Primer, probe, method and kit for detecting Sf-RVN cell DNA residual quantity

By extracting DNA using specific primers and probes combined with magnetic beads and performing real-time quantitative PCR, the accuracy and sensitivity issues of detecting residual DNA in Sf-RVN cells were resolved. This enabled efficient detection of residual DNA in recombinant influenza virus HA protein products, meeting drug safety standards.

CN121320564APending Publication Date: 2026-01-13CHANGCHUN INST OF BIOLOGICAL PRODS
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511716393.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-21
Publication Date
2026-01-13

AI Technical Summary

Technical Problem

Existing technologies are insufficient for the stable, sensitive, accurate, and rapid detection of residual Sf-RVN cell DNA. In particular, the coexistence of baculovirus genome and host DNA in influenza virus recombinant HA protein products leads to the risk of false positives and fails to meet stringent drug safety standards.

Method used

Using primers and probes specifically targeting Sf-RVN cells, DNA was extracted using the magnetic bead method and real-time quantitative PCR was performed. A standard curve was prepared using Sf-RVN cell genomic DNA to achieve efficient detection of residual DNA in Sf-RVN cells.

Benefits of technology

It achieves stable, sensitive, and accurate detection of residual DNA in Sf-RVN cells, with a detection limit of 0.03 pg/μL, meeting pharmaceutical safety standards. The amplification efficiency is as high as 94%, making it suitable for influenza vaccine production and providing safety assurance for biological products.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121320564A_ABST
    Figure CN121320564A_ABST
Patent Text Reader

Abstract

The invention relates to a primer, a probe, a method and a kit for detecting Sf-RVN cell DNA residual quantity, and belongs to the technical field of gene detection. The invention discloses primers and a probe for detecting the residual quantity of Sf-RVN cell DNA (deoxyribonucleic acid). The primers comprise an upstream primer and a downstream primer; the sequence of the upstream primer is as shown in SEQ ID NO: 1; the sequence of the downstream primer is as shown in SEQ ID NO: 2; the sequence of the probe is as shown in SEQ ID NO: 3. The primer and the probe can stably, accurately, quickly, sensitively and specifically detect the residual quantity of the Sf-RVN cell DNA, and can be applied to quantitative detection of the residual quantity of the host insect cell Sf-RVN cell DNA in an intermediate process sample, a semi-finished product and a finished product of an influenza virus recombinant HA protein product produced by an insect cell-baculovirus expression system.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of gene detection, and particularly relates to a primer, a probe, a method and a kit for detecting residual DNA of Sf-RVN cells. BACKGROUND

[0002] Host cell DNA residual refers to the DNA fragments from host cells that may exist in biological products. The host cell DNA residual of biological products produced by passaged cell strains may transmit tumor or virus-related genes, which is potentially dangerous. Insect baculovirus expression system has been widely used in the production of higher eukaryotic proteins. It is a production system that uses recombinant viruses carrying foreign target genes as carriers to express in insects or cultured cells. Insect cells (such as Spodoptera frugiperda 9, Sf9) are widely used for the expression of recombinant proteins, and Sf-RVN cell line is a rhabdovirus-negative Sf9 cell line. In most cases, recombinant proteins are processed, modified and transported to the appropriate location in the cell to obtain the desired biological activity. In the production process using baculovirus-insect expression system, the recombinant biological products are inevitably contaminated by genomic DNA from insect cells, which poses a safety risk. Therefore, establishing a suitable host cell DNA residual detection method helps to monitor the production process to evaluate the safety of the product, so as to better ensure the safety and quality of biological products.

[0003] The host cell DNA residual amount is strictly limited by drug supervision and management institutions in various countries. The current guidelines of WHO and the US FDA recommend that the residual DNA in the finished product should not be higher than 10 ng / dose, and the length should not be greater than 200 bp. The guidelines issued by the US FDA indicate that the residual limit of host cell DNA in biological products is 100 pg / dose. For large-dose biological products such as monoclonal antibodies, the residual amount of DNA can be relaxed to 10 ng / dose according to the source of residual DNA and the administration route. The residual DNA limit of biological products specified in the general rules of the European Pharmacopoeia is mostly not more than 10 ng / dose, but the residual DNA limit of individual vaccines is more stringent, such as the DNA residual amount in inactivated hepatitis A vaccine should not exceed 100 pg / dose, and the DNA residual amount in hepatitis B vaccine should not exceed 10 pg / dose. The domestic limit standard for residual DNA: the Chinese Pharmacopoeia 2020 edition part three stipulates that the DNA residual amount of biological products produced by cell matrix should not exceed 100 pg / dose, and the DNA residual amount of vaccines produced by bacterial or fungal matrix should not exceed 10 ng / dose. In addition, FDA also suggests that the detection method for residual DNA should be sensitive to at least 10 pg / dose.

[0004] The Pharmacopoeia of various countries also provides several classic detection methods. The detection methods for host cell DNA residue recorded in the 2020 edition of the Pharmacopoeia of China include DNA probe hybridization, fluorescence staining and quantitative PCR. The USP40-NF35 general chapter 1130 of the United States Pharmacopoeia 2017 edition introduces three methods for detecting exogenous DNA residue, namely DNA probe hybridization, threshold method and real-time quantitative PCR. The European Pharmacopoeia proposes two sensitive analysis methods for quantifying host cell residual DNA, namely real-time quantitative PCR and immunoenzyme method. Among them, the quantitative PCR method has strong sequence specificity, high sensitivity (fg level) and good reproducibility, and is recommended by the Pharmacopoeia of China, the United States Pharmacopoeia and the European Pharmacopoeia.

[0005] There is an urgent need in the art for a method and reagent capable of stably, sensitively, accurately and rapidly detecting the residual amount of Sf-RVN cell DNA. SUMMARY

[0006] The present application provides a primer, a probe, a method and a kit for detecting the residual amount of Sf-RVN cell DNA. The primer and the probe of the present application can stably, accurately, rapidly, sensitively and specifically detect the residual amount of Sf-RVN cell DNA.

[0007] The first object of the present application is to provide a primer and a probe for detecting the residual amount of Sf-RVN cell DNA, wherein the primer comprises an upstream primer and a downstream primer. The sequence of the upstream primer (F1) is 5'-TCTCGATCCTGCACACTATG-3'(SEQ ID NO: 1). The sequence of the downstream primer (R1) is 5'-AACACCCGTGTAAAGGAGCA-3'(SEQ ID NO: 2). The sequence of the probe (Probe) is 5'-TGGCGTCCCAACTTAAACCAGGTGA-3'(SEQ ID NO: 3).

[0008] Further, the 5' end of the probe is modified with a fluorescent reporter group FAM, and the 3' end is modified with a fluorescent quencher group BHQ1.

[0009] Further, the amount-of-substance ratio of the upstream primer, the downstream primer and the probe is 2:2:1.

[0010] The second object of the present application is to provide a method for detecting the residual amount of Sf-RVN cell DNA using the above primer and probe.

[0011] Further comprising the following steps: extracting DNA of the sample to be tested as a template, then using the upstream primer, the downstream primer and the probe to prepare a real-time fluorescent quantitative PCR reaction system and perform real-time fluorescent quantitative PCR reaction, and finally calculating the residual amount of Sf-RVN cell DNA in the sample to be tested according to the standard curve.

[0012] Further, the real-time fluorescent quantitative PCR reaction system, in 20 μL, is as follows: 2 × Taq Pro HS U + Probe Master Mix 10 μL 50 × ROX buffer 0.4 μL Upstream primer, concentration 10 μM 0.4 μL Downstream primer, concentration 10 μM 0.4 μL Probe, concentration 10 μM 0.2 μL Template 1 μL RNase free water to 20 μL.

[0013] Further, the real-time fluorescent quantitative PCR reaction program is as follows: First step: 37℃ 2min; Second step: 95℃ 30sec; 1 cycle; Third step: 95℃ 10sec, 60℃ 30sec, 45 cycles.

[0014] Further, the DNA of the sample to be tested is extracted by the magnetic bead method.

[0015] Further, the standard curve is established by the following method: The positive quantitative standard of Sf-RVN cells is diluted by 10 times gradient, and the diluted positive quantitative standard of Sf-RVN cells is subjected to real-time fluorescent quantitative PCR reaction, the concentration of the positive quantitative standard of Sf-RVN cells of different concentrations is taken as the abscissa, and the measured CT value is taken as the ordinate, and a standard curve is established; The reaction system and reaction program of the real-time fluorescent quantitative PCR reaction of the diluted positive quantitative standard of Sf-RVN cells are the same as those of the real-time fluorescent quantitative PCR reaction of the DNA of the sample to be tested; Still further, the positive quantitative standard of Sf-RVN cells is prepared from SF-RVN cell genomic DNA, and the Sf-RVN cell genome is a complete genome.

[0016] Further, the sample to be tested is an influenza virus recombinant HA protein product produced by Sf-RVN cells.

[0017] A third object of the present application is to provide a kit for detecting the residual amount of Sf-RVN cell DNA, which contains the above-mentioned primer and probe.

[0018] Further, the kit further comprises one or more of a real-time fluorescent quantitative PCR reaction system, a negative control product, a negative quality control product, and a positive quantitative standard product of Sf-RVN cells; The amplification sequence of the positive quantitative standard product of the SF-RVN cells is: TCTCGATCCTGCACACTATGTAAGTTCACCTGGTTTAAGTTGGGACGCCATGCTCCTTTACACGGGTGTT (SEQ ID NO: 4).

[0019] The principle of the present application is that the total DNA in the sample to be tested is extracted by the method of magnetic bead extraction of DNA, real-time quantitative PCR is performed by using the primer and probe specifically targeting the genome of Sf-RVN cells, and the standard curve is drawn by using the genomic DNA of Sf-RVN cells as a standard product, so as to detect and quantify the residual amount of Sf-RVN cell DNA.

[0020] In the prior art, a conserved gene (such as 18S rRNA) is generally targeted, such a gene has a high copy number in insect cells, the sequence is conserved, the design difficulty is low, and the risk of non-specific amplification is easy to cause. The present application first targets a specific gene fragment (GenBank KY042019.1) of Sf-RVN cells, the sequence is an unknown function gene, and has no homology with the baculovirus genome and the target gene (influenza virus HA). Through repeated screening and verification, the primer and probe combination (sequence table SEQ ID NO: 1-3) with absolute specificity to Sf-RVN genomic DNA is finally obtained, and the cross reaction of coexisting baculovirus DNA, vector genes and mammalian cells (such as MDCK) in the baculovirus system is successfully avoided.

[0021] The present application specially solves the detection problem of influenza virus recombinant HA protein products, and there are a large amount of baculovirus genome, HA gene fragment and host protein interference in the production process of influenza virus recombinant HA protein products; The HA gene and the host DNA residue coexist, if the conserved region (such as 18S rRNA) is targeted, false positive is easy to be caused due to homologous sequences (such as CHO cell 18S rRNA has high homology with human, and the risk has been reported). The present application realizes 100% specific detection in the HA protein product through the unique target sequence design, and the sensitivity reaches 0.03 pg / μL, which is more than 30 times higher than the prior art, and meets the strict requirements of WHO / FDA on vaccine products ≤10 pg / dose.

[0022] The present application firstly realizes a wide linear range of 3000 pg / muL to 0.03 pg / muL and an amplification efficiency of more than 94% in the HA protein preparation, and the recovery rate is stable, which provides a key guarantee for vaccine safety.

[0023] The annual production capacity of global influenza vaccine is more than 1 billion doses, and the present application is the first DNA residual detection scheme for the influenza vaccine produced by the insect cell-baculovirus system, which solves the long-term pain point of lack of special detection tools in the field.

[0024] Compared with the prior art, the present application has the following beneficial effects: The primers and probes of the present application have good specificity, eliminate the need for DNA extraction and purification steps of the sample to be tested, and can efficiently detect and quantify the SF-RVN cell genomic DNA.

[0025] The primers and probes of the present application have a large linear range, good linearity, and high amplification efficiency, and the linear range of the positive quantitative standard is 3000 pg / muL to 0.03 pg / muL.

[0026] The primers and probes of the present application have high detection sensitivity, and the minimum detection limit can reach 0.03 pg / muL.

[0027] The detection method and kit of the present application can be applied to the quantitative detection of Sf-RVN cell DNA residues in influenza virus recombinant HA protein preparations, including but not limited to the quantitative detection of host insect cell Sf-RVN cell DNA residues in intermediate process samples, semi-finished products, and finished products of influenza virus recombinant HA protein preparations produced by the insect cell-baculovirus expression system, and has a good application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0028] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0029] Figure 1 The nucleic acid electrophoresis map prepared for the positive quantitative standard in Example 2 of the present application.

[0030] Figure 2 The amplification curve of the positive quantitative standard in Example 3 of the present application. Curves 1-6 in the figure respectively represent the following concentration gradient groups: 3000 pg / muL, 30 pg / muL, 3 pg / muL, 0.3 pg / muL, and 0.03 pg / muL.

[0031] Figure 3Standard curve for the positive quantitative standard in Example 3 of the present application.

[0032] Figure 4 is a detection amplification curve diagram of the sample to be tested in Example 3 of the present application. DETAILED DESCRIPTION

[0033] The technical solutions of the present application are further illustrated below in combination with examples and drawings. The reagent products and experimental methods used in the following examples are conventional commercially available products or methods in the art, and are not described in detail.

[0034] Materials and methods involved in the examples of the present application.

[0035] 1. Test sample The test sample was an influenza virus recombinant HA protein sample with batch number 202510 from Changchun Institute of Biological Products.

[0036] 2. Standard Sf-RVN insect cells (without rhabdovirus) were purchased from Merck Company, and the positive quantitative standard of Sf-RVN cells was derived from Sf-RVN cell genomic DNA (GenBank No. KY042019.1).

[0037] The specific amplification sequence was: TCTCGATCCTGCACACTATGTAAGTTCACCTGGTTTAAGTTGGGACGCCATGCTCCTTTACACGGGTGTT (SEQ ID NO: 4).

[0038] 3. Main reagents and instruments The MolPure® Cell / Tissue DNA Kit was purchased from Yixing Biotech Co., Ltd.; the host cell residual DNA test sample pretreatment kit (magnetic bead method) was purchased from Huzhou Shenko Biological Technology Co., Ltd.; and the fluorescent quantitative PCR instrument (ABI QuantStudio 5) was purchased from ABI.

[0039] Example 1 Design of fluorescent quantitative PCR primers and probes The inventors of the present application finally designed a set of primers and probes for SF-RVN cells with high amplification efficiency, good specificity and high adaptability after repeated research and comparison, and the sequences were as follows: F1: TCTCGATCCTGCACACTATG R1: AACACCCGTGTAAAGGAGCA Probe: FAM-TGGCGTCCCAACTTAAACCAGGTGA-BHQ1.

[0040] Preparation of positive quantitative standard of Sf-RVN cells The genomic DNA solution of Sf-RVN cells was extracted and purified using the MolPure® Cell / Tissue DNA Kit kit, and the absorption ratio at 260 nm and 280 nm and the concentration value of the genomic DNA solution of Sf-RVN cells were determined using a UV spectrophotometer. The results are shown in Table 1, which shows that the fluctuation range is between 1.6-2.0, and the extracted genomic DNA solution of Sf-RVN cells is pure. The purity of the nucleic acid was identified by electrophoresis, and the results are shown in Figure 1 The band was single and consistent with the expected. The concentration of the obtained genomic DNA solution of Sf-RVN cells was adjusted to 124 ng / μL and aliquoted as a positive quantitative standard of Sf-RVN cells, and stored at -80°C for standby. The DNA extraction process refers to the kit instructions.

[0041] Table 1 Calibration of the concentration of genomic DNA extracted from Sf-RVN cells

[0042] Example 3 Establishment of real-time fluorescent quantitative PCR amplification method Host cell residual DNA sample pretreatment: according to 2 times the mass of the sample to be tested, the positive quantitative standard of Sf-RVN cells was mixed as a recovery rate detection sample, and the host cell residual DNA sample pretreatment kit (magnetic bead method) was used to extract and purify the recombinant HA protein sample from Changchun Institute of Biological Products with batch number 202510 and the recovery rate detection sample.

[0043] The host cell residual DNA sample pretreatment process refers to the kit instructions.

[0044] The positive quantitative standard of Sf-RVN cells was gradient diluted according to the following concentrations: 3000 pg / μL, 300 pg / μL, 30 pg / μL, 3 pg / μL, 0.3 pg / μL, 0.03 pg / μL.

[0045] The qPCR reaction system (20 μl) is shown in Table 2, and the qPCR reaction program is shown in Table 3. The amplification curve is shown in Figure 3

[0046] Table 2 qPCR reaction system

[0047] Table 3 qPCR reaction program

[0048] ​After the program is run, a standard curve is drawn according to the CT value. The detection limit of the primer and probe of the application can be as low as 0.03 pg / μL. The copy number of the positive quantitative standard sample of Sf-RVN cells of different concentrations at the most stable time of the curve is taken as the abscissa, and the measured CT value is taken as the ordinate to draw a linear regression curve, and the standard curve is obtained, as shown in Figure 3 The results show that the correlation coefficient R2 is 0.995, i.e., R 2 > 0.99, and Eff is 98.488%.

[0049] The recombinant HA protein sample from Changchun Institute of Biological Products with batch number 202510 and the recovery sample are detected, and the results are shown in Figure 4 Table 4 and Table 4. It can be seen that the recovery rate is in the range of 50%-150%, and the concentration of residual DNA of the recombinant HA protein solution of Sf-RVN cells is 0.014 pg / μL.

[0050] Table 4 SF-RVN genomic DNA residual detection after sample pretreatment by kit (magnetic bead) method

[0051] Example 4: Specificity test In addition to the Sf-RVN cell genomic DNA, the recombinant HA protein product produced by the baculovirus production system also contains the DNA of the target gene and the baculovirus genome. In order to investigate the specificity of the primer and probe of the application, the following verification is carried out. The MDCK cell genomic DNA stored in the laboratory is extracted by using the MolPure® Cell / Tissue DNA Kit, and the laboratory-prepared auxiliary baculovirus genome Bacmid1, the Bacmid2 containing the auxiliary baculovirus genome of the target gene, are subjected to qPCR reaction according to the qPCR reaction system and reaction program in Example 3, and the reaction is repeated for 3 times. If the detection result is negative (the CT value is beyond the detection limit of the standard curve or is judged as negative by default), it indicates that the specificity meets the requirements.

[0052] The detection results are shown in Table 5, and all the detection samples are negative, which proves that the method of the application has good specificity.

[0053] Table 5: qPCR specificity test results

[0054] The above is only a preferred embodiment of the application and is not used to limit the application. For those skilled in the art, the application can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. within the spirit and principle of the application shall be included in the protection scope of the application.

Claims

1. Primers and probes for detecting residual DNA in Sf-RVN cells, characterized in that, The primers include an upstream primer and a downstream primer; The sequence of the upstream primer is shown in SEQ ID NO:1; The sequence of the downstream primer is shown in SEQ ID NO:2; The sequence of the probe is shown in SEQ ID NO:

3.

2. The primers and probes for detecting residual DNA in Sf-RVN cells according to claim 1, characterized in that, The probe is modified with a fluorescent reporter group FAM at its 5' end and a fluorescent quencher group BHQ1 at its 3' end.

3. The primers and probes for detecting residual DNA in Sf-RVN cells according to claim 1, characterized in that, The molar ratio of the upstream primer, downstream primer, and probe is 2:2:

1.

4. A method for detecting residual DNA in Sf-RVN cells using the primers and probes described in any one of claims 1-3.

5. The method for detecting residual DNA in Sf-RVN cells according to claim 4, characterized in that, Includes the following steps: DNA was extracted from the sample to be tested as a template. Then, a real-time quantitative PCR reaction system was prepared using upstream primers, downstream primers and probes, and a real-time quantitative PCR reaction was performed. Finally, the residual amount of Sf-RVN cell DNA in the sample to be tested was calculated according to the standard curve.

6. The method for detecting residual DNA in Sf-RVN cells according to claim 5, characterized in that, The real-time quantitative PCR reaction system, in 20 μL increments, consists of: 2× Taq Pro HS U+Probe Master Mix 10μL 50×ROX buffer 0.4μL Upstream primer, concentration 10 μM, 0.4 μL Downstream primer, concentration 10 μM, 0.4 μL Probe, concentration 10 μM, 0.2 μL 1μL template Add RNase-free water to a final volume of 20 μL; The real-time quantitative PCR reaction procedure is as follows: Step 1: 37℃ for 2 minutes; Step 2: 95℃ for 30 seconds; One loop; Step 3: 95℃ for 10 seconds, 60℃ for 30 seconds, for a total of 45 cycles.

7. The method for detecting residual DNA in Sf-RVN cells according to claim 5, characterized in that, The method for establishing the standard curve is as follows: The positive quantitative standard of Sf-RVN cells was diluted 10-fold, and real-time fluorescence quantitative PCR was performed on the diluted positive quantitative standard of Sf-RVN cells. The concentration of different concentrations of positive quantitative standard of Sf-RVN cells was used as the x-axis and the measured CT value was used as the y-axis to establish a standard curve. The reaction system and procedure for real-time quantitative PCR of the diluted Sf-RVN cell positive quantitative standard are the same as those for real-time quantitative PCR of the DNA of the sample to be tested.

8. The method for detecting residual DNA in Sf-RVN cells according to claim 5, characterized in that, It possesses one or more of the following characteristics: DNA was extracted from the sample using the magnetic bead method; The positive quantitative standard of Sf-RVN cells was prepared from SF-RVN cell genomic DNA, and the Sf-RVN cell genome is a complete genome. The sample to be tested is a recombinant HA protein product of influenza virus produced with the participation of Sf-RVN cells.

9. A kit for detecting residual DNA in Sf-RVN cells containing primers and probes as described in any one of claims 1-3.

10. The kit for detecting residual DNA in Sf-RVN cells according to claim 9, characterized in that, The kit also includes one or more of the following: a real-time quantitative PCR reaction system, a negative control, a negative quality control, and a positive quantitative standard for Sf-RVN cells; The amplified sequence of the positive quantitative standard of the SF-RVN cells is shown in SEQ ID NO:4.