A molecular marker related to high-sugar feed utilization trait of gibel carp and application thereof

Genome-wide association analysis identified the SNP site slc25a11-1 on chromosome 7 of mandarin fish, and molecular marker primer pairs Slc25a11-F and Slc25a11-R were developed. This solved the problem of poor digestibility and utilization of high-sugar feed in mandarin fish, improved aquaculture efficiency and the accuracy of genetic improvement, and promoted the sustainable aquaculture of mandarin fish.

CN121320576BActive Publication Date: 2026-05-01HUAZHONG AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HUAZHONG AGRI UNIV
Filing Date
2025-12-15
Publication Date
2026-05-01

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively address the problem of poor digestion and utilization of high-sugar feed by mandarin fish, leading to metabolic reactions such as cell apoptosis and oxidative stress, which affect aquaculture efficiency and sustainable development.

Method used

Genome-wide association analysis revealed that the SNP locus slc25a11-1 on chromosome 7 of mandarin fish is associated with high sugar feed utilization traits. Molecular marker primer pairs Slc25a11-F and Slc25a11-R were developed to identify high sugar feed utilization traits in mandarin fish and to screen for varieties with strong high sugar tolerance.

Benefits of technology

It significantly improves the utilization efficiency of high-sugar feed for mandarin fish, reduces feed costs, increases the speed and accuracy of genetic improvement, and promotes sustainable aquaculture and the protection of genetic diversity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121320576B_ABST
    Figure CN121320576B_ABST
Patent Text Reader

Abstract

The application discloses a molecular marker related to a high-sugar feed utilization character of Procyprinus, and application thereof. The molecular marker is located on the 7th chromosome of the Procyprinus, and contains one SNP site slc25a11-1 on the molecular marker. The SNP site slc25a11-1 is located at the 1439370th base of the 6th chromosome of the Procyprinus, and the polymorphic site is T / C. The high-sugar feed utilization of the Procyprinus species can be obviously improved through the molecular marker, so that the feed cost is reduced and the breeding benefit is increased.
Need to check novelty before this filing date? Find Prior Art

Description

A molecular marker associated with high-sugar feed utilization traits in mandarin fish and its application Technical Field

[0001] This invention relates to the field of molecular genetics in aquaculture, specifically to a molecular marker related to the utilization trait of high-sugar feed in mandarin fish and its application. Background Technology

[0002] DNA molecular marker technology, as a method for directly studying genetic material, has opened up new avenues for animal genetic breeding research. There are many types of DNA molecular markers. Early markers such as RAPD and AFLP, due to their dominant inheritance characteristics, were not easy to identify recessive alleles and could lead to locus loss during linkage analysis, thus limiting their applications in some cases. Although RFLP shows co-dominance, its complex operation process has gradually led to its replacement by SSR and SNP molecular markers, making them the preferred technique for molecular marker research.

[0003] Single nucleotide polymorphisms (SNPs) play a crucial role in animal breeding. SNP markers can locate quantitative trait loci (QTLs), aiding in the selection of superior traits and optimizing the breeding process. Studies have found that SNP sites located in Toll-like receptor genes (TLRs) are significantly associated with resistance to white spot disease (WSSV), with individuals carrying specific alleles showing a 40% increase in survival rate, providing targets for the molecular design of disease-resistant vaccines. Researchers have already used genome-wide association studies (GWAS) to screen for SNP markers significantly associated with body length and weight, and combined with family selection techniques, have increased the growth rate of selected populations by 18%-22%, shortening the breeding cycle.

[0004] Mandarin fish (Siniperca chuatsi) is a traditional and prized freshwater fish in my country, prized for its tender, delicious flesh, lack of intramuscular bones, and high nutritional value. It has a unique diet, feeding exclusively on live fish throughout its life, typically refusing dead bait or artificial feed. Since the 21st century, advancements in science and technology have led to breakthroughs in the artificial breeding of mandarin fish through feed formulation optimization, improved domestication techniques, and the cultivation of new varieties. However, mandarin fish do not digest and utilize feed as efficiently as herbivorous or omnivorous fish, especially carbohydrates (sugars) in their feed. Long-term intake of such feed can cause metabolic reactions such as cell apoptosis and oxidative stress. Therefore, overcoming the challenges of sugar metabolism disorders and physiological function regulation caused by high-sugar feeds is crucial for the sustainable development of the mandarin fish aquaculture industry.

[0005] Molecular markers are a crucial tool in biological research. Conducting research on DNA molecular markers is of great significance for strengthening biodiversity conservation, taxonomic identification, and advancing molecular-assisted breeding. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a molecular marker related to the high-sugar feed utilization trait of mandarin fish and its application. This invention involves feeding a population of mandarin fish with a high-carbohydrate diet, comparing the differences in growth performance and sugar tolerance among all individuals under high-carbohydrate stress, and identifying candidate genes related to sugar tolerance in mandarin fish through genome-wide association analysis. This process aims to obtain molecular markers with breeding value and develop rapid and effective molecular marker breeding techniques.

[0007] To achieve the above objectives, the technical solution designed by the present invention is as follows:

[0008] This invention provides a molecular marker associated with the high-sugar feed utilization trait of mandarin fish, the molecular marker being located on chromosome 7 of mandarin fish and containing one SNP site slc25a11-1;

[0009] The SNP site slc25a11-1 is located at base 1439370 on chromosome 7 of the mandarin fish, and the polymorphic site is T / C.

[0010] The present invention also provides the application of the aforementioned molecular marker in identifying high-sugar feed utilization traits in mandarin fish, screening high-sugar-tolerant mandarin fish varieties, and in the genetic breeding of high-sugar feed utilization traits in mandarin fish.

[0011] The present invention also provides a primer pair for obtaining the aforementioned molecular marker. The nucleotide sequence of the primer pair containing the SNP site slc25a11-1 is as follows:

[0012] Slc25a11-F: AATGTCCCCTGAAAGCCAGC;

[0013] Slc25a11-R:GTTGGCAAGTTGAATCTCAGACC.

[0014] Furthermore, the nucleotide sequence of the sequence amplified by the primer pairs Slc25a11-F and Slc25a11-R is shown in SEQ ID NO: 1, wherein the degenerate base Y is T / C, and the SNP site slc25a11-1 is located at the 97th base of the sequence.

[0015] When the SNP site slc25a11-1 is of the TT genotype, the high-sugar feed efficiency of mandarin fish is higher than that of mandarin fish of other genotypes.

[0016] This invention also provides a method for detecting molecular markers related to the utilization traits of high-sugar feed in mandarin fish. The method uses the primer pairs described above for amplification and sequencing comparison to complete the detection.

[0017] The present invention also provides the application of the primer pair described above in identifying the high sugar feed utilization trait of mandarin fish, screening mandarin fish varieties with strong high sugar tolerance, and in the genetic breeding of high sugar feed utilization trait of mandarin fish.

[0018] The present invention also provides a kit for detecting the aforementioned molecular markers, the kit comprising the aforementioned primer pairs.

[0019] The present invention also provides a method for identifying the high-sugar feed utilization traits of mandarin fish using the aforementioned kit, comprising the following steps:

[0020] Detect molecular markers on chromosome 7 of mandarin fish that are associated with high sugar feed utilization traits, and determine the high sugar feed utilization traits of mandarin fish based on SNP sites;

[0021] When the SNP locus slc25a11-1 is of the TT genotype, the high-sugar feed efficiency of mandarin fish is higher than that of mandarin fish of other genotypes.

[0022] Furthermore, the detection method includes the following steps:

[0023] (1) Extract DNA from the mandarin fish to be tested;

[0024] (2) Perform PCR amplification on the extracted DNA using the primer pairs provided in the kit;

[0025] (3) Sequencing analysis of the PCR amplification products to obtain sequencing results;

[0026] (4) Based on the sequencing results, the genotypes were obtained. When the SNP site slc25a11-1 was the TT genotype, the high sugar feed efficiency of mandarin fish was higher than that of mandarin fish with other genotypes.

[0027] The present invention also provides the application of the kit described herein in identifying the high sugar feed utilization trait of mandarin fish, screening mandarin fish varieties with strong high sugar tolerance, and in the genetic breeding of high sugar feed utilization trait in mandarin fish.

[0028] The beneficial effects of this invention are:

[0029] This invention verifies that the slc25a11-1 locus is significantly associated with the high-sugar feed utilization trait in mandarin fish. By implementing the molecular markers of this invention, the utilization of high-sugar feed in mandarin fish can be significantly improved, thereby reducing feed costs and increasing aquaculture efficiency. Furthermore, this invention also helps to improve the speed and accuracy of genetic improvement programs for mandarin fish, promoting sustainable aquaculture and the protection of genetic diversity. Attached Figure Description

[0030] Figure 1 shows the sequencing peaks of SNP sites related to the utilization of high-sugar feed;

[0031] Figure 2 shows the distribution of SNPs in Mandarin fish. Detailed Implementation

[0032] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can understand it.

[0033] Example 1

[0034] Molecular screening related to high-sugar feed utilization traits in mandarin fish

[0035] 1. Experimental materials

[0036] From 1100 mandarin fish, 150 well-domesticated mandarin fish of uniform size (average weight 43.6 g) were selected. All experimental fish came from aquaculture bases in Guangdong, ensuring a homogeneous population and clear genetic background. The mandarin fish were fed an extruded feed with a high sugar content of 18%. Feed intake, survival rate, and weight gain were recorded during the rearing period, and samples were collected for analysis after 5 months. A comprehensive analysis of growth traits, serum biochemical indicators, liver and intestinal tissue sections, expression of key sugar metabolism genes, and sugar tolerance tests divided the mandarin fish population into a high-sugar feed utilization group (S group) and a low-sugar feed utilization group (W group). Growth traits showed that the S group had higher weight gain rate, body length, body height, and liver-to-body ratio. Genome resequencing was performed on 104 muscle samples (1 g) from the mandarin fish.

[0037] 2. DNA extraction and DNA quality control

[0038] DNA was extracted from the muscle tissue of 104 mandarin fish samples. The purity and integrity of the DNA were analyzed using 1.5% agarose gel electrophoresis to detect any DNA degradation. The concentration of the DNA was accurately quantified using Qubit 4.0.

[0039] 3. Construction of resequencing libraries

[0040] After quality control, samples that passed inspection were used to randomly fragment genomic DNA using Tn5 transposase, followed by PCR amplification and magnetic bead sorting. The resulting library contained fragments ranging from 300 bp to 700 bp. This library was then directly used for sequencing.

[0041] 4. Detection and annotation of genomic genetic variations

[0042] The Fastq tool was used to remove sequence reads containing low-quality bases and reads with a quality score less than 20. Reads were aligned to the mandarin fish reference genome using BWA v0.7.17 with default parameters. Initial SNP variant detection and filtering were performed from the generated BAM file using the SAM-TOOLS software package to generate a comprehensive SNP dataset. To ensure the accuracy of variant detection, all chimeric and non-allelic SNPs were systematically removed. Genotyping quality control was performed using the PLINK software package. SNPs meeting specific criteria, including minimum allele frequency (MAF) > 0.05 and genotyping negative detection rate < 20%, were carefully selected for subsequent GWAS analysis. Extrapolation was performed using the Beagle 5.0 software program to control for uncalled genotypes.

[0043] 5. Sequencing results and interpretation

[0044] In this embodiment, the Illumina platform was used to resequently sequence 104 muscle samples of mandarin fish. The monomer data size of the samples ranged from 7.60 G to 13.53 G, and the sequencing quality of each sample was high (QC20 ≥ 99.26%, QC30 ≥ 97.25%), with GC content ranging from 40.36% to 44.38%. The sequencing data size of each mandarin fish sample met the sufficient standard, the GC distribution was normal, and the sequencing quality was ideal, meeting the requirements for subsequent analysis.

[0045] After quality control, Sentieon software was used to align the clean reads to the reference gene (GCA_011952085.1), and then sort and remove redundancy. The average mapping rate was 99.90%, the average chromosome coverage was 95.52%, and the average sequencing depth was 12.84 × 10⁻⁶. A total of 2,641,098 SNPs were identified in the high-sugar experimental mandarin fish population. After filtering, 302,940 high-quality SNPs were retained for subsequent analysis. To visually demonstrate the distribution characteristics of genome-wide SNPs, CMplot was used to count the number of SNPs in each window based on a sliding window, and the results were displayed as a heatmap. As shown in Figure 2, the polymorphism rates of Chr04 and Chr05 were relatively high, while the mutation rates of the other chromosomes did not differ significantly.

[0046] Example 2

[0047] Identification of molecular markers associated with high-sugar feed utilization traits in mandarin fish

[0048] 1. Experimental materials

[0049] From 1100 mandarin fish, 150 well-domesticated mandarin fish of uniform size (average weight 43.6 g) were selected. All experimental fish came from aquaculture bases in Guangdong, ensuring a homogeneous population and clear genetic background. The mandarin fish were fed an extruded feed with a high sugar content of 18%. Feed intake, survival rate, and weight gain were recorded during the rearing period. After 5 months of rearing, samples were collected for genome-wide association analysis. A comprehensive analysis of growth traits, serum biochemical indicators, liver and intestinal tissue sections, expression of key sugar metabolism genes, and sugar tolerance tests divided the mandarin fish population into a high-sugar feed utilization group (S group) and a low-sugar feed utilization group (W group). Growth traits showed that the S group had a higher weight gain rate, body length, body height, and liver-to-body ratio. The weight gain rate of the S group (175.24%) was significantly higher than that of the W group (39.31%).

[0050] 2. Genomic DNA extraction and quality testing

[0051] Fin tissues from 35 mandarin fish in groups S and W were collected and stored in anhydrous ethanol at 4°C for DNA extraction. Genomic DNA was extracted from the mandarin fish using a commercial DNA extraction kit (TIANGEN) following the manufacturer's instructions. The concentration and quality of the DNA were detected using a microplate reader (Bio-Tek), and the integrity of the DNA was verified by 1.5% agarose gel electrophoresis. DNA samples from groups S and W were obtained separately.

[0052] 3. PCR amplification and agarose gel electrophoresis

[0053] (1) The extracted DNA from groups S and W was amplified by PCR. The reaction system was as follows: each 20 μL PCR reaction contained: 10 μL of 2×PCR Master Mix (containing Taq DNA polymerase, dNTPs and buffer), 1 μL of 20 μM forward and reverse primers, 50 ng of template DNA, and sterile deionized water to make up the volume. The primer sequences are shown in Table 1.

[0054] (2) PCR reaction conditions: initial denaturation at 95℃ for 5 min; followed by 35 cycles, each cycle including denaturation at 95℃ for 30 s, annealing at 60℃ for 30 s, extension at 72℃ for 30 s; the last extension step was performed at 72℃ for 7 min.

[0055] (3) The DNA of mandarin fish was amplified using primer pairs Slc25a11-F and Slc25a11-R to obtain the gene sequence containing the SNP site slc25a11-1. The specificity of the primers and the quality of the PCR product were verified by 2% agarose gel electrophoresis to confirm the specific amplification.

[0056] Table 1 Primer Information

[0057]

[0058] 4. Sequencing and result interpretation

[0059] The gene sequence containing the SNP site slc25a11-1 was sequenced using the Sanger sequencing method (Shanghai Sangon Biotech). The accurate genotyping of the target SNP site was confirmed by peak plotting using Chromas software.

[0060] The results are shown in Figure 1 and Table 2. The results indicate that, during the analysis, single peaks with higher peak values ​​were considered homozygous SNP sites, while double peaks with lower peak values ​​were considered heterozygous SNP sites. The SNP site slc25a11-1 is located at base 1439370 on chromosome 7 of *Siniperca chuatsi*, with a polymorphism of T / C, and is located at position 2060 of the slc25a11 gene sequence (http: / / genomes.igb-berlin.de / cgi-bin / hgGateway?db=sinChu7).

[0061] Table 2 Basic Information on SNP Sites

[0062]

[0063] 5. Genetic diversity analysis and correlation analysis

[0064] Genetic parameters, including allele frequency, genotype frequency, homozygosity (Ho), heterozygosity (He), effective number of alleles (Ne), and polymorphism information content (PIC), were calculated for the SNP locus slc25a11-1. The results are shown in Table 3. The PIC of this locus is between 0.25 and 0.5, classifying it as a moderately polymorphic locus.

[0065] Table 3. Genetic diversity parameters of SNP loci in the experimental groups

[0066]

[0067] Based on the genotypes detected by Sanger sequencing, SPSS 27 software was used for data processing, and the chi-square test was used to calculate the correlation between SNP genotypes and differences in high-sugar feed efficiency in mandarin fish. The results are shown in Table 4. The genotype of SNP locus slc25a11-1 was significantly correlated with high-sugar feed utilization pattern (P<0.05).

[0068] Table 4 Genotype Distribution

[0069]

[0070] 6. Based on Table 5, the association between SNP loci and weight gain rate phenotype in high-sugar feed utilization was explored using different genetic models. The results are shown in Table 6. SNP locus slc25a11-1 showed a significant association with weight gain rate in the Codominant, Recessive, and Additive models, with P values ​​less than 0.05.

[0071] Table 5 Hardy-Weinberg equilibrium (univariate logistic regression)

[0072]

[0073] Table 6 Association analysis between SNP loci and weight gain rate phenotype (univariate logistic regression)

[0074]

[0075] Example 3

[0076] Acquisition of molecular markers associated with high-sugar feed utilization traits in mandarin fish

[0077] Using the genomic DNA of Mandarin fish (http: / / genomes.igb-berlin.de / cgi-bin / hgTracks?db=sinChu7&lastVirtModeType=default&lastVirtModeExtraState=&virtModeType=default&virtMode=0&nonVirtPosition=&position=sinChu7%2DLG01%3A1%2D100000&hgsid=64423) as a template, PCR amplification was performed using primer pairs Slc25a11-F and Slc25a11-R from Example 1. The nucleotide sequences of primer pairs Slc25a11-F and Slc25a11-R are shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

[0078] Slc25a11-F: AATGTCCCCTGAAAGCCAGC;

[0079] Slc25a11-R:GTTGGCAAGTTGAATCTCAGACC.

[0080] The gene sequence slc25a11-a containing the SNP site slc25a11-1 was obtained. Its nucleotide sequence is shown in SEQ ID NO: 1. The degenerate base Y is T / C, and the SNP site slc25a11-1 is located at the 97th base of the gene sequence slc25a11-a. The polymorphic site is T / C.

[0081] Example 4

[0082] This embodiment provides a kit for detecting molecular markers related to the high sugar feed utilization trait of mandarin fish, including the primer pair Slc25a11-F and Slc25a11-R from Example 2.

[0083] Example 5

[0084] This embodiment provides a method for identifying the high-sugar feed utilization traits of mandarin fish using the kit from Example 4, comprising the following steps:

[0085] Detect molecular markers on chromosome 7 of mandarin fish that are associated with high sugar feed utilization traits, and determine the high sugar feed utilization traits of mandarin fish based on SNP sites;

[0086] The distribution of gene frequency and genotype frequency at the SNP-slc25a11 locus differed significantly between the S and W groups, and was significantly associated with the weight gain phenotype in the glucose tolerance trait.

[0087] The detection method includes the following steps:

[0088] (1) Extract DNA from the mandarin fish to be tested;

[0089] (2) Perform PCR amplification on the extracted DNA using the primer pairs provided in the kit;

[0090] (3) Sequencing analysis of the PCR amplification products to obtain sequencing results;

[0091] (4) Based on the sequencing results, the genotypes were obtained. When the SNP site slc25a11-1 was the TT genotype, the high sugar feed efficiency of mandarin fish was higher than that of mandarin fish with other genotypes.

[0092] Example 6

[0093] This embodiment utilizes the kit from Example 4 and the method from Example 5 to detect the high-sugar feed utilization trait of mandarin fish, including the following steps:

[0094] 1. Experimental materials

[0095] In this embodiment, the mandarin fish used were experimental fish raised by the College of Fisheries of Huazhong Agricultural University. The mandarin fish had a body length of 9.15-11.56 cm and a weight of 15.70-41.85 g. A total of 48 mandarin fish were randomly selected.

[0096] 2. Genomic DNA extraction and quality testing

[0097] Genomic DNA was extracted from 48 selected mandarin fish.

[0098] 3. PCR amplification and agarose gel electrophoresis

[0099] The genomic DNA of the extracted mandarin fish was amplified by PCR using primers Slc25a11-F and Slc25a11-R, respectively. The reaction system and reaction conditions were the same as in Example 2.

[0100] 4. Sequencing and result interpretation

[0101] The amplification products from step 3 were sequenced and analyzed to obtain the genotype of the SNP locus slc25a11-1. The high-sugar feed efficiency of each mandarin fish was statistically analyzed, and the results are shown in Table 7. Three genotypes were detected in the mandarin fish population: TT, CT, and CC. The high-sugar feed efficiency of the TT genotype mandarin fish was higher than that of the other genotypes. The test results showed that P = 0.012 (P < 0.05), indicating that this locus had a significant difference in high-sugar feed efficiency among the mandarin fish population.

[0102] In this embodiment, feed efficiency refers to the weight gain of each mandarin fish / the total amount of feed consumed by each mandarin fish during the farming experiment. The average feed efficiency of the TT group was 0.92, the average feed efficiency of the TC group was 0.75, and the feed efficiency of the CC group was 0.76.

[0103] Table 7. Evaluation of high-sugar feed efficiency after different genotype groups

[0104]

[0105] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The application of a molecular marker in identifying high-sugar feed utilization traits in mandarin fish and in the genetic breeding of high-sugar feed utilization traits in mandarin fish, characterized in that: The molecular marker is the sequence shown in SEQ ID NO: 1, and the molecular marker contains one SNP site slc25a11-1; the SNP site slc25a11-1 is located at the 97th base of the sequence shown in SEQ ID NO: 1, and the polymorphic site is T / C.

2. A method for detecting molecular markers related to the utilization traits of high-sugar feed in mandarin fish, characterized in that: The molecular marker is the sequence shown in SEQ ID NO: 1, which contains one SNP site, slc25a11-1. The SNP site slc25a11-1 is located at the 97th base of the sequence shown in SEQ ID NO: 1, and the polymorphic site is T / C. The method uses primer pairs for amplification and sequencing comparison for detection. The nucleotide sequences of the primer pairs are as follows: Slc25a11-F: AATGTCCCCTGAAAGCCAGC; Slc25a11-R: GTTGGCAAGTTGAATCTCAGACC. When the SNP site slc25a11-1 is of the TT genotype, the high-sugar feed efficiency of mandarin fish is higher than that of mandarin fish of other genotypes.

3. The application of the primer pair according to claim 2 in identifying the high-sugar feed utilization trait of mandarin fish and in the genetic breeding of the high-sugar feed utilization trait of mandarin fish.

4. A method for identifying the utilization traits of high-sugar feed in mandarin fish using the primer pair described in claim 2, characterized in that: Includes the following steps: Molecular markers associated with high-sugar feed utilization traits in mandarin fish were detected. Based on the SNP sites, the high-sugar feed utilization traits of mandarin fish were determined. When the SNP site slc25a11-1 is of the TT genotype, the high-sugar feed efficiency of mandarin fish is higher than that of other genotypes. The molecular marker is the sequence shown in SEQ ID NO: 1, which contains one SNP site slc25a11-1. The SNP site slc25a11-1 is located at the 97th base of the sequence shown in SEQ ID NO: 1, and the polymorphic site is T / C.

5. The method according to claim 4, characterized in that: The detection method includes the following steps: (1) extracting DNA from the mandarin fish to be detected; (2) performing PCR amplification on the extracted DNA using primers in the kit; (3) performing sequencing analysis on the PCR amplification product to obtain sequencing results; (4) obtaining the genotype based on the sequencing results. When the SNP site slc25a11-1 is the TT genotype, the high sugar feed efficiency of the mandarin fish is higher than that of other genotypes of mandarin fish.

Citation Information

Patent Citations

  • SNP molecular marker easy to domesticate artificial feed mandarin fish related gene

    CN102653757A

  • SNP (single nucleotide polymorphism) molecular mark related to domesticating property of mandarin fish

    CN103305506A