification fermentation liquid used in the following examples is as follows: 250 g of sorghum powder is boiled with 1 L of deionized water to gelatinize until there is resistance to stirring, 0.5 g of thermostable a-amylase is added, and liquefaction is performed at 90°C for 1 h. After cooling, 0.2 g of saccharifying enzyme is added, and saccharification is performed at 60°C for 2 h. After cooling to room temperature, centrifugation is performed, filtration is performed using gauze, and the sugar degree is adjusted to 8 Brix using deionized water. After dispensing, sterilization is performed at 115°C for 20 min.

[0033] YPD solid medium: yeast extract 10 g / L, peptone 20 g / L, glucose 20 g / L, agar 18 g / L.

[0034] Example 1: Isolation, screening and identification of Kazakhstan yeast NW717 Isolation and screening: a sample of fermented grains taken from a fermentation tank of a distillery is dispersed in sterilized normal saline at 30°C and 180 r / min and incubated for 30 min. The dispersed liquid after incubation is diluted by 10 -5 times with sterile normal saline, and 3 gradients of the diluted 10 -3 , 10 -4 , and 10 -5 times are taken, respectively, and are spread on YPD solid medium, and aerobic culture is performed at 30°C. The growth on the medium is observed every 24 h. Single colonies with differences in size, shape, and surface state are selected, and the three-zone streaking method is used to separate and purify the single colonies three times on YPD solid medium to obtain single colonies. The single colonies are picked and activated in liquid, and are cultured at 30°C and 180 r / min for 24 h. The bacterial liquid is mixed with 50% glycerol at a ratio of 1:1 for preservation, and is placed in a -20°C refrigerator for standby.

[0035] Identification: (1) Morphological characteristics: the colony of the isolated NW717 strain is round, milky white, with a neat edge and a slightly raised center. The single colony is picked, mixed by blowing and sucking in normal saline, and the bacterial suspension is fixed on a glass slide. After being dyed with iodine solution for 1 min, the dyeing solution is washed off with water, and the cell morphology is observed under a microscope. The cells of the NW717 strain are nearly round or oval, with a diameter of 2-5 microns.

[0036] (2) ITS identification: the DNA of the strain is extracted according to the steps of the Fungal Genomic DNA Extraction Kit (Beijing Solabio Science and Technology Co., Ltd.) as the PCR (Polymerase Chain Reaction) template.

[0037] The ITS sequence of the yeast strain was amplified by PCR using primers IST1: SEQ ID NO: 2 (5'-CCGTAGGTGAACCTGCGG-3') and IST4: SEQ ID NO: 3 (5'-TCCTCCGCTTATTGATATGC-3'). The amplification system (25 μL): 0.5 μL of upstream primer, 0.5 μL of downstream primer, 12.5 μL of 2x MiX enzyme (Nanjing Novogene Bio- tech Co., Ltd.), 1 μL of DNA template, 10.5 μL of ddH2O. The amplification program: 95℃ for 3 min; 95℃ for 15 s, 50℃ for 15 s; 72℃ for 2 min, a total of 35 cycles; 72℃ for 5 min; 12℃ for ∞. After agarose gel electrophoresis verification of the PCR product, it was sent to Beijing Huada Gene Technology Co., Ltd. for sequencing. The sequencing results were compared with the known sequences in the EzBioCloud database (https: / / www.ezbiocloud.net / ). Sequences with a sequence similarity of more than 99% were identified as the same species, and further comparison of the morphological characteristics and physiological and biochemical characteristics of the isolated yeast with the yeast species recorded in the literature was made. If they were completely consistent, they were identified as Kazachstania.

[0038] The screened Kazachstania NW717 was preserved on September 25, 2025, and the preservation center was Guangdong Microbial Culture Collection Center, located at No. 59 Building, 5th Floor, Guangzhou Xianlie Middle Road 100 Courtyard, with a postcode of 510070. The classification name was Kazachstania gamospora , and the preservation number was GDMCC No: 67029.

[0039] Example 2: Cultivation of Kazachstania NW717 Strain activation: Under sterile operation conditions, the screened Kazachstania NW717 was inoculated into a 30 mL test tube containing 5 mL of sorghum saccharification fermentation broth at a 2% v / v inoculation amount, and cultured at 30 ± 2℃ and 100 ± 50 r / min on a shaking bed for 1-2 days.

[0040] After strain activation, the sorghum saccharification fermentation broth containing 2% agar powder and sterilized was streak inoculated, and a single colony was taken, spread on a glass slide to which a drop of sterile water was added, and the cells were fixed by flame heating to maintain the cell morphology. A methylene blue solution was added for staining for 2 minutes, and then observed under a microscope. As shown in Figure 1 , the colony was round, milky white, with a neat edge and a slightly raised center.

[0041] Example 3: Preparation of Kazachstania NW717 fermentation broth Optimization of fermentation culture: under sterile operation conditions, activated Kazakhstan yeast NW717 was inoculated into 300 mL of a modified 100 mL of a high-sugar fermentation culture medium (containing different concentrations of phenylalanine) at a 2% v / v inoculation amount, and cultured at 30 ± 2°C and 100 ± 50 r / min for 2-5 days.

[0042] The modified high-sugar fermentation culture medium is a high-sugar fermentation liquid to which 0-20 g / L of phenylalanine is added.

[0043] In the fermentation flask, 20 mL of the fermentation culture medium was taken, centrifuged at 6000x g for 10 min, and the supernatant was taken, 4-octanol was added as an internal standard, and then 2.5 g of sodium chloride was added. Then, gas chromatography mass spectrometry was used for quantitative detection. g

[0044] Gas chromatography conditions: the chromatographic column was a DB-wax capillary column (60 m*0.25 mm*0.25 μm), the injection port temperature was 250°C, the carrier gas was 99.999% high-purity helium, the flow rate was 1 mL / min, and no split injection was used. Solid-phase microextraction was used for sampling, and the sampling needle type was SmartSPME Fiber 80um DVB / C-WR / PDMS, 3 pcs.

[0045] Column oven temperature program: the initial temperature was 40°C, maintained for 5 min, increased to 220°C at a rate of 5°C / min, and then increased to 250°C at a rate of 20°C / min and maintained for 2.5 min.

[0046] Mass spectrometry conditions: the interface temperature was 230°C, the ion source temperature was 230°C, the acquisition mode was Q3 scan, the mass scan range was 20-400 m / z, and the solvent delay was 4 min.

[0047] The results show that the Kazakhstan yeast NW717 culture method and the Kazakhstan yeast NW717 cultured by the method have the ability to metabolically synthesize phenethyl propionate (as shown in Figure 2 , and in the presence of phenylalanine, can produce high yields of phenethyl propionate. When the concentration of phenylalanine is 5 g / L, the yield is as high as 1.60 ± 0.10 g / L (as shown in Figure 3 ). Phenethyl propionate has a floral (rose) and sweet fragrance, and has an important influence on the flavor of baijiu. Therefore, the Kazakhstan yeast NW717 and the fermentation broth thereof according to the present application have important significance for the improvement of the flavor of baijiu when used in the production of baijiu.​

Claims

1. Kazakhstani yeast producing flavor esters ( Kazachstania gamospora NW717, characterized in that, The accession number is GDMCC No: 67029.

2. A microbial inoculant, characterized in that, Contains the Kazakhstani yeast NW717 as described in claim 1.

3. The method for culturing Kazakhstani yeast NW717 to synthesize flavor esters according to claim 1, characterized in that, The process includes the following steps: inoculating Kazakhstani yeast NW717 into sorghum saccharification and fermentation broth containing phenylalanine, and then culturing it; the flavor ester is phenylethyl propionate.

4. The cultivation method according to claim 3, characterized in that, The inoculation amount of Kazakhstani yeast NW717 was 1–10% v / v.

5. The cultivation method according to claim 3, characterized in that, The incubation temperature is 28–32℃, and the incubation time is 2–5 days.

6. The cultivation method according to claim 3, characterized in that, The concentration of phenylalanine is 0.1–20 g / L.

7. The cultivation method according to claim 3, characterized in that, The sorghum saccharification and fermentation broth is obtained by adding liquefying enzyme and saccharifying enzyme sequentially after sorghum gelatinization, followed by liquefaction and saccharification, and then adjusting the sugar content.

8. The application of Kazakhstani yeast NW717 as described in claim 1 or the microbial agent as described in claim 2 in winemaking.

9. The application according to claim 8, characterized in that, The liquor is at least one of distilled spirits, fermented spirits, or blended spirits; preferably, the liquor is selected from at least one of baijiu, brandy, whiskey, vodka, rum, gin, tequila, fruit distilled spirits, huangjiu, beer, wine, fruit wine, sake, or milk wine; more preferably, the baijiu is at least one of soy sauce aroma type, strong aroma type, light aroma type, or rice aroma type.

10. The use of Kazakhstani yeast NW717 according to claim 1 or the microbial agent according to claim 2 in the preparation of fermented mash, yeast starter or food fermentation liquid containing phenylethyl propionate.