Method for constructing mouse obesity model and application thereof

By specifically knocking out the C9 complement gene in mice, a spontaneous obesity model was constructed, which solved the problems of model instability and large differences from human obesity in existing technologies. It achieved a stable phenotype of spontaneous obesity under normal diet, which is suitable for obesity research and drug screening.

CN121320460BActive Publication Date: 2026-04-17WEIFANG MEDICAL UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
WEIFANG MEDICAL UNIV
Filing Date
2025-12-16
Publication Date
2026-04-17

AI Technical Summary

Technical Problem

Existing animal models of obesity suffer from problems such as long modeling cycles, large individual differences, significant differences from human obesity, or serious complications. There is a lack of stable and novel spontaneous obesity animal models that closely resemble the pathophysiological process of human obesity.

Method used

By specifically knocking out the complement C9 gene in mice, and using TALEN gene editing technology to target and delete the first exon of the C9 genome, a spontaneous obesity model in mice was constructed. This involved injecting C9 TALEN mRNA into mouse fertilized eggs and transplanting them into pseudopregnant female mice to obtain F0 generation chimeric mice, which were then further hybridized to obtain homozygous mice.

Benefits of technology

The constructed model exhibits spontaneous obesity under normal dietary conditions, has a stable phenotype, avoids interference from high-fat diets, is suitable for obesity research and drug screening, has a flexible time window and broad application value, and can be used to study obesity and its metabolic complications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121320460B_ABST
    Figure CN121320460B_ABST
Patent Text Reader

Abstract

This invention provides a method for constructing a mouse obesity model and its application, relating to the fields of biotechnology and medical animal model technology. This invention is the first to discover and confirm complement. C9 Genetic defects can lead to spontaneous obesity in mice, and based on this, a novel method for constructing an animal model of obesity has been developed. The model constructed using this method exhibits spontaneous obesity even under a normal diet, avoiding the interference of a forced high-fat diet. Under a high-fat diet, the obesity phenotype is accelerated and exacerbated, providing a flexible time window and a stronger phenotype for research. The model constructed using this method can not only be used for obesity research but also extended to the study of its entire spectrum of metabolic complications and the construction of an efficient drug screening platform, possessing significant scientific and commercial value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of biotechnology and medical animal model technology, and in particular to a method for constructing a mouse obesity model and its application. Background Technology

[0002] With rising economic levels, obesity has become a major global public health problem and a significant risk factor for type 2 diabetes, cardiovascular disease, non-alcoholic fatty liver disease, and various cancers. In-depth research into the pathogenesis of obesity and the development of effective preventative and therapeutic drugs are crucial, and this relies heavily on animal models that can mimic the human obesity disease process.

[0003] Currently, commonly used animal models of obesity mainly include: 1) Diet-induced obesity (DIO) models: These models induce weight gain in animals through long-term feeding of a high-fat diet. The disadvantages of this model are its long modeling period, significant individual variability, and its primary focus on simulating exogenous obesity, which differs from the complex genetic and metabolic factors involved in human obesity. 2) Genetic defect models: Such as ob / ob (Leptin-deficient) and db / db (Leptin receptor-deficient) mice. These models exhibit significant obesity phenotypes, but represent extreme single-gene mutations, which do not align with the polygenic, low-efficacy characteristics of most human obesity models. Furthermore, they are often accompanied by severe complications such as diabetes, limiting their application.

[0004] Therefore, there is an urgent need in this field for a new type of spontaneous obesity animal model that has a short modeling cycle, stable phenotype, and is closer to the pathophysiological process of human obesity.

[0005] In view of this, the present invention is hereby proposed. Summary of the Invention

[0006] One of the objectives of this invention is to provide a method and application for constructing a mouse obesity model, so as to at least solve one of the technical problems existing in the prior art.

[0007] In order to achieve the above-mentioned objectives of the present invention, the following technical solution is adopted:

[0008] This invention provides a method for constructing a mouse obesity model, comprising: specifically knocking out complement in mice. C9 Genes, and / or, reducing or inhibiting complement in mice C9 The expression levels of the genes were used to obtain the spontaneous obesity model in mice.

[0009] Furthermore, through targeted deletion C9 The first exon of the genome enables complement. C9 Gene-specific knockout.

[0010] Furthermore, using TALEN gene editing technology, targeted deletion... C9 The first exon of the genome.

[0011] Furthermore, through C9 TALEN mRNA targeted deletion C9 The first exon of the genome, described C9 TALEN mRNA has the nucleotide sequence shown in SEQ ID NO1.

[0012] Furthermore, the aforementioned C9 TALEN mRNA was injected into mouse fertilized eggs and then transplanted into pseudopregnant mice to obtain F0 generation chimeric mice.

[0013] Furthermore, it also includes crossing the F0 generation chimeric mice with wild-type mice to obtain F1 generation heterozygous mice, and then crossing the F1 generation heterozygous mice with each other to obtain complement. C9 Gene knockout homozygous mice.

[0014] Furthermore, the obesity includes spontaneous obesity.

[0015] The present invention also provides the application of the mouse obesity model constructed by the above method in the development and / or screening and / or preparation of products for the prevention and / or relief and / or treatment of obesity;

[0016] Preferably, the product includes a drug;

[0017] Preferably, the obesity includes spontaneous obesity.

[0018] This invention also provides the application of the mouse obesity model constructed using the above method in the study of obesity pathogenesis and / or obesity-related metabolic diseases;

[0019] Preferably, the obesity-related metabolic diseases include insulin resistance, type II diabetes, and non-alcoholic fatty liver disease;

[0020] Preferably, the obesity includes spontaneous obesity.

[0021] Furthermore, this invention also provides a mouse obesity model constructed using the above method for studying complement. C9 Applications in gene function;

[0022] Preferably, the functions include energy metabolism, lipid synthesis, and lipid breakdown.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] 1. Pioneering: The first discovery and confirmation of complement. C9 Genetic defects can lead to spontaneous obesity in mice, and based on this, a novel method for constructing an animal model of obesity has been developed.

[0025] 2. Spontaneous obesity with stable phenotype: The model constructed by this method can develop spontaneous obesity under normal diet, avoiding the interference of forced high-fat diet; the obesity phenotype is accelerated and aggravated under high-fat diet, providing a flexible time window and stronger phenotype for research.

[0026] 3. Wide range of applications: The model constructed using this method can not only be used for obesity research, but also extended to the study of its full spectrum of metabolic complications, as well as the construction of an efficient drug screening platform, which has significant scientific and commercial value. Attached Figure Description

[0027] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0028] Figure 1 Knockout in Embodiment 1 of the present invention C9 Mouse genotype identification results; where A represents the targeted deletion mouse. C9 The first exon of a gene C9 A. Schematic diagram of TALEN mRNA design; B. Result of genotyping of mouse tail DNA by PCR; C. Result of genotyping of liver DNA by PCR; D. Sequencing results of ligating purified RT-PCR product into pMD-18T vector; E. Result of Western blot detection.

[0029] Figure 2 This is a schematic diagram of mouse weight changes in Example 2 of the present invention; wherein, A is a Western blot detection result; B is a knockout result under normal dietary conditions. C9 Figure 1 shows the weight gain curve of mice after gene therapy; C represents mice knocked out under normal dietary conditions. C9 Figure 1 shows the weight gain curve of mice after gene therapy; D is the appearance of male mice under normal dietary conditions.

[0030] Figure 3 This is a schematic diagram of mouse fat and liver weight in Example 2 of the present invention; where A represents the weight under normal dietary conditions. C9 - / - eWAT results for mice; B represents results under normal dietary conditions. C9 - / - sWAT results of mice; C represents normal dietary conditions. C9 - / - pWAT results for mice; D represents... C9- / - White adipose tissue weight results for mice; E represents... C9 - / - Results of fat body ratio in mice; F represents... C9 - / - Results of mouse liver weight; G represents... C9 - / - Results of liver-to-body ratio in mice;

[0031] Figure 4 These are images showing the morphological observations of mouse fat and liver in Example 2 of this invention; where A represents the condition under normal dietary conditions. C9 - / - Results of eWAT adipocyte size in mice; B represents the size under normal dietary conditions. C9 - / - Results of sWAT adipocyte size in mice; C: Results of Oil Red O staining; D: Results of total triglyceride content in liver; E: Results of total cholesterol content in liver;

[0032] Figure 5 This is a schematic diagram of mouse weight changes in Example 3 of the present invention; wherein, A is a diagram of mouse feeding strategy; B is a diagram of Western blot detection results; C is a diagram of mouse knockout under high-fat diet conditions. C9 Genetic weight gain curve in mice; D is the appearance of male mice under high-fat diet conditions;

[0033] Figure 6 This is a schematic diagram of mouse fat and liver weight in Example 3 of the present invention; where A represents the weight under a high-fat diet. C9 - / - eWAT results for mice; B represents results under high-fat diet conditions. C9 - / - sWAT results of mice; C represents the results under high-fat diet conditions. C9 - / - pWAT results for mice; D represents... C9 - / - White adipose tissue weight results for mice; E represents... C9 - / - Results of fat body ratio in mice; F represents... C9 - / - Results of mouse liver weight; G represents... C9 - / - Results of liver-to-body ratio in mice;

[0034] Figure 7 These are images showing the morphological observations of mouse fat and liver in Example 3 of this invention; where A represents the condition under a high-fat diet. C9 - / - Results of eWAT adipocyte size in mice; B represents the size under high-fat diet conditions. C9 - / - Results of sWAT adipocyte size in mice; C: Results of Oil Red O staining; D: Results of total triglyceride content in liver; E: Results of total cholesterol content in liver. Detailed Implementation

[0035] Unless otherwise defined herein, the scientific and technical terms used in conjunction with this invention shall have the meanings commonly understood by one of ordinary skill in the art. The meaning and scope of terms shall be clear; however, in any case of potential ambiguity, the definitions provided herein shall prevail over any dictionary or foreign definitions. In this application, unless otherwise stated, the use of "or" means "and / or". Furthermore, the use of the term "comprising" and other forms is non-limiting.

[0036] Generally, the nomenclature and techniques used in cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization, together with those described herein, are those well-known and commonly used in the art. Unless otherwise stated, the methods and techniques of the present invention are generally carried out according to conventional methods well-known in the art and described in various general and more specific references, which are cited and discussed throughout this specification. Enzymatic reactions and purification techniques are carried out according to the manufacturer's instructions, as commonly practiced in the art, or as described herein. The nomenclature, laboratory procedures, and techniques used in analytical chemistry, synthetic organic chemistry, and medical and medicinal chemistry, together with those described herein, are those well-known and commonly used in the art.

[0037] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0038] C9 It is a key component of the complement system membrane attack complex (MAC). In recent years, numerous studies have shown that the complement system, particularly the MAC, plays a crucial role in low-grade chronic inflammation and metabolic regulation. Chronic inflammation is the core pathological basis of obesity and related metabolic diseases such as insulin resistance, type 2 diabetes, and non-alcoholic fatty liver disease. However, current techniques lack animal models for complement analysis. C9 Effects on lipid metabolism and obesity in mice. Based on this, according to a first aspect of the present invention, a method for constructing a mouse obesity model is provided, comprising: specifically knocking out complement in mice. C9 Genes, and / or, reducing or inhibiting complement in mice C9 The expression levels of the genes were used to obtain the spontaneous obesity model in mice.

[0039] This invention is the first to discover and confirm complement. C9Genetic defects can lead to spontaneous obesity in mice, and based on this, a novel method for constructing an animal model of obesity has been developed. The model constructed using this method exhibits spontaneous obesity even under a normal diet, avoiding the interference of a forced high-fat diet. Under a high-fat diet, the obesity phenotype is accelerated and exacerbated, providing a flexible time window and a stronger phenotype for research. The model constructed using this method can not only be used for obesity research but also extended to the study of its entire spectrum of metabolic complications and the construction of an efficient drug screening platform, possessing significant scientific and commercial value.

[0040] In some preferred embodiments, targeted deletion C9 The first exon of the genome enables complement. C9 Gene-specific knockout.

[0041] C9 The first exon of the genome encodes the mouse. C9 The protein's signal peptide, through deletion of the first exon, represses... C9 The secretion of proteins achieves complete functional inactivation, rather than just the deletion of DNA fragments. At the same time, the deletion of the start exon greatly increases the probability of obtaining invalid alleles, thus improving the reliability of the model.

[0042] Gene editing techniques conventional in this field can be used to delete... C9 The first exon of the genome, for example, CRISPR / Cas9 gene editing technology, TALEN gene editing technology, or ZFN gene editing technology. In some preferred embodiments, TALEN gene editing technology is used to target and delete... C9 The first exon of the genome.

[0043] This invention uses TALEN technology to target and delete complement in mice. C9 The first exon of a gene can efficiently and specifically achieve gene function loss, thereby establishing a stable spontaneous obesity mouse model.

[0044] In some preferred embodiments, by C9 TALEN mRNA targeted deletion C9 The first exon of the genome, described C9 The TALEN mRNA has the nucleotide sequence shown in SEQ ID NO1.

[0045] In some preferred embodiments, the C9 TALEN mRNA was injected into mouse zygotes and then transplanted into pseudopregnant mice to obtain F0 generation chimeric mice. These F0 generation chimeric mice were crossed with wild-type mice to obtain F1 generation heterozygous mice. Complement was obtained by crossing these F1 generation heterozygous mice with each other.C9 Gene knockout homozygous mice.

[0046] This invention will... C9 Specific TALEN mRNA was microinjected into mouse zygotes and transplanted into pseudopregnant mice, enabling efficient gene editing during early embryonic development. The resulting F0 generation chimeric mice, after mating with wild-type mice, stably produced genes carrying TALEN mRNA. C9 Heterozygous F1 mice with gene mutations are then used to breed homozygous knockout mice. This method is not only mature and efficient, but also avoids the risk of exogenous DNA integration, which is beneficial for constructing animal models with clear genetic backgrounds and stable phenotypes, providing a reliable technical foundation for subsequent research on obesity mechanisms and drug screening.

[0047] In some preferred embodiments, the obesity includes spontaneous obesity.

[0048] According to a second aspect of the invention, the use of a mouse obesity model constructed using the above-described method in the development and / or screening and / or preparation of products for the prevention and / or relief and / or treatment of obesity is also provided.

[0049] The complement provided by the present invention C9 Gene-deficient mouse models can spontaneously develop obesity under normal dietary conditions, exhibiting stable phenotypes and good reproducibility, making them ideal as in vivo screening platforms for evaluating products for the prevention or treatment of obesity. By administering test substances and monitoring changes in body weight, the degree of adipose tissue accumulation, and related metabolic indicators, their efficacy can be rapidly and accurately evaluated. This application not only expands the practical value of this model but also provides a novel animal model tool for the development of new anti-obesity drugs.

[0050] Preferably, the product includes a drug.

[0051] According to a third aspect of the present invention, the application of the mouse obesity model constructed using the above method in the study of obesity pathogenesis and / or obesity-related metabolic diseases is also provided.

[0052] The complement provided by the present invention C9 The gene-deficient mouse model not only exhibits a significant spontaneous obesity phenotype, but more importantly, it provides a novel animal model tool for studying the pathogenesis of obesity and related metabolic diseases. Because... C9 The specific loss of genes directly affects the body's energy metabolism homeostasis. This model can be used to explore the role of the complement system in processes such as adipose tissue inflammation, insulin resistance, and liver lipid deposition, filling the research gap in the field of "immune-metabolic" interaction regulation.

[0053] Preferably, the obesity-related metabolic diseases include insulin resistance, type II diabetes, and non-alcoholic fatty liver disease.

[0054] According to a fourth aspect of the present invention, a mouse obesity model constructed using the above-described method is also provided for the study of complement. C9 Applications in gene function.

[0055] Preferably, the functions include energy metabolism, lipid synthesis, and lipid breakdown.

[0056] The present invention will be further illustrated by the following examples. Unless otherwise specified, the materials in the examples are prepared according to existing methods or purchased directly from the market.

[0057] Example 1 Complement C9 Construction and reproduction of gene knockout mice

[0058] Design targeted deletion mice C9 The first exon of a gene C9 TALEN mRNA, design scheme as attached. Figure 1 As shown in A in the diagram.

[0059] Two effective methods were selected. C9 TALEN mRNA (SEQ ID NO.1: TTGGGTGTCAATGCACAGATGCCAATACC, SEQ ID NO.2: TCAATGCACAGATGCCAATACCCGTTTCCAGGTG) was injected into the fertilized eggs of C57BL / 6 mice and transplanted into pseudopregnant female mice to obtain F0 generation chimeric mice. F0 generation mice were then mated with wild-type C57BL / 6 mice to obtain F1 generation heterozygous mice. C9 + / -). The F1 generation heterozygous mice ( C9 + / - crosses produce homozygotes. C9 - / -) Knockout mice, heterozygotes ( C9 + / -) mice and wild-type ( C9 + / + mice. Genotyping of tail and liver DNA was performed by PCR (SEQ ID NO.3: F: 5'-CCATCACCTTAGCCCTTGCCATCT-3', SEQ ID NO.4: R: 5'-CTTAACCTTTATTGTCCCTACTTTG-3'). PCR reaction conditions were as follows:

[0060]

[0061] The expected DNA product size for wild-type (C9+ / +) mice was 160 bp, while the expected DNA product sizes for homozygous (C9- / -) mice were 126 bp (-34 bp) and 131 bp (-29 bp), respectively. Results are attached. Figure 1 As shown in B, lanes 1 and 2 are 160bp, representing wild-type mice. C9 + / +) mice; lane 3 shows 126bp (-34), lane 4 shows 131bp (-29), representing homozygous mice. C9 - / -) Knockout mice; Lane 5 has two bands of 126bp and 160bp, and Lane 6 has two bands of 131bp and 160bp, representing mice that are heterozygous ( C9 + / -) mice.

[0062] RNA was extracted from liver tissue and amplified using RT-PCR (SEQ ID NO.5: F: 5'-GTCCTCCGGCTGCAAAGGAATGC-3', SEQ ID NO.6: R: 5'-GTCTATCGGTATGGGATAGTT-3'). See attached... Figure 1 As shown in C, lanes 1 and 2 are 160bp, representing wild-type mice. C9 + / +) mice, lane 3 126bp (-34), lane 4 131bp (-29), representing homozygous mice. C9 - / -) Knockout mice. (Attached) Figure 1 In step D, the purified RT-PCR product was ligated into the pMD-18T vector for sequencing to identify the genotype. The top layer shows WT mice, the lower left image shows (-29) mice, and the lower right image shows (-34) mice; the boxes contain the deleted sequences. (Appendix) Figure 1 Western blot analysis showed that E was detectable in both serum and liver in lanes 1 and 3. C9 Protein, representing wild-type mice ( C9 + / + mice; lane 2 mice were -34 mice, and lane 4 mice were -29 mice. No detectable antibodies were found in the serum or liver of either mouse type. C9 Protein, representing mice that are homozygous ( C9 - / -) Knockout mice.

[0063] Example 2: Verification of spontaneous obesity phenotype under normal diet

[0064] Select 3-week-old males and females C9 - / - mice (-34) and C9 + / + (WT) mice were fed a standard maintenance diet (10% fat for energy). Body weight was measured weekly. Figure 2Western blot analysis showed that lanes 1-3 were detectable in the epididymal adipose tissue. C9 Protein, representing wild-type mice ( C9 + / + mice; lanes 4-6 were (-34) mice, and no detectable contamination was observed in the epididymal adipose tissue of the mice. C9 Protein, representing mice that are homozygous ( C9 - / -) Knockout mice. (Attached) Figure 2 Figures B and C show that under normal dietary conditions, regardless of whether the mouse is female or male, knockout... C9 All genes resulted in a significantly higher weight gain curve in the mice compared to the WT group. (See attached image) Figure 2 D in the figure shows the appearance of a male mouse under normal dietary conditions.

[0065] Six-month-old male mice (-34) were selected, and epididymal white fat (eWAT), subcutaneous white fat (sWAT), perirenal white fat (pWAT), and brown fat (BAT) were isolated and weighed. The results are attached. Figure 3 As shown in AC, under normal dietary conditions, C9 The eWAT, sWAT, and pWAT levels in the mice were significantly higher than those in the WT control group, but there was no significant difference in brown adipose tissue weight. Figure 3 The D and E displays, C9 The white adipose tissue weight of the mice was significantly higher than that of the WT control group, and the fat-to-body ratio was also significantly increased. Figure 3 The F and G displays, C9 The liver weight of the mice was significantly higher than that of the WT control group, but the liver-to-body ratio was not significantly different. Figure 4 Figures A and B show that under normal dietary conditions, C9 The eWAT and sWAT adipocytes of the mice were significantly larger than those of the WT control group, but there was no significant difference in the size of brown adipocytes. Figure 4 The C values, as shown by Oil Red O staining, indicate that under normal dietary conditions, C9 - / - Increased lipid deposition in the liver of mice. (See attached image) Figure 4 The results showed that the total triglyceride and cholesterol levels in the liver were significantly higher than those in the WT control group.

[0066] Example 3: Accelerated Validation of Obesity Phenotype under High-Fat Diet Conditions

[0067] Males aged 4 weeks were selected. C9 - / - mice (-34) and C9 Seven + / + (WT) mice were fed a normal high-fat diet (HFD, 60% fat for energy). Weight was recorded weekly. (See attached image) Figure 5 Figure A illustrates the feeding strategy for mice. (Attached) Figure 5Western blot analysis showed that lanes 1-4 were detectable in the epididymal adipose tissue. C9 Protein, representing wild-type mice ( C9 + / + mice; lanes 5-8 were (-34) mice, and no detectable contamination was found in the epididymal adipose tissue of the mice. C9 Protein, representing mice that are homozygous ( C9 - / -) Knockout mice. (Attached) Figure 5 The C-value in the data shows that, under high-fat diet conditions, knockout C9 The gene caused a significantly higher weight gain curve in the mice compared to the WT group. (See attached image) Figure 5 D in the figure shows the appearance of male mice under high-fat diet conditions.

[0068] After 8 weeks of feeding a high-fat diet (i.e., at 12 weeks of age), the mice were sacrificed, and the weight of each adipose tissue was measured as in Example 2. The results are attached. Figure 6 As shown in AC, under high-fat diet conditions, C9 The eWAT, sWAT, and pWAT levels in the mice were significantly higher than those in the WT control group, but there was no significant difference in brown adipose tissue weight. Figure 6 The D and E displays, C9 The white adipose tissue weight of the mice was significantly higher than that of the WT control group, and the fat-to-body ratio was also significantly increased. Figure 6 The F and G displays, C9 The liver weight of the mice was significantly higher than that of the WT control group, and the liver-to-body ratio also differed significantly between the two groups. Figure 7 Figures A and B show that under a high-fat diet, C9 The eWAT and sWAT adipocytes of the mice were significantly larger than those of the WT control group, but there was no significant difference in the size of brown adipocytes. Figure 7 Oil Red O staining showed that C under high-fat diet conditions, C9 - / - Increased lipid deposition in the liver of mice. (See attached image) Figure 7 The results showed that the total triglyceride and cholesterol levels in the liver were significantly higher than those in the WT control group, consistent with the trend observed in mice on a normal diet.

[0069] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for constructing a mouse obesity model, characterized in that, include: Complement specific knock-out mice C9 genes, resulting in an obese mouse model.

2. The method according to claim 1, characterized in that, Targeted deletion C9 The first exon of a gene enables complement. C9 Gene-specific knockout.

3. The method according to claim 2, characterized in that, Using TALEN gene editing technology, targeted deletion C9 The first exon of a gene.

4. The method according to claim 3, characterized in that, Will C9 TALEN mRNA was injected into mouse zygotes and then transplanted into pseudopregnant mice to obtain F0 generation chimeric mice. These F0 generation chimeric mice were then crossed with wild-type mice to obtain F1 generation heterozygous mice. Complement was obtained by crossing these F1 generation heterozygous mice with each other. C9 Homozygous mice with gene knockout.

5. The method according to any one of claims 1-4, characterized in that, The obesity mentioned includes spontaneous obesity.

6. The application of a mouse obesity model in the development and / or screening of products for alleviating and / or treating obesity, characterized in that, The mouse obesity model is a mouse obesity model constructed using the method described in any one of claims 1-5; The products include pharmaceuticals; The obesity mentioned includes spontaneous obesity.

7. The application of a mouse obesity model in studying the pathogenesis of obesity and / or obesity-related metabolic diseases, characterized in that, The mouse obesity model is a mouse obesity model constructed using the method described in any one of claims 1-5; The obesity-related metabolic diseases include type II diabetes and non-alcoholic fatty liver disease; The obesity mentioned includes spontaneous obesity.

8. Mouse obesity model in complement research C9 Its application in gene function is characterized by, The mouse obesity model is a mouse obesity model constructed using the method described in any one of claims 1-5.

Citation Information

Patent Citations

  • Methods For Treating Conditions Associated With Masp-2 Dependent Complement Activation

    CN104721824A

  • Application of protein marker of multiple sclerosis

    CN107436320A