Application of CsSSCD1 gene in regulating accumulation of theanine in tea plant
By regulating the synthesis and degradation pathways of theanine in tea plants through silencing or overexpressing the CsSSCD1 gene, the systematic understanding of the molecular regulatory network of theanine synthesis and degradation was solved, the accumulation of theanine was regulated, and the quality of tea was improved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-04
- Publication Date
- 2026-03-24
AI Technical Summary
Existing research has not yet fully revealed the molecular regulatory network of theanine synthesis and degradation, especially the interaction mechanism between tyrosine degradation pathway and theanine accumulation, and the molecular basis affecting tea quality formation lacks a systematic understanding.
The synthesis and degradation pathways of theanine in tea plants were regulated by silencing or overexpressing the CsSSCD1 gene. The accumulation of theanine was regulated by its nucleotide sequence (SEQ ID No. 1). VIGS and transient overexpression systems were constructed to verify its negative regulatory effect and to explore the influence of the tyrosine degradation pathway on theanine accumulation.
The regulation of the CsSSCD1 gene significantly affects theanine content, increasing or inhibiting the accumulation of theanine. A theanine metabolism regulatory network was constructed, which improved tea quality and revealed the key enzymes and regulatory factors in the synthesis and degradation of theanine.
Smart Images

Figure CN121320417B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant molecular biology, and more particularly to... CsSSCD1 Application of genes in regulating the accumulation of theanine in tea plants. Background Technology
[0002] Tea is one of the world's three major non-alcoholic beverages and an important economic crop in my country. Its rich secondary metabolites contribute to its unique flavor. Among them, theanine, an amino acid unique to tea plants, is a key component affecting the taste and functionality of tea infusion and is one of the important indicators for evaluating tea quality. Currently, theanine synthesis mainly involves two steps: First, alanine loses its carboxyl group under the action of alanine decarboxylase (AlaDC) to generate ethylamine; subsequently, Glu and ethylamine are catalyzed by theanine synthase (CsTSI) to generate theanine. AlaDC is a key restriction enzyme, and its expression level is highly positively correlated with the content of ethylamine and theanine, playing a decisive role in regulating the rate of theanine synthesis.
[0003] Environmental factors significantly influence the accumulation of theanine. Theanine content is highest in spring shoots and decreases significantly with increasing season and leaf age. Light intensity, nitrogen supply, and temperature changes all affect its synthesis and degradation by regulating the expression of metabolic genes. For example, nitrogen fertilizer application significantly promotes theanine synthesis, while strong light induces the activation of degradation pathways. Studies have found that γ-glutamyl transpeptidases (CsGGTs) can hydrolyze theanine, and their expression levels increase significantly in older leaves and under strong light, leading to a decrease in theanine content. Furthermore, previous studies have shown that multiple transcription factors (such as CsMYB42 and CsMYB73) can directly bind to and regulate the promoter activity of genes related to theanine synthesis or degradation, thereby affecting its accumulation level.
[0004] Although the aforementioned studies have preliminarily revealed key enzymes and some regulatory factors in the synthesis and degradation of theanine, a systematic understanding of the theanine metabolic regulatory network is still lacking. Previous research has suggested that glutamate, required for theanine synthesis, also participates in tyrosine synthesis and degradation metabolism, and that the tyrosine metabolic pathway may indirectly affect theanine accumulation through competition with glutamate or other mechanisms; however, this potential link lacks experimental evidence. In Arabidopsis thaliana, the gene encoding fumarylacetoacetate hydrolase (FAH), a key enzyme in this pathway, is... SSCD1 ( Short-day Sensitive Cell Death1 The mutation leads to programmed cell death under short-day conditions. However, research on the tyrosine degradation pathway in tea plants is still lacking, and its molecular regulatory mechanisms are even less known.
[0005] Therefore, exploring the interaction mechanism between tyrosine degradation pathway and theanine accumulation is an important scientific issue for clarifying the amino acid metabolism network of tea plants and elucidating the molecular basis of tea quality formation. Summary of the Invention
[0006] The purpose of this invention is to explore CsSSCD1 It plays a key role in regulating the accumulation of theanine in tea plants.
[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0008] This invention provides CsSSCD1 The application of genes in regulating theanine accumulation in tea plants, the aforementioned CsSSCD1 The nucleotide sequence of the gene is shown in SEQ ID No. 1.
[0009] Preferably, using the CsSSCD1 The method to enhance the accumulation of theanine in tea trees through gene therapy is as follows: CsSSCD1 The silencing of theanine enhances its synthesis and inhibits its degradation, thereby increasing the accumulation of theanine.
[0010] Preferably, using the CsSSCD1 The method to inhibit the accumulation of theanine in tea trees through gene therapy is as follows: CsSSCD1 Overexpression of the compound enhances the synthesis and degradation pathways of tyrosine, activates glutamate metabolism, inhibits the synthesis pathway of theanine and promotes the degradation of theanine, thereby inhibiting the accumulation of theanine.
[0011] The present invention also provides CsSSCD1 The application of genes in improving tea quality, the aforementioned CsSSCD1 The nucleotide sequence is shown in SEQ ID No. 1.
[0012] Preferably, using the CsSSCD1 The method of improving tea quality through genetic engineering is as follows: CsSSCD1 Gene silencing increases the accumulation of theanine, thereby improving tea quality.
[0013] This invention utilizes RT-qPCR detection technology to discover [the following information] through sampling under various environmental conditions (long and short day light, cold stress, and different light qualities) of multiple varieties. CsSSCD1 Expression showed a stable negative correlation with theanine content.
[0014] This invention utilizes VIGS technology for silencing. CsSSCD1 Subsequently, a significant increase in theanine was observed; further transient overexpression was observed in tea leaf fragments. CsSSCD1 The study found a significant decrease in theanine content, confirming the negative regulatory role of this gene. Furthermore, this invention, through targeted amino acid metabolomics analysis, discovered that... CsSSCD1Inhibition of expression weakens tyrosine synthesis, inhibits the expression of AAAT, a key enzyme in the synthesis of aromatic amino acids, reduces glutamate accumulation but not significantly, while significantly reduces glutamine accumulation, ultimately hindering the degradation of theanine and increasing its synthesis.
[0015] This invention is the first to propose that the accumulation of theanine may be regulated by the tyrosine degradation pathway through metabolic pathway interactions and substrate competition mechanisms. Based on this, the key genes of this pathway were identified and functionally validated for the first time. CsSSCD1 It is negatively correlated with theanine metabolism.
[0016] This invention demonstrates, through the construction of VIGS and transient overexpression systems, that... CsSSCD1 The study investigated the effects on the content of theanine and related amino acids, and preliminarily constructed a regulatory network containing transcriptional regulatory factors. Attached Figure Description
[0017] Figure 1 This is the standard curve for theanine.
[0018] Figure 2 for CsSSCD1 Expression levels and accumulation of theanine under various environmental conditions: (A) Theanine content in tea leaves after 0 and 15 days of short-day treatment. CsSSCD1 (B) Changes in gene expression levels; CsSSCD1 Correlation analysis between expression levels and theanine content (each point represents a biological replicate (n=3)); (C) under low temperature treatment (10℃) and control (25℃) conditions, theanine content and CsSSCD1 (D) Changes in expression levels in tea leaves under different light qualities (white light, blue light, red light) treatment. CsSSCD1 Changes in expression levels and theanine content.
[0019] Figure 3 For silence CsSSCD1 The effects of this study on the content of theanine and Tyr (tyrosine) in tea leaves and the expression of related genes were investigated. Specifically, (A) gene silencing (VIGS) using the silencing vector pTRV2-CsSSCD1 resulted in changes in the theanine content and... CsSSCD1 (B) Changes in relative expression levels; silencing CsSSCD1 Changes in Tyr content compared to the control group (pTRV2); (C) Silence CsSSCD1 Changes in glutamic acid (Glu) content in tea leaves after silencing; (D) silence CsSSCD1 Changes in glutamine (Gln) content in tea leaves after aging; (E–L) CsSSCD1 Changes in the expression of key genes involved in theanine synthesis and related metabolic pathways after silencing: (E) CsGGT2 (γ-glutamyl transpeptidase), (F) CsTS1 (Theanine synthase), (G) CsAlaDC (Alanine decarboxylase), (H) CsGOGAT (Glutamate synthase), (I)CsGS1.2 and (J) CsGS1.1 (Glutamine synthase isoenzyme), (K) CsAAAT1 (Aromatic amino acid transaminase).
[0020] Figure 4 for CsSSCD1 The effects of overexpression on theanine and Tyr content and the expression of related genes, among which, (A) CsSSCD1 Overexpression ( OE-CsSSCD1 The theanine content in tea leaves after treatment and CsSSCD1 Changes in gene expression levels, compared with the empty vector control group; (B) CsSSCD1 Changes in Tyr content in tea leaves after overexpression; (C) Changes in glutamate content; (D) Changes in glutamine content; (E–L) CsSSCD1 Expression levels of genes related to theanine and amino acid metabolism after overexpression: (E) CsGGT2 (γ-glutamyl transpeptidase), (F) CsTS1 (Theanine synthase), (G) CsAlaDC (Alanine decarboxylase), (H) CsGOGAT (Glutaminase), (I–J) CsGS1.1 and CsGS1.2 (Glutamine synthase subtype), (K) CsAAAT1 (Aromatic amino acid transaminase).
[0021] Figure 5 CsSSCD1 Gene-theanine regulatory model. Detailed Implementation
[0022] CsSSCD1 The nucleotide sequence (SEQ ID No. 1):
[0023]
[0024] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0025] Example 1: Different treatment conditions and variety backgrounds CsSSCD1 Expression characteristics analysis
[0026] To reveal the system CsSSCD1 The expression pattern of theanine and its potential relationship with theanine accumulation in tea plants under different environmental treatments and among different varieties are investigated in this invention. CsSSCD1 Expression levels and theanine content were analyzed.
[0027] 1. Illumination duration: Three-year-old Zhongcha 108 tea seedlings were cultured for 15 days under short-day conditions (8 hours of light and 16 hours of darkness) with 1500 lux of white light. One bud and one leaf were frozen in liquid nitrogen for gene expression analysis and theanine determination.
[0028] 2. Different varieties: Using five-year-old tea trees of the same resource nursery, including Baijinya (BJY), Naibai (NB), Wuniuzao (WNZ), Longjing (LJ), and Zhongcha 108 (ZC), one bud and one leaf were frozen in liquid nitrogen for gene expression analysis and theanine determination.
[0029] 3. Different temperatures: Three-year-old Zhongcha 108 tea seedlings were cultured at 10℃ and 25℃ for 7 days respectively. One bud and one leaf were frozen in liquid nitrogen for gene expression analysis and theanine determination.
[0030] 4. Different light qualities: Three-year-old Zhongcha 108 tea seedlings were irradiated with 2000 lux white light, red light, and blue light for 7 days. One bud and one leaf were frozen in liquid nitrogen for gene expression analysis and theanine determination.
[0031] All data are expressed as mean ± standard deviation (n=3). Double asterisks indicate statistical significance. P <0.01, Student's t-test); different letters indicate significant differences between treatment groups, based on one-way ANOVA and Tukey's HSD test ( P <0.05).
[0032] 5. Gene expression analysis methods;
[0033] The analysis was performed using real-time fluorescence quantification, specifically as follows:
[0034] (1) Total RNA extraction: Approximately 100 mg of tea plant tissue samples from different treatment groups were taken, and total RNA was extracted using a commercial RNA extraction kit (such as the TIANGEN RNAprep Pure Plant Kit) according to the instructions. RNA integrity was detected by agarose gel electrophoresis, and RNA concentration and purity were determined using a NanoDrop 2000 spectrophotometer, with A260 / A280 required to be between 1.9 and 2.1.
[0035] (2) Reverse transcription to synthesize cDNA: Take 1 μg of total RNA and use a reverse transcription kit (such as the Takara PrimeScript™ RT reagent Kit) to synthesize cDNA. The reaction system and procedure should be strictly followed according to the kit instructions. The obtained cDNA sample is rinsed with RNase-free dd... Dilute 10-fold and use as a template for subsequent qRT-PCR.
[0036] (3) qRT-PCR reaction system and conditions: SYBR Green fluorescence quantitative detection kit (such as Takara TBGreen®Premix Ex Taq™II) was used.
[0037]
[0038] The amplification reaction was performed on an ABI QuantStudio™ 6 Flex real-time quantitative PCR instrument. The reaction conditions were: 95°C pre-denaturation for 30 s; followed by 40 cycles: 95°C for 5 s, 60°C for 30 s. Melting curve analysis was performed after amplification to verify the specificity of the amplified products.
[0039] (4) Primer design
[0040] The gene-specific primers used in the experiment were designed based on the target gene sequence, and the amplified fragment length was controlled between 100 and 200 bp. The reference gene was a commonly used internal control gene in tea plants (such as GAPDH or β-actin). All primers were synthesized by a professional company.
[0041] (5) Data Analysis
[0042] Use 2 ^-ΔΔ Relative expression levels were calculated using the Ct method. Three biological replicates were set up for each sample, and each replicate was performed in triplicate. Results are expressed as mean ± standard deviation. The primers used in Examples 1 and 2 are summarized in the table below:
[0043]
[0044] 6. Methods for determining amino acid content:
[0045] (1) Sample preparation: Plant tissues (tea leaves) from different treatment groups were rapidly ground into powder in liquid nitrogen. Approximately 100 mg of powder was weighed and added to pre-cooled 80% methanol solution (containing internal standards, such as L-norvaline or amino acid mixture), and thoroughly vortexed. The mixture was centrifuged at 4℃ and 12,000 rpm for 10 min, and the supernatant was collected for later use.
[0046] (2) Derivatization: Commercial amino acid analysis kits (such as AccQ-Tag, AQC derivatization reagent) or OPA / FMOC derivatization methods are used to derivatize the free amino acids in the extract to improve detection sensitivity and resolution. The reaction conditions are the same as those of the kit or classical method.
[0047] (3) Chromatography-mass spectrometry detection: After centrifugation and filtration, the supernatant of the derivatized product is subjected to ultra-high performance liquid chromatography (HPLC) analysis. The commonly used separation column is a C18 reversed-phase column, and the mobile phase is water + 0.1% formic acid (A) and acetonitrile / methanol + 0.1% formic acid (B) gradient elution. Mass spectrometry is performed using electrospray ionization (ESI), positive ion mode, and multiple reaction monitoring (MRM) for quantitative analysis.
[0048] (4) Standard curve and quantification: A standard curve was established using a mixture of amino acid standards of known concentrations. The theanine standard curve is shown in the figure below. Figure 1 The linear correlation coefficient R² should be ≥0.99. The amino acid content in the sample was calculated by comparing peak areas and correcting for internal standards, and the results are expressed in mg / g. -1 Fresh weight indicates.
[0049] (5) Data processing: Peak identification, qualitative and quantitative analysis of the obtained raw data. Exploring the differences and trends in amino acid metabolites among different treatment groups.
[0050] Under short-day treatment, the theanine content in tea plants decreased significantly, from 26.9 mg / g before treatment to 12.19 mg / g; simultaneously, CsSSCD1 The relative expression level of [a substance] increased significantly to 5.7, showing a significant negative correlation trend. Figure 2 A).
[0051] The theanine content in multiple tea varieties (such as Baijinya, Naibai, Wuniuzao, Longjing, and Zhongcha) was analyzed. CsSSCD1 After examining the expression levels, it was found that the two also showed a significant negative correlation among varieties. Figure 2 B).
[0052] Under low-temperature stress, the theanine content also decreased (from 27.1 mg / g to 24.7 mg / g), corresponding to CsSSCD1 The expression level was adjusted upward to 3.1 ( Figure 2 C);
[0053] Under different light quality treatments, both red and blue light significantly increased the accumulation of theanine, with red light treatment showing the most significant effect; meanwhile, CsSSCD1 Expression levels were significantly downregulated under both light quality conditions. Figure 2 D), further supporting its negative regulatory characteristics.
[0054] These results indicate that CsSSCD1 The expression of theanine is regulated by exogenous environmental factors such as light and temperature, and shows a negative correlation with the accumulation of theanine, which may serve as an important negative regulator of its metabolism.
[0055] Example 2 CsSSCD1 Verification of the negative regulatory effect on theanine accumulation
[0056] To further verify CsSSCD1 Whether it participates in the regulation of theanine metabolism was investigated in this study using VIGS technology and transient overexpression technology to downregulate and upregulate theanine in tea leaves. CsSSCD1 The level of expression.
[0057] 1. VIGS Silence:
[0058] (1) Vector construction: A specific fragment of approximately 200–300 bp (SEQ ID No. 20) was selected from the coding sequence (CDS) of the target gene and amplified by PCR. The amplified fragment was cloned into the multiple cloning site (EcoRI, BamHI) of the Tobacco Rattle Virus (TRV) vector pTRV2 via homologous recombination. The recombination product was verified by sequencing and used as a VIGS silencing vector. The pTRV1 vector was used as an auxiliary vector.
[0059] CsSSCD1 -VIGS-EcoRI / BamHI:
[0060] EcoRI+TCCTCAAGAGCTCCGATTGCTTCATTCAGCCTAATCTCAACAAGTTCCTGGGTCTGGGACGCCCTGCATGGAAGGAAGCTCGTGCAACAATTCAAAAGCTGCTGTCATCTACTGAACCAGCATTACGTGACAAT GCAAGTTTGAGGCAGAAAGCACTTGTGCCTATGGACAAGGTAGAAATGCTGGTTCCTATTGCAATAGGAGACTACACAGACTTCTTTTCATCCATGCATCATGCAAAGAATTGTGGGACCATATTCCGTGGACC+BamHI
[0061] (2) Agrobacterium transformation: Recombinant pTRV2 and pTRV1 were transformed into Agrobacterium strain (Agrobacterium tumefaciens GV3101) by electroporation. Positive clones were identified by antibiotic selection and colony PCR.
[0062] (3) Agrobacterium culture and mixing: Single colonies were inoculated into antibiotic-containing medium (LB medium, containing 25 mg / mL Kana) and cultured at 28°C and 200 rpm until the logarithmic growth phase. After centrifugation, the bacterial culture was collected and mixed with infection buffer (containing 10 mg / mL MgCl2). Resuspended in 10 mM MES and 200 μM acetylsylgenone, the final OD 600 Adjust to approximately 1.0. Mix equal volumes of pTRV1 and pTRV2-target gene bacterial cultures and let stand for 3 h to induce infection activity.
[0063] (4) Plant inoculation: Select tea seedlings with uniform growth and about 4-6 true leaves as materials, and use the injection method to inject the mixed Agrobacterium solution into the cotyledons or the base of the true leaves. Figure 3 The middle group was pTRV2+CsSSCD1. The control group was inoculated with a mixed culture of pTRV1 and empty vector pTRV2 ( Figure 3 (The middle group is pTRV2).
[0064] (5) Plant culture and silencing verification: After inoculation, the plants were cultured at 25℃ under 16 h light / 8 h dark conditions. After 3 weeks, the plant phenotype and silencing effect were observed. RNA was extracted from leaf samples and the expression level of the target gene was detected by real-time quantitative PCR (qRT-PCR) to verify the silencing efficiency.
[0065] 2. Construction of the overexpression system:
[0066] (1) Vector construction: The full-length fragment was obtained by PCR amplification based on the coding sequence of the target gene (CDS, SEQ ID No. 21). The amplified product was inserted into a plant binary overexpression vector (such as pCAMBIA2300) via homologous recombination and placed downstream of the 35S promoter to drive high-level transcription. The resulting recombinant plasmid was sequenced to verify that the inserted sequence was correct.
[0067] CsSSCS1 -OE-SalI / XbaI:
[0068]
[0069] (2) Agrobacterium transformation: The recombinant vector was transformed into Agrobacterium strain (LBA4404), and the transformation was completed by electroporation. Positive clones were identified by antibiotic selection and colony PCR.
[0070] (3) Agrobacterium culture and preparation: Select single colonies and inoculate them into a medium containing antibiotics (e.g., LB medium + antibiotics), and culture in a shaker at 28°C until the logarithmic growth phase. After centrifugation, collect the bacterial culture and rinse with infection buffer (10 mM MgCl2). Resuspended in 10 mM MES and 200 μM acetylsylgenone, and the OD was adjusted. 600 To approximately 0.8~1.0, for future use.
[0071] (4) Instantaneous expression
[0072] Transient expression: Fresh tea tree branches were taken, and Agrobacterium tumefaciens solution was injected into the back of the leaves using the injection method. Samples were collected and tested 3 days later. Figure 4 China is called OE-CsSSCD1 Group);
[0073] The control group was transformed with an empty vector ( Figure 4 (This is referred to as the Empty Vector group in the text).
[0074] (5) Overexpression verification: Collect the inoculated or transformed plant materials, extract RNA and perform real-time quantitative PCR (qRT-PCR) to verify whether the expression level of the target gene in the transformed plants is significantly increased.
[0075] 3. Amino acid metabolomics assay;
[0076] To explore its regulatory mechanism, further targeted amino acid metabolomics analysis was conducted. The changes in the content of glutamic acid, glutamine and tyrosine in tea leaves were analyzed. The amino acid content determination method was the same as in Example 1.
[0077] 4. Transcription level of related metabolic genes
[0078] To investigate the expression changes of key enzyme genes related to theanine and Tyr metabolism, this invention used RT-qPCR technology to analyze the transcriptional levels of related metabolic genes, specifically involving... CsGGT2 (γ-glutamyl transpeptidase) CsTS1 (Theanine synthase) CsGOGAT (Glutamate synthase) CsAlaDC (alanine decarboxylase), CsGS1.2 and CsGS1.1 (Glutamine synthase isoenzyme) CsAAAT1 (Aromatic amino acid transaminase). The gene expression analysis method is the same as in Example 1, and the primers used are shown in Table 2.
[0079] Experimental results:
[0080] The VIGS results show that (1) CsSSCD1 After silencing, the theanine content significantly increased from 15.2 mg / g DW to 34.3 mg / g DW. Figure 3 A), Hint CsSSCD1 (2) Targeted amino acid metabolomics analysis results showed that, with CsSSCD1 The relevant Tyr content decreased significantly from 0.098 mg / g DW to 0.075 mg / g DW. Figure 3 B), Hint CsSSCD1 It may indirectly affect theanine accumulation by influencing the metabolic transformation process of Tyr; the content of theanine's direct precursor Glu decreased from 1.94 mg / g DW to 1.90 mg / g DW, but not significantly. Figure 3 (C) This phenomenon may be attributed to the high basal abundance of Glu in plants, its large metabolic flux, and its strong homeostatic regulation ability, making it difficult to show significant differences at the overall level even when dynamic changes occur during transformation; however, the content of the intermediate metabolite glutamine (Gln) increased from 1.47 mg· ¹ DW decreased significantly to 0.79 mg· ¹ DW (decreased by approximately 46%) Figure 3 D), indicating that in CsSSCD1 Under silencing conditions, the metabolic and transport rates of Glu to Gln are accelerated, leading to a redistribution of nitrogen, with preferential flow to theanine synthesis pathway; (3) Changes in the expression of key enzyme genes related to theanine and Tyr metabolism showed that the expression of theanine degradation enzyme genes CsGGT2 Decreased expression level ( Figure 3 E), genes related to theanine synthesis, such as theanine synthase genes. CsTS1 ( Figure 3 F) Genes of key enzymes for ethylamine synthesis CsAlaDC ( Figure 3 G) and Glu synthase genes CsGOGAT ( Figure 3 H) was significantly upregulated; Glu degradation enzyme gene ( CsGS1.2 , CsGS1.1 () Figure 3 I and Figure 3 J) and Tyr synthesis-related enzyme genes ( CsAAAT1 () Figure 3 K) expression levels were significantly downregulated. In summary, CsSSCD1 After silencing, Tyr synthesis is suppressed, the Glu-Gln metabolic balance shifts towards theanine synthesis, the theanine synthesis is enhanced and degradation is inhibited, ultimately promoting significant accumulation of theanine in leaves.
[0081] To further verify its functionality from a reverse perspective, this invention constructs 35S:: CsSSCD1 The results of importing the transient expression vector into tea leaf pieces showed that (1) CsSSCD1 Overexpression significantly inhibited the accumulation of theanine, reducing its content from 12.1 mg / g DW to 8.7 mg / g DW. Figure 4 A); (2) Metabolomics analysis showed that the Tyr content increased significantly under overexpression treatment, from 0.41 mg / g DW to 0.47 mg / g DW, but the difference was not significant ( Figure 4 B), while the Glu content increased from 0.44 mg / g DW to 0.49 mg / g DW, but the difference was not significant. Figure 4 C), showing the opposite trend to the VIGS results; the content of the intermediate metabolite glutamine (Gln) decreased from 0.038 mg / g DW to 0.035 mg / g DW, with no significant difference. This result may be attributed to the short duration of transient overexpression treatment, the early stage of metabolic changes, and the fact that amino acids have not yet accumulated significantly; at the same time, the absolute content of amino acids such as Gln in the transient leaves is low and the metabolic flux is fast, so their fluctuations are difficult to show significant differences at the overall level; (3) Results of expression of related key enzyme genes ( Figure 4 E– Figure 4 L) shows that theanine degradation-related enzyme genes CsGGT2 Increased expression level ( Figure 4 E), theanine synthesis-related enzyme genes CsTS1, CsAlaDC , CsGOGAT Significantly lowered ( Figure 4 F, Figure 4 G and Figure 4 H), and Glu degradation-related enzyme genes CsGS1.2 , CsGS1.1 ( Figure 4 I and Figure 4 J) and Tyr synthesis key enzyme genes CsAAAT1 ( Figure 4 K) expression levels were significantly upregulated. Notably, there was a baseline difference in absolute levels between VIGS and transient expression, primarily due to treatment duration, sampling time, and methodological factors; however, both showed a high degree of agreement in their effect direction (VIGS: increased theanine content, decreased Tyr content; transient expression: decreased theanine content, increased Tyr content), jointly supporting... CsSSCD1 It has a negative regulatory effect on theanine accumulation. In summary, CsSSCD1 Overexpression of theanine inhibited the theanine synthesis pathway and enhanced the degradation pathway, thereby reducing theanine content. This showed the opposite effect to the silencing treatment, further verifying that the gene plays a negative regulatory role in theanine metabolism.
[0082] In summary, this invention proposes... CsSSCD1 -Theanine regulatory model (see Figure 5 ): CsSSCD1 It is activated in response to external environmental stimuli (such as low temperature, short daylight, blue / red light, drought). CsSSCD1 The encoded protein possesses tyrosine ammonia-lyase (FAH) activity, which accelerates the degradation of Tyr into tricarboxylic acid cycle (TCA) intermediates (such as fumarate and acetoacetate), thereby enhancing the activity of energy metabolism pathways. The increased Tyr degradation rate feeds back into enhanced upstream biosynthesis to maintain cellular homeostasis. Tyr synthesis depends on Glu for amino groups, which are catalyzed by glutamate-2-ketoglutarate aminotransferase (GOGAT), further exacerbating Glu consumption. To replenish Glu, glutamine (Gln) is converted to Glu via glutamate synthetase (GS), driving an overall increase in Glu metabolic flux. As Glu is a direct substrate for theanine synthesis, the significant diversion of Glu into the Tyr synthesis pathway restricts theanine synthesis. Simultaneously, the expression of γ-glutamyltranspeptidase (GGT) in the theanine degradation pathway is upregulated, accelerating theanine degradation and further reducing its content. Both metabolomics and transcriptomics results support this mechanism pathway. CsSSCD1 Through a cascade of regulation—"enhancing Tyr degradation → increasing Tyr synthesis flux → activating Gln–Glu metabolism → inhibiting theanine synthesis and enhancing its degradation"—a negative feedback mechanism is formed, thereby reducing the overall accumulation level of theanine.
[0083] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. CsSSCD1 The application of genes in regulating the accumulation of theanine in tea plants is characterized by, The CsSSCD1 The nucleotide sequence is shown in SEQ ID No.
1.
2. The application as described in claim 1, characterized in that, Using the CsSSCD1 The method to enhance the accumulation of theanine in tea trees through gene therapy is as follows: CsSSCD1 The silencing of theanine enhances its synthesis and inhibits its degradation, thereby increasing the accumulation of theanine.
3. The application as described in claim 1, characterized in that, Using the CsSSCD1 The method to inhibit the accumulation of theanine in tea trees through gene therapy is as follows: CsSSCD1 Overexpression of the compound enhances the synthesis and degradation pathways of tyrosine, activates glutamate metabolism, inhibits the synthesis pathway of theanine and promotes the degradation of theanine, thereby inhibiting the accumulation of theanine.
Citation Information
Patent Citations
Application of CsSPX3 and CsPHL7 genes in regulation and control of theanine synthesis of tea trees and improvement of tea quality of tea trees
CN118853743A