Alpha-hemolysin compositions and methods for immunizing against staphylococcus aureus

Abstract

Provided herein are compositions and methods for treating Staphylococcus aureus.

Description

Technical Field

[0001] This invention relates to compositions and methods for treating Staphylococcus aureus.

[0002] Reference sequence list This application contains a sequence of documents that has been filed electronically by the Patent Centre in computer-readable XML format and is incorporated herein by reference in its entirety under 37C.FR § 1.52(e)(5). The XML file was created on April 11, 2024, and is named “047563-792748(020578).XML”, with a size of 51.6 kilobytes.

[0003] Government funding statement This invention was carried out with government support under license number AI167137 granted by the National Institutes of Health. The government owns certain rights to this invention. Background Technology

[0004] Staphylococcus aureus ( Staphylococcus aureus Staphylococcal infections cause more than one million deaths globally each year, impacting individuals throughout their lifespan and disproportionately affecting people in low- and middle-income countries. Organismically, Staphylococcus aureus is both a commensal bacterium of human skin and a leading cause of infection. Skin and soft tissue infections (SSTIs) remain the most common form of Staphylococcal disease, with an incidence of >100 cases per 100,000 people in the United States and costs >4 billion US dollars per year. SSTIs can lead to disseminated disease and exacerbate the health burden of antibiotic resistance.

[0005] While vaccine-based prevention of Staphylococcus aureus infection is a public health necessity, previous efforts to develop effective vaccines have failed. Each candidate vaccine that has reached human clinical trials exhibits high immunogenicity; however, the induced immune response has not been known to correlate with protective immunity against Staphylococcus aureus infection. Furthermore, recent studies have shown that pre-existing immune responses to Staphylococcus aureus can be detrimental to vaccine efficacy. New vaccine development approaches are needed that are based on an understanding of human immunity to this pathogen and recognize the need for a global solution. Summary of the Invention

[0006] This document discloses a modified α-hemolysin (Hla) polypeptide or its derivative or fragment comprising amino acid substitutions H35L, R66C, and E70C relative to the amino acid sequence shown in SEQ ID NO:1 (Hla). HREThe modified Hla polypeptide may contain the amino acid sequence shown in SEQ ID NO:11, or a sequence having at least about 80% identity with it, or a fragment thereof. The modified Hla polypeptide may contain any one of the amino acid sequences shown in SEQ ID NOS:12-35, or a fragment thereof, or an amino acid sequence having at least about 80% identity with it.

[0007] This document discloses a polynucleotide comprising a nucleic acid sequence encoding a modified Hla polypeptide. The modified Hla polypeptide may comprise the amino acid sequence shown in SEQ ID NO:11, a fragment thereof, or an amino acid sequence having at least about 80% identity with it. The polynucleotide sequence may be an isolated polynucleotide sequence, plasmid, expression vector, granule, or viral vector. The polynucleotide sequence may be contained in a virus or virus-like particle (VLP).

[0008] A host cell containing a polynucleotide sequence is also disclosed. Non-limiting examples of host cells include Chinese hamster ovary (CHO) cells, HEK 293 cells, human cervical cancer cells (HeLa), canine kidney cells (MDCK), human hepatocytes (HepG2), young hamster kidney cells (BHK), monkey kidney cells (CV1), Vero cells, CEM cells, 721.221 cells, H9 cells, Jurkat cells, Raji cells, W138 cells, COS-7 cells, 293 cells, HepG2 cells, 3T3 cells, and RIN cells.

[0009] This document discloses immunogenic compositions comprising a modified Hla polypeptide or a derivative or fragment thereof, or a polynucleotide sequence encoding an Hla polypeptide, and at least one pharmaceutically acceptable excipient. The immunogenic composition may further comprise a pharmaceutically acceptable adjuvant. Non-limiting examples of suitable adjuvants include alum, AddaSO3 (AS03-like), MPLA and alum (AS04-like), Fruends, CpG-ODN1585, and any combination thereof. The immunogenic composition may further comprise at least one additional active agent.

[0010] This article further discloses a method for inducing an immune response against a bacterial pathogen in a subject in need, comprising administering a modified Hla peptide to the subject. The use of the modified Hla peptide in the preparation of medicaments for inducing an immune response against a bacterial pathogen, and the use of the modified H1a peptide in inducing an immune response against a bacterial pathogen are also disclosed. The bacterial pathogen may be Staphylococcus aureus. Administering the modified Hla peptide to a subject can result in enhanced germinal center (GC) or T-follicle helper (TFH) responses, or reduced severity of skin and soft tissue infections, invasive Staphylococcus aureus disease, sepsis, and carrier infections, compared to administration of an immunogenic composition comprising only the substituted H35L amino acid sequence shown in SEQ ID NO:1.

[0011] In one aspect, the subject may be a mammal. In another aspect, the subject may be a human. The subject may be of any age. In one aspect, the subject may be a child under 3 years of age, or under 2 years of age, or under 1 year of age, or less than 12 months, or 11 months, or 10 months, or 9 months, or 8 months, or 6 months, or 5 months, or 4 months, or 3 months, or 2 months, or 1 month, or less than 4 weeks, or 3 weeks, or 2 weeks, or 1 week. The subject may be a pregnant woman. The method may further include administration of at least one, at least two, at least three or more additional immunogenic compositions. The method may include administration of at least one additional immunogenic antigen. Other non-restricted examples of immunogenic antigens include Opp3a, DltD, HtsA, LtaS, IsdA, IsdB, IsdC, SdrC, SdrD, SdrE, SdrF, SdrG, SdrH, SrtA, SpA, Sbi, FmtB, β-hemolysin, fibronectin-binding protein A (fnbA), fibronectin-binding protein B (fnbB), coagulase, Fig, Map, leukocytoxin (Pvl), α-toxin and its variants, γ-toxin (hlg) and its variants, Ica, immunodominant ABC transporter, Mg2+ transporter, Ni-ABC transporter, RAP, autolysin, laminin receptor, IsaA / PisA, IsaB / PisB, SpOIIIE, SsaA, EbpS, SasA, SasF, SasH, and EFB. (FIB), SBI, Npase, EBP, bone sialic acid-binding protein II, aureolysin precursor (AUR) / Sepp1, CNA and its fragments, such as M55, TSST-1, mecA, poly-N-acetylglucosamine (PNAG / dPNAG) extracellular polysaccharide, GehD, EbhA, EbhB, SSP-1, SSP-2, HBP, vitrin-binding protein, HarA, EsxA, EsxB, enterotoxin A, enterotoxin B, enterotoxin C1, and novel autolysins. Administration can be via intravenous, intramuscular, subcutaneous, oral, or intraperitoneal routes. Attached Figure Description

[0012] The patent or application document contains at least one drawing made in color. A copy of this patent or patent application with the color drawing will be provided by the patent office upon request and payment of the necessary fees. Aspects of this disclosure are illustrated by way of example, wherein: Figure 1A schematic diagram of the ADAM10 extracellular domain (PDB 6BE6) is provided, showing the structural orientation of each domain relative to the cell membrane: metalloproteinases (magenta), deintegrins (cyan), and cysteine-rich domains (green). Transmembrane and cytoplasmic tail domains are shown in gray.

[0013] Figure 2A-2B An analysis of Hla-targeted vaccine candidate antigens was provided. Figure 2A An analysis of serum anti-Hla titers by age was provided, showing the half-maximal effective concentration (EC50) during the first five years of life. 50 The values ​​gradually increase. The 75th, 25th (black), and 50th (red) percentiles are marked. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, obtained through one-way ANOVA and Tukey test for multiple comparisons. Figure 2B An analysis of the functional Hla neutralizing activity in serum during a rabbit erythrocyte protection assay was provided, demonstrating that infants and children under two years of age exhibited immature responses compared to older children. The 75th and 25th (black) and 50th (red) percentiles are indicated. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, multiple comparisons were performed using one-way ANOVA and Tukey's test.

[0014] Figures 3A-3D Analysis of Hla-targeting candidate antigens is provided. Figure 3A Schematic diagrams of the structure of the monomeric Hla antigen (left, PDB 4YHD) and the isolated monomer from the heptameric toxin (right, PDB 7AHL), with the full-length vaccine antigen Hla labeled. H35L (purple), Hla D45A / Y118F (Orange), HIA R66C / E70C The positions of variant residues (in blue). Figure 3B A set of peptide antigens is provided: Hla 50 (SEQ ID NO:36); Hla P1 The first 50 amino acids of Hla contain five repeating synthetic antigens (SEQ ID NO:37) predicted by IEDB to be T-cell epitopes; and Hla P2 : A synthetic antigen containing three different predictive T-cell antigen peptides from Hla (SEQ ID NO:38). Figure 3C Vaccine efficacy data for preventing abscesses are provided for each antigen. Each antigen was delivered to mice in each group to examine vaccine efficacy compared to a single Freunds adjuvant control. Data on subcutaneous delivery of 1 × 10⁻⁶ antigens to mice (n=9–10 per group) immunized with each Hla variant vaccine are provided. 8Data on the area of ​​skin abscess (left) and skin necrosis (right) following CFU Staphylococcus aureus USA300 / LAC strain. Figure 3D Data was provided to show that the incorporation of the fully detoxified histidine 35 mutation to leucine (Hla) H35L / D45A / Y118F and Hla H35L / R66C / E70C Hla HDY and Hla HRE After that, the candidate vaccine antigen Hla H35L (Hla H (purple), Hla D45A / Y118F and H1a R66C / E70C This triggers protection against rRBC cleavage.

[0015] Figures 4A-4H An analysis of Hla-targeted vaccine candidate antigens was provided. Figure 4A Offered options from Hla vaccines alone (using adjuvants (sham) or candidate Hla vaccines) H35L Hla D45A / Y118F Hla R66C / E70C OT-II CD4 harvested from draining lymph nodes of immunized mice + T cells OT-II CD4 + T cell subset analysis. Subcutaneous infection 1 × 10 8 Tissues were harvested 7 days after CFU of wild-type Staphylococcus aureus USA300 / LAC strain. Nonparametric one-way ANOVA corrected by Bonferroni-Dunn was performed, p<0.05. Figure 4B The protection of rRBC cleavage after treatment with 2 nM Hla and the protection after treatment with Hla are shown. H35L (purple), Hla D45A / Y118F (Orange), H1a R66C / E70C (Blue) Correlation between serum anti-Hla titers (Log EC50) in mice after immunization. Figure 4C This is a comparison between the Hla variant of the vaccine antigen bound to rRBC and wild-type Hla. Figure 4D This shows that, compared to wild-type Hla, Hla H Hla HDY and Hla HRE Analysis of melting curves. Figure 4E It is produced through coupled in vitro transcription and translation. 35 S-methionine-labeled Hla, Hla H Hla HDY and Hla HRE SDS-PAGE analysis. Figure 4F Hla and Hla were displayed. H Hla HDY and HlaHRE The heptameric assembly and stability analysis was performed by incubating the radiolabeled toxin with rRBCs for one hour at room temperature, followed by incubation at 37°C, 62°C, or 80°C for 10 minutes before evaluation. Figure 4G The results showed that as the concentration of the radiolabeled toxin increased, Hla... HRE Analysis of heptamer activity. Radiolabeled toxins were incubated with rRBCs at room temperature for one hour, followed by incubation at 37°C. The relative optical density units of the monomeric and heptamer toxins were quantified using ImageJ software. After separation by SDS-PAGE, the labeled toxins were detected by phosphorus screen imaging. Figure 4E-4G The toxin monomer (arrow) and oligomer (Hla7) are marked. Figure 4H This demonstrates the effect of mass spectrometry on antigen Hla. HRE Disulfide bonds were identified in Hla (mass spectrometry peptide sequence provided in SEQ ID NO:47). Hla was identified by LC-MS / MS analysis. HRE The disulfide chain (SS) peptides of Cys66 and Cys70 in the protein were linked and verified by manual comparison of y or b ions for matching.

[0016] Figures 5A-5E The results show that newborn vaccination provides protection against Staphylococcus aureus skin and soft tissue infections. Figure 5A This is a schematic diagram showing the timeline of newborn vaccination and SSTI modeling. Figure 5B Provided display using 1×10 8 The area of ​​skin abscess (left) in mice (9-10 mice per group) after reinfection with CFU Staphylococcus aureus (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 indicates HLA) HRE (Statistically significant compared to each vaccine condition indicated by color) and using 1×10 8 The area of ​​skin necrosis (right) in immunized mice (9-10 mice per group) after reinfection with CFU Staphylococcus aureus (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 indicates HLA) HRE A graph showing statistical significance compared to each vaccine condition indicated by color. Figure 5C Provided display using 1×10 8 Plot of skin abscess area (left) in mice (n=9-10 per group) after reinfection with CFU Staphylococcus aureus (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 indicate HLA) HRE (Statistically significant compared to each vaccine condition indicated by color) and using 1×10 8The area of ​​skin necrosis (right) in immunized mice (9-10 mice per group) after reinfection with CFU Staphylococcus aureus (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 indicates HLA) HRE A graph showing statistical significance compared to each vaccine condition indicated by color. Figure 5D Showing Figure 5B and 5C Serum dilutions in mice, when exposed to 0.8 pM recombinant Hla, provided 50% protection against rRBC lysis (IC50). Figure 5E The correlation between serum dilutions that provide 50% protection against Hla-mediated (0.8 pM) rRBC lysis and anti-Hla titers in mice after immunization was demonstrated.

[0017] Figure 5F-5H Hla is displayed. HRE The vaccine enhanced protective immunity against Staphylococcus aureus infection, regardless of the vaccine adjuvant. As shown, mice were given a primary vaccine 48 hours after birth and a booster vaccine at weaning, then were infected with the primary infection at 5-6 weeks of age, and then reinfected on the contralateral flank at 21 days of age. Figure 5F Provided via subcutaneous delivery 1×10 8 Data on the area of ​​skin abscesses (left) and skin necrosis (right) after reinfection with CFU Staphylococcus aureus USA300 / LAC strain in mice immunized with AddaS03 and Hla peptides. Mice were immunized with each of the following Hla variant vaccines: Hla H (purple), Hla HDY (Orange), Hla HRE (Blue) or adjuvant control only (black). Figure 5G Provided via subcutaneous delivery 1×10 8 Data on the area of ​​skin abscesses (left) and skin necrosis (right) after reinfection with CFU Staphylococcus aureus USA300 / LAC strain in mice immunized with MPLA+ alum and Hla peptide. Mice were immunized with each of the following Hla variant vaccines: Hla H (purple), Hla HDY (Orange), Hla HRE (Blue) or adjuvant control only (black). Figure 5H Provided via subcutaneous delivery 1×10 8 Data on the area of ​​skin abscesses (left) and skin necrosis (right) after reinfection with CFU Staphylococcus aureus USA300 / LAC strain in mice immunized with CpG-ODN1585 and Hla peptide. Mice were immunized with each of the following Hla variant vaccines: Hla H (purple), HlaHDY (Orange), Hla HRE (Blue) or adjuvant control only (black). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, calculated using two-way AVOVA and Tukey test for multiple comparisons, indicating Hla HRE It was statistically significant compared to each vaccine condition indicated by the legend color.

[0018] Figure 6A-6K Hla is displayed. HRE Enhanced host T FH To provide enhanced protective immunity. Figure 6A Serum dilutions of immunized mice were shown, which provided 50% protection against rRBC lysis (IC50) when exposed to 0.8 pM recombinant Hla (serum collected 1 or 3 weeks after booster). Figure 6B An analysis of serum-mediated neutralization of Hla binding to rRBCs was presented, which compared immune serum collected from mice one week after booster vaccination. Figure 6C Optical density analysis of Hla oligomer formation on rRBCs was provided, which compared... Figure 6A and Figure 6B Immune serum from mice. Figure 6D Provided using Hla H or Hla HRE Analysis of inguinal germinal center cells in mice one week after vaccine immunization, comparing CD4+ + GL7 on T cells + Fas + B. Median fluorescence intensity (MFI). Figure 6E Provided using Hla H or Hla HRE Analysis of inguinal germinal center cells in mice one week after vaccine immunization, comparing CD4+ + Ki67 on T cells + GL7 + Fas + Median fluorescence intensity (MFI) of B cells. Figure 6F Provided using Hla H or Hla HRE Analysis of inguinal germinal center cells in mice one week after vaccine immunization, comparing CD4+ + CD4 on T cells + Median fluorescence intensity (MFI) of T cells. Figure 6H Provided using Hla H or Hla HRE Analysis of inguinal germinal center cells in mice one week after vaccine immunization, comparing CD4+ +Median fluorescence intensity (MFI) of CXCR5 on T cells. Figure 6I Photographs showing the overall pathological changes of skin lesions in mice in each group 2 days after a second infection with Staphylococcus aureus are provided. Figure 6J Provided CXCR5 in mice hi Bcl6 + T FH Analysis of cell subsets (compartments). Figure 6K Provided resistance to wild-type (WT) Staphylococcus aureus, Δ hla Syngeneic variants or Δ supplements with plasmids capable of restoring hla expression hla Variants (Δ) hla:: p hla CXCR5 in newly infected mice hi Bcl6 + T FH Analysis of cell subsets. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0019] Figure 6L -M displays the output using Hla. HRE Maternal antibody protection weakens 16 weeks after vaccination. Figure 6L Flow cytometry data were provided, in which the data was labeled CXCR5. + ICOS + PD1 + T FH Cell population response to 1×10 8 It is produced by reinfecting immunized mice with Staphylococcus aureus. Figure 6M Flow cytometry data were provided, including T FH The group is using 1×10 8 Staphylococcus aureus USA300 / LAC or its Δ hla It is produced after mice are infected with the same gene variant.

[0020] Figures 7A-7G The results showed that Hla was associated with maternal vaccination and prior exposure to Staphylococcus aureus SSTI infection. HRE The vaccine is still effective. Figure 7A This is a schematic diagram showing the timeline of newborn vaccination and SSTI modeling. Figure 7B Provided display using 1×10 8 A graph showing the area of ​​skin abscesses (left) and skin necrosis (right) in mice (4-8 mice per group) after primary infection with CFU-staphylococcus aureus. Mice were born after receiving alum or alum-Hla. HRE Vaccinated mother mice; pups not vaccinated (black and blue respectively), alum-immunized (gray), or alum-HlaHRE Immunization (green). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 indicate that maternal immunization with alum was statistically significant compared to each vaccine condition indicated by color. Figure 7C Showing Figure 7B Serum dilutions in mice, when exposed to 0.8 pM recombinant Hla, provided 50% protection against rRBC lysis (IC50). Figure 7D This is a diagram illustrating the pre-exposure process, showing the timeline of primary infection, immunization program, and secondary infection in young mice. Figure 7E Provided display using 1×10 8 A graph showing the area of ​​skin abscess (left) and skin necrosis (right) in mice (13-14 mice per group) after secondary infection with CFU Staphylococcus aureus. Figure 7E Provides display 1×10 8 A graph showing the area of ​​skin abscess (left) and skin necrosis (right) in mice (13-14 mice per group) after secondary infection with CFU Staphylococcus aureus. Figure 7F Showing Figure 7E Serum dilutions in mice, when exposed to 0.8 pM recombinant Hla, provided 50% protection against rRBC lysis (IC50). Figure 7G Provided without subsequent active immunization of offspring (marked with ∅) alum (black) or alum-Hla HRE (Blue) or using alum or alum-Hla HRE Following the immunization of the mother, alum-Hla was then used. HRE Serum dilutions of offspring subjected to active immunization (gray and green, respectively) (providing 50% protection against rRBC lysis (IC50) when exposed to 0.8 pM recombinant Hla). Pre-infected sera were collected at 6, 8, 10, and 16 weeks to analyze maternal antibody lifetime. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, calculated using one-way ANOVA and Tukey's test for multiple comparisons.

[0021] Figures 8A-8E Hla is displayed. HRE Vaccines have shown efficacy in different biological environments. Figure 8A Provided display using 1×10 8 Figure showing the area of ​​skin abscess (left) and skin necrosis (right) in immunized female mice (6-8 mice per group) after infection with CFU Staphylococcus aureus. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Figure 8B Provided Figure 8ASerum dilutions in mice, when exposed to 0.8 pM recombinant Hla, provided 50% protection against rRBC lysis (IC50). Figure 8C This is a diagram showing the juvenile vaccination schedule and SSTI infection. Figure 8D Provided display using 1×10 8 Figure showing the area of ​​skin abscess (left) and skin necrosis (right) in 10 CFU Staphylococcus aureus-immunized juvenile mice. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Figure 8E Provided Figure 8D Serum dilutions in mice, when exposed to 0.8 pM recombinant Hla, provided 50% protection against rRBC lysis (IC50).

[0022] Figures 9A-9D Hla is displayed. HRE The vaccine remains effective against Staphylococcus aureus SSTI infection, while adjuvant formulations show different T values. FH answer. Figure 9A Provided display using 1×10 8 Figure 1: Skin abscess (left) and skin necrosis (right) area in mice (4-8 mice per group) infected with CFU Staphylococcus aureus. *p<0.05, **p<0.01 indicates histidine-labeled vaccine versus unlabeled HLA. HRE The difference between the vaccines is statistically significant. Figure 9B Showing Figure 9A Serum dilutions in mice, when exposed to 0.8 pM recombinant Hla, provided 50% protection against rRBC lysis (IC50). Figure 9C This shows the T cells in mice infected with Staphylococcus aureus SSTI. FH A graph showing the negative correlation between cell recovery and clinical abscess size. Figure 9D This demonstrates the anti-Hla neutralizing IC50 and T in mice infected with Staphylococcus aureus SSTI. FH A graph showing the direct correlation between responses.

[0023] The accompanying drawings are not intended to limit the inventive concept to the specific aspects disclosed and described herein. The drawings are not necessarily drawn to scale, but are intended to clearly illustrate certain aspects of the inventive concept. Detailed Implementation

[0024] The following detailed description is taken with reference to the accompanying drawings, which illustrate various aspects of this disclosure. The drawings and description are intended to describe various aspects of this disclosure in sufficient detail to enable those skilled in the art to practice this disclosure. Other components may be utilized, and changes may be made without departing from the scope of this disclosure. Therefore, the following description should not be considered limiting.

[0025] This disclosure is partly based on a surprising discovery that, in the context of previously characterized detoxified α-hemolysin (Hla) antigens with disrupted pore-forming ability, certain rationally designed modifications can effectively activate germinal center (GC) and T follicle helper (TFH) cell responses, thereby affecting long-term immunity against Staphylococcus aureus. Several pore-forming mutations in Hla have been previously characterized, and detailed descriptions of these mutants and the potency of Hla antigens containing these mutations can be found in PCT / US2002 / 066463, the disclosure of which is incorporated herein by reference in its entirety. Through extensive experimentation and thoughtful design, this disclosure provides, in the context of previously characterized detoxified α-hemolysin (Hla), a substitution mutation with a substitution at position H35 that provides robust immune protection and a significant increase in functional neutralizing responses. H35L In contrast, the substitution of two amino acids, R66C and E70C, significantly altered the vaccination outcomes, which was quite unexpected. These modifications (Hla H35L / R66C / E70C, referred to in this paper as Hla) HRE These mutants outperformed previously characterized mutants as vaccines. The data presented in this paper indicate that they affect GC and TFH responses. GCs are specialized microstructures that form in secondary lymphoid tissue and are known to provide long-lived antibody-secreting plasma cells and memory B cells, thereby inducing protection against reinfection. GC formation is heavily dependent on TFH cells. In GCs, B cells undergo somatic mutations in the genes encoding their B cell receptors, which, upon successful selection, can lead to the emergence of B cell clones that bind antigens (e.g., Hla) with high affinity. In the case of Hla, high-affinity antibodies can be neutralizing.

[0026] Staphylococcal α-hemolysin (Hla or α-toxin) is an initial member of the bacterial pore-forming β-barrel toxin family. Its structural genes... hlaLocated on the chromosome of all studied Staphylococcus aureus strains, Hla encodes a 319-amino acid precursor polypeptide. The polypeptide is secreted as a 293-residue water-soluble monomer (amino acid sequence provided in SEQ ID NO:1 – mature Hla sequence). Genetic variation studies of clinical isolates have shown significant conservation of Hla at both the nucleotide and protein levels among different strains. Hla is thought to bind to surface receptors on sensitive host cells, thereby promoting its oligomerization into heptamer pre-pores, which are β-barrel structures with a pore size of 2 nm inserted into the plasma membrane. Hla pores are formed in lymphocytes, macrophages, alveolar epithelial cells, lung endothelial cells, and erythrocytes; however, granulocytes and fibroblasts appear to be less sensitive to dominant lysis. Instillation of purified Hla into rabbit or rat lung tissue induces vascular leakage and pulmonary hypertension, attributed to the release of several signaling molecules, such as phosphatidylinositol, nitric oxide, prostaglandins (PGE2, PGI2), and thromboxane A2. Consistent with the biochemical characteristics of Hla, eliminating mutations in Hla expression in Staphylococcus aureus severely weakened the virulence of the bacteria in mouse pneumonia, skin infection, and sepsis models.

[0027] Hla utilizes ADAM10 as a cellular receptor, causing cytolytic damage and initiating ADAM10-mediated damage to target cells. While Hla is not required for Staphylococcus aureus survival, this toxin is crucial for the pathogenesis of severe skin infections, pneumonia, sepsis, peritonitis, corneal infections, and central nervous system infections in animal models. Hla's tissue tropism is a result of the almost ubiquitous cellular expression of ADAM10, making this single toxin a widely used virulence factor in the molecular pathogenesis of Staphylococcus aureus diseases and a prominent vaccine candidate. However, for effective use as a vaccine, Hla needs to be detoxified to prevent pore formation, as pore formation is intrinsically harmful to host cells.

[0028] In some aspects, this disclosure provides compositions comprising polypeptides or polynucleotides encoding polypeptides (whose amino acid sequence corresponds to an attenuated Hla polypeptide or an immunogenic variant, derivative, or fragment thereof), and methods for producing such compositions and using such compositions to provide durable protection against Staphylococcus aureus and other related bacterial infections.

[0029] Composition Modified Hla peptides and derivatives In some aspects, this disclosure includes a modified α-hemolysin (Hla) polypeptide or a derivative or fragment thereof comprising a substitution of the histidine amino acid at position 35 relative to SEQ ID NO:1, wherein position 35 is substituted by any other amino acid that destabilizes the heptamer structure, resulting in the elimination of functional pore formation (as provided in SEQ ID NO:3, where X is any amino acid); and at least one amino acid substitution of R66C or E70C relative to SEQ ID NO:1. In one aspect, the modified Hla polypeptide comprises amino acid substitutions of H35L, R66C, and E70C relative to SEQ ID NO:1 (hereinafter referred to as Hla). HRE In one instance, the modified Hla polypeptide comprises the sequence shown in SEQ ID NO:11, or a derivative or fragment thereof.

[0030] The modified Hla polypeptide may contain amino acid substitutions for H35X and R66C, or H35X and E70C. The modified Hla polypeptide may contain amino acid substitutions for H35L and R66C, or H35L and E70C. The modified Hla polypeptide may contain amino acid substitutions for H35X, R66C, and E70C. The modified Hla polypeptide may contain amino acid substitutions for H35L, R66C, and E70C. The modified Hla polypeptide may contain any of the amino acid sequences shown in SEQ ID NO:8-11, or sequences having at least about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity with them or their derivatives or fragments.

[0031] The modified Hla polypeptide may further comprise one or more modifications relative to the amino acid sequence shown in SEQ ID NO:11. Therefore, the modified Hla polypeptide may comprise an amino acid sequence as shown in any one of SEQ ID NO:12-35, or a derivative or fragment thereof. In some aspects, this disclosure includes polypeptides comprising an amino acid sequence having at least about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity with any one of SEQ ID NO:12-35, or a derivative or fragment thereof.

[0032] This document also considers derivatives or fragments of modified Hla peptides. When used herein to refer to a peptide, the terms “derivative” or “variant” and “fragment” refer to a peptide associated with a modified Hla peptide as disclosed herein, for example, by its amino acid sequence, structure (e.g., secondary and / or tertiary), activity (e.g., enzyme activity), and / or function. Derivatives, variants, and fragments of a peptide may contain one or more amino acid variations (e.g., mutations, insertions, and deletions), truncations, modifications, or combinations thereof, compared to a wild-type peptide. A single residue may be deleted, or multiple consecutive amino acids may be deleted. A stop codon may be introduced into the coding nucleic acid sequence (by substitution or insertion) to produce a truncated protein. Insertion mutants typically involve adding material at non-terminal sites of the peptide. This can include the insertion of one or more residues. Terminal additions, known as fusion proteins, may also be produced. Substitution variants or derivatives typically involve exchanging one amino acid for another at one or more sites within a protein and can be designed to modulate one or more properties of the peptide with or without loss of other disclosed functions or properties. Substitution can be conserved, i.e., one amino acid is replaced by an amino acid of similar shape and charge. Conservative substitutions are well known in the art and include changes such as: alanine to serine; arginine to lysine; asparagine to glutamine or histidine; aspartic acid to glutamic acid; cysteine ​​to serine; glutamine to asparagine; glutamic acid to aspartic acid; glycine to proline; histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine, or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and valine to isoleucine or leucine. Alternatively, substitutions can be non-conservative, affecting the function or activity of the polypeptide. Non-conservative changes typically involve replacing residues with chemically different residues, such as replacing nonpolar or uncharged amino acids with polar or charged amino acids, and vice versa.

[0033] The size of Hla protein or polypeptide (wild-type or modified) can include, but is not limited to, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 105, 110, 115, 120, 125, 130, 13 5, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 775, 800, 825, 850, 875, 900, 925, 950, 975, 1000, 1100, 1200, 1300, 1400, 1500, 1750, 2000, 2250, 2500 amino acids or more, and any range from which they can be derived, or their derivatives. It is anticipated that peptides can be mutated to be shorter than their corresponding wild-type forms, but they can also be altered by fusing or conjugating heterologous protein sequences with specific functions (e.g., ...).(For purposes such as targeting or localization, enhancing immunogenicity, and purification). Modified Hla peptide fragments may contain the 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80 of the disclosed peptide. 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 11 9, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 1 53, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 235, 235, 237, 236, 238, 238, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 2 54, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, or more consecutive amino acids. The modified Hla polypeptide according to this disclosure can be a single domain of Hla or multiple domains of Hla attached via a linker polypeptide.

[0034] The disclosed modified Hla polypeptides may further comprise amino molecules or non-amino acids to form protein compositions. As used herein, "amino molecule" means any amino acid, amino acid derivative, or amino acid mimic known in the art. In some aspects, the residues of the protein molecule are continuous, without any non-amino molecule interrupting the sequence of amino molecule residues. In other aspects, the sequence may comprise one or more non-amino molecule portions. In certain aspects, the residue sequence of the protein molecule may be interrupted by one or more non-amino molecule portions. Thus, the term "protein composition" includes an amino molecule sequence comprising at least one of the 20 common amino acids in naturally occurring synthetic proteins, or at least one modified or unusual amino acid. Protein compositions can be prepared by any technique known to those skilled in the art, including (i) expressing proteins, polypeptides, or peptides using standard molecular biology techniques, and (ii) from natural or recombinant sources (e.g., *Escherichia coli*). E. coli (iii) Chemical synthesis of protein compounds, such as those derived from insect cells, yeast, etc. Nucleotide sequences of various genes, as well as protein, polypeptide, and peptide sequences, have been previously disclosed and can be found in recognized computer databases. One such database is the GenBank and GenPept databases of the National Center for Biotechnology Information (NCBI). The coding regions of these genes can be amplified and / or expressed using the techniques disclosed herein or techniques known to those skilled in the art.

[0035] Amino acid sequence variants of Hla are envisioned, and these can be substitution, insertion, or deletion variants. Modifications in the polypeptides of this disclosure, compared to the wild type, can affect amino acid sequences 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, and 70. 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213,214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293 or more non-continuous or continuous amino acids. The methods disclosed herein are intended to utilize amino acids derived from any Staphylococcus aureus. staphylococcus Hla polypeptides of species and strains.

[0036] Variants typically lack one or more residues of the native or wild-type protein. This can involve the deletion of a single residue or multiple consecutive amino acids. A stop codon can be introduced into the coding nucleic acid sequence (through substitution or insertion) to produce a truncated protein. Insertion mutants typically involve adding material at a non-terminal point of the polypeptide. This can include the insertion of one or more residues. Terminal additions can also produce proteins called fusion proteins.

[0037] The proteins disclosed herein may be recombinant and synthesized in vivo or in vitro. Alternatively, the disclosed recombinant proteins (modified Hla polypeptides) can be isolated from bacteria. It is also contemplated that bacteria containing such variants can be used in the compositions and methods of this disclosure. Therefore, protein isolation is not required.

[0038] This disclosure also provides recombinant polynucleotides encoding the proteins, polypeptides, and peptides of this disclosure. The nucleic acid sequence of wild-type Hla is shown in SEQ ID NO:2, and nucleic acid sequences encoding any Hla variant or modified Hla polypeptide as disclosed herein are contemplated. Methods for generating polynucleotide sequences encoding the disclosed polypeptides are known in the art and are further described below.

[0039] Polynucleotides This article discloses a polynucleotide sequence comprising a nucleic acid sequence encoding the modified Hla polypeptide or a derivative or fragment thereof disclosed herein.

[0040] The polynucleotide may comprise a nucleic acid sequence encoding an amino acid sequence comprising any one of the sequences shown in SEQ ID NO:6-11, fragments thereof, derivatives thereof, or amino acid sequences having 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity with it.

[0041] As used in this application, the term "polynucleotide" refers to a recombinant or isolated nucleic acid molecule that does not contain total genomic nucleic acid. The term "polynucleotide" includes oligonucleotides and recombinant vectors, including, for example, plasmids, granules, bacteriophages, viruses, virus-like particles (VLPs), etc. This disclosure provides isolated nucleic acid segments and recombinant vectors whose sequences comprise a continuous nucleic acid sequence encoding any one or a fragment thereof, or a derivative thereof, of SEQ ID NO: 6-35, or having 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity with them. In some aspects, the polynucleotide may further include regulatory sequences that have been substantially isolated from their naturally occurring gene or protein-coding sequences. The polynucleotide may be RNA, DNA, analogues thereof, or combinations thereof.

[0042] In this regard, the terms "gene," "polynucleotide," or "nucleic acid" are used to refer to nucleic acids (including any sequences required for proper transcription, post-translational modification, or localization) that encode proteins, polypeptides, or peptides. As those skilled in the art will understand, the term includes genomic sequences, expression cassettes, cDNA sequences, and smaller engineered nucleic acid segments that express or are suitable for expressing proteins, polypeptides, domains, peptides, fusion proteins, and mutants. Nucleic acids encoding all or part of a polypeptide may comprise continuous nucleic acid sequences encoding all or part of such polypeptides of the following lengths: 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 29... 0, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 6 50, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000, 101 0, 1020, 1030, 1040, 1050, 1060, 1070, 1080, 1090, 1095, 1100, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 9000, 10000 or more nucleotides, nucleosides or base pairs. It is also envisioned that a specific polypeptide from a given species could be encoded by nucleic acids containing natural variations, having slightly different nucleic acid sequences but still encoding the same or substantially similar proteins.

[0043] In some aspects, this disclosure provides isolated nucleic acid segments and recombinant vectors incorporating nucleic acid sequences encoding the disclosed modified Hla polypeptide or any variant or fragment thereof as provided herein. Thus, the isolated nucleic acid segments or vectors containing the nucleic acid segments can encode, for example, modified Hla polypeptides containing an H35X substitution, where X is any suitable amino acid, an R66C or E70C substitution, and possessing immunogenicity. In some aspects, the isolated nucleic acid segments or vectors containing the nucleic acid segments can encode, for example, Hla (H35L) polypeptides containing an R66C or E70C substitution and possessing immunogenicity.

[0044] The term "recombinant" can be used in conjunction with the name of a polypeptide or a specific polypeptide, and this generally refers to a polypeptide produced from a nucleic acid molecule manipulated in vitro or a replication product of such a molecule. In other aspects, this disclosure relates to isolated nucleic acid segments and recombinant vectors incorporating nucleic acid sequences encoding modified Hla polypeptides that can be used to generate an immune response in subjects. In various aspects, the nucleic acids of this disclosure can be used in gene vaccines.

[0045] The nucleic acid segments used in this disclosure, regardless of the length of the coding sequence itself, can be combined with other nucleic acid sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, and other coding segments, so that their total length can vary considerably. Therefore, it is conceivable to use nucleic acid fragments of almost any length, with the total length preferably limited by the convenience of preparation and use in the intended recombinant nucleic acid scheme. In some cases, the nucleic acid sequence can encode a polypeptide sequence having an additional heterologous coding sequence, for example, to allow for the purification, transport, secretion, post-translational modification of the polypeptide, or for therapeutic benefits, such as targeting or potency. As mentioned above, tags or other heterologous polypeptides can be added to the modified polypeptide coding sequence, where "heterologous" means a polypeptide different from the modified polypeptide.

[0046] In some respects, the nucleic acids used in this disclosure encode modified Hla polypeptides or derivatives or fragments thereof as disclosed herein. Such sequences can be generated as a result of codon redundancy and functional equivalence, which are known to be naturally present in nucleic acid sequences and the proteins they encode. Alternatively, functionally equivalent proteins or peptides can be generated by applying recombinant DNA technology, where changes in protein structure can be designed based on considerations of the properties of the exchanged amino acids. Human-designed alterations can be introduced by applying site-directed mutagenesis techniques, for example, to introduce improvements in the antigenicity of the protein.

[0047] In some respects, the term "functionally equivalent codon" is used herein to refer to codons encoding the same amino acid, such as the six codons for arginine or serine, and also to codons encoding biologically equivalent amino acids. It should also be understood that amino acid and nucleic acid sequences may each include additional residues, such as additional N-terminal or C-terminal amino acids, or 5' or 3' sequences, and are substantially as shown in one of the sequences disclosed herein, provided that the sequence meets the foregoing criteria, including maintaining biological protein activity in relation to protein expression. The addition of terminal sequences is particularly applicable to nucleic acid sequences, which may include various non-coding sequences flanking the 5' or 3' portion of the coding region.

[0048] The following discussion focuses on altering the amino acids of proteins to produce equivalent or even improved second-generation molecules. For example, certain amino acids can replace other amino acids in a protein structure without significantly losing their ability to interact with structures such as antigen-binding regions of antibodies or binding sites on substrate molecules. Since the interacting abilities and properties of a protein determine its biological activity, certain amino acid substitutions can be made in the amino acid sequence and its associated DNA coding sequence, still producing proteins with similar properties. Therefore, the inventors envision various alterations being made to the DNA sequence of genes or nucleic acids without significantly losing their biological utility or activity.

[0049] In some aspects, this disclosure includes isolated polynucleotides, plasmids, viruses, virus-like particles (VLPs), viral vectors, granules, and bacteriophages containing nucleic acid sequences encoding polypeptides, said polypeptides having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with any one of SEQ ID NOS: 6-35 or its derivatives or fragments.

[0050] The nucleic acid sequence encoding the disclosed modified Hla polypeptide can be operatively linked to one or more regulatory sequences. Ooperative linking means juxtaposition, where the components so described are in a relationship that allows them to function in a desired manner. The operative linking of the expression control sequence to the coding sequence is achieved under conditions compatible with the expression control sequence. As used herein, an expression control sequence refers to a nucleic acid sequence that regulates the expression of the nucleic acid sequence to which it is operatively linked. The expression control sequence is operatively linked to the nucleic acid sequence when it controls and regulates the transcription and translation (as applicable) of the nucleic acid sequence. Therefore, the expression control sequence may include appropriate promoters, enhancers, transcription terminators, start codons (i.e., ATGs) preceding the protein-coding gene, splicing signals for introns, and stop codons that maintain the correct reading frame of the gene to allow correct translation of the mRNA. The term "control sequence" is intended to include at least the components whose presence can affect expression, and may also include additional components whose presence is advantageous, such as leader sequences and fusion chaperone sequences. The expression control sequence may include a promoter.

[0051] In some respects, vectors containing nucleic acid sequences encoding modified Hla can be plasmids, granules, yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), viral vectors, or bacteriophages. Vectors can provide for the replication of the polynucleotide sequence encoding the modified Hla polypeptide, Hla polypeptide expression, or integration of the Hla nucleic acid into the host cell chromosome. The choice of vector depends on the desired purpose. Certain cloning vectors can be used to clone, mutate, and manipulate Hla nucleic acids. Other vectors can be used to express Hla polypeptides, to express polypeptides in large quantities for purification purposes, or to express Hla polypeptides in a time- or tissue-specific manner. Vectors can also be selected based on the host cell, for example, to facilitate expression in bacterial, mammalian, insect, fish (e.g., zebrafish), and / or amphibian cells. The selection of a vector that matches the host cell will be apparent to those skilled in the art, and the types of host cells will be discussed below. Many vectors or vector systems are commercially available, such as the pET bacterial expression system (Invitrogen™, Carlsbad CA).

[0052] The vectors disclosed herein may be viral or non-viral vectors. For example, as described above, the disclosed vectors may be viral vectors. There are numerous compositions and methods available for delivering nucleic acids to cells in vitro or in vivo. These methods and compositions can be broadly categorized into two classes: virus-based delivery systems and non-virus-based delivery systems. For example, nucleic acids can be delivered by a variety of direct delivery systems, such as electroporation, liposome transfection, calcium phosphate precipitation, plasmids, viral vectors, viral nucleic acids, bacteriophage nucleic acids, bacteriophages, granules, or by transfer of genetic material in cells or via a carrier (e.g., cationic liposomes). Suitable transfection methods, including viral vectors, chemical transfectants, or physicomechanical methods such as electroporation and direct diffusion of DNA, are described, for example, by Wolff, JA et al., Science, 247, 1465-1468, (1990), and Wolff, JA Nature, 352, 815-818, (1991). These methods are well known in the art and are readily adaptable for use with the compositions and methods described herein. In some cases, these methods will be modified to function specifically for large DNA molecules. Furthermore, these methods can be used to target certain neurodegenerative diseases or conditions and cell populations by leveraging the targeting properties of the carrier.

[0053] Vectors may include various components, including but not limited to origins of replication, one or more markers or selective genes (e.g., GFP, neo), promoters, enhancers, terminators, polyadenylated sequences, repressors, or activators. These elements are provided in the vector to be operatively linked to the coding region of a Fla1a-encoding nucleic acid, thereby promoting expression in host cells of interest. Cloning and expression vectors may contain origins of replication, which enable the vector to replicate in host cells. Vectors may also include optional markers, for example, to confer drug resistance or to compensate for defects in growth. Examples of drug resistance markers include, but are not limited to, ampicillin, tetracycline, neomycin, or methotrexate. Examples of other marker genes may be fluorescent peptides, such as members of the fluorescent protein family, such as GFP, YFP, BFP, RFP, etc. These markers may be contained in the same vector as the gene of interest, or they may be contained in a separate vector and co-transfected with a vector containing the gene of interest.

[0054] The vector may contain a promoter (which may be operatively linked) suitable for expressing Hla in mammalian cells to provide inducible or constitutive expression of the disclosed modified Hla peptide. Exemplary inducible promoters include, for example, metallothionein promoters or ecdysone-responsive promoters. Exemplary constitutive promoters include, for example, viral promoters derived from cytomegalovirus (CMV), Rous sarcoma virus (RSV), simian virus 40 (SV40), avian sarcoma virus, β-actin promoters, and heat shock promoters. Promoters can be selected based on their tissue specificity. Some promoters are expressed only in certain tissues, and one of these promoters can be used when it is necessary to express the peptide of interest only in selected tissues. The selection of promoters for the desired host cell system will be apparent to those skilled in the art.

[0055] Vectors encoding modified H1a peptides can be viral vectors. Examples of viral vectors include retroviral vectors such as adenovirus, adeno-associated virus (AAV), simian virus 40 (SV40), cytomegalovirus (CMV), Moloney murine leukemia virus (MoMuLv), Rous sarcoma virus (RSV), lentivirus, herpesvirus, poxvirus, and vaccinia virus. Viral vectors can be used to promote expression in target cells, for example, for the production of modified H1a peptides or for therapeutic purposes (e.g., delivery of modified H1a peptides to a subject via expression by the vector). In cases of therapeutic use, the H1a-encoding vector (e.g., a viral vector) can be administered directly to the patient via an appropriate route, or administered using an ex vivo strategy using cells (autologous) or allogeneic cells suitable for administration to the patient to be treated. In some aspects, vectors encoding modified H1a peptides can be virus-like particles or VLPs. The term VLP is used as is commonly known in the art and corresponds to small particles containing certain proteins derived from the viral capsid. Virus-like particles do not contain any genetic material from the virus and do not cause infection.

[0056] As used herein, plasmids or viral vectors are agents that transport disclosed nucleic acids, such as nucleic acid sequences capable of encoding one or more disclosed peptides, into cells without degradation and include promoters that produce gene expression in the cells to which they are delivered. In some respects, the nucleic acid sequences disclosed herein are derived from any viral family that shares characteristics that make them suitable for use as vectors. Retroviruses include Maronie mouse leukemia virus, MMLV, and retroviruses expressing MMLV as desired as vectors. Retroviral vectors are capable of carrying larger genetic payloads, i.e., transgenic or marker genes, than other viral vectors and are a commonly used vector for this reason. However, they are less useful in non-proliferating cells. Adenoviral vectors are relatively stable and easy to use, have high titers, can be delivered in aerosol form, and can transfect non-dividing cells. Poxvirus vectors are large and have several sites for gene insertion; they are thermostable and can be stored at room temperature. Viral vectors can be formulated into pharmaceutical compositions as described above.

[0057] Retroviral vectors are commonly described by Verma, IM, Retroviral vectors for gene transfer. In Microbiology, Amer. Soc. for Microbiology, pp. 229-232, Washington, (1985), the entire contents of which are incorporated herein by reference. Examples of methods for gene therapy using retroviral vectors are described in U.S. Patent Nos. 4,868,116 and 4,980,286, and PCT applications WO 90 / 02806 and WO89 / 07136; their teachings on methods for gene therapy using retroviral vectors are incorporated herein by reference in their entirety.

[0058] This disclosure provides an adeno-associated virus (AAV) vector comprising, substantially comprising, or consisting of a nucleic acid sequence encoding the disclosed modified Hla polypeptide. When the AAV vector consists substantially of a nucleic acid sequence encoding the disclosed modified Hla polypeptide, it may contain additional components (e.g., genetic elements, such as poly(A) sequences or restriction enzyme sites, which facilitate manipulation of the vector in vitro) that do not materially affect the AAV vector. When the AAV vector consists of a nucleic acid sequence encoding a polypeptide, the AAV vector does not contain any additional components (i.e., components that are not endogenous to AAV and are not required to achieve expression of the nucleic acid sequence to thereby provide Hla).

[0059] Other useful systems include, for example, replicating and host-restricted non-replicating vaccinia virus vectors. Furthermore, the disclosed nucleic acid sequences can be delivered to target cells in non-nucleic acid-based systems. For example, the disclosed polynucleotides can be delivered via electroporation, liposome transfection, or calcium phosphate precipitation. The chosen delivery mechanism will depend in part on the type of cells targeted and whether delivery is performed, for example, in vivo or in vitro.

[0060] Suitable methods for nucleic acid delivery to achieve expression of the compositions disclosed herein include, in fact, any method as described herein or known to those skilled in the art that can introduce nucleic acids (e.g., DNA, including viral and non-viral vectors) into cells, tissues, or organisms. Such methods include, but are not limited to, direct delivery of DNA, such as by injection (US Patent Nos. 5,994,624, 5,981,274, 5,945,100, 5,780,448, 5,736,524, 5,702,932, 5,656,610, 5,589,466, and 5,580,859, each incorporated herein by reference), including microinjection (Harland and Weintraub, 1985; US Patent No. 5,789,215, incorporated herein by reference); by electroporation (US Patent No. 5,384,253, incorporated herein by reference); by calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe et al., 1990); by using DEAE dextran followed by polyethylene glycol (Gopal, 1985); by direct acoustic loading (Fechheimer et al., 1987); by liposome-mediated transfection (Nicolau and Sene, 1982; Fraley et al., 1979; Nicolau et al., 1987; Wong et al., 1980; Kaneda et al., 1989; Kato et al., 1991); by microbullet bombardment (PCT applications WO 94 / 09699 and 95 / 06128; US patents 5,610,042, 5,322,783, 5,563,055, 5,550,318, 5,538,877 and 5,538,880, each of which is incorporated herein by reference); by stirring with silicon carbide fibers (Kaeppler et al., 1985); by direct acoustic loading (Fechheimer et al., 1987); by liposome-mediated transfection (Nicolau and Sene, 1982; Fraley et al., 1979; Nicolau et al., 1987; Wong et al., 1980; Kaneda et al., 1989; Kato et al., 1991); by microbulb bombardment (PCT applications WO 94 / 09699 and 95 / 06128; US patents 5,610,042, 5,322,783, 5,563,055, 5,550,318, 5,538,877 and 5,538,880, each of which is incorporated herein by reference); by stirring with silicon carbide fibers (Kaeppler et al., 1985); by direct acoustic loading (Fechheimer et al., 1987); by direct acoustic loading (Fechheimer et al. 1990; U.S. Patent Nos. 5,302,523 and 5,464,765, each incorporated herein by reference; transformation mediated by Agrobacterium (U.S. Patent Nos. 5,591,616 and 5,563,055, each incorporated herein by reference); protoplast transformation mediated by PEG (Omirulleh et al., 1993; U.S. Patent Nos. 4,684,611 and 4,952,500, each incorporated herein by reference); or DNA uptake mediated by drying / inhibition (Potrykus et al., 1985). By applying techniques such as these, organelles, cells, tissues, or organisms can be stably or transiently transformed.

[0061] Therefore, in addition to the disclosed expression vector, the polynucleotide composition may also contain lipids, such as liposomes, including cationic liposomes (e.g., DOTMA, DOPE, DC cholesterol) or anionic liposomes. If desired, the liposomes may further contain proteins to facilitate targeting of specific cells. Compositions containing peptides and cationic liposomes can be administered to blood or target organs. For information on liposomes, see, for example, Brigham et al., Am. J. Resp. Cell. Mol. Biol. 1:95-100 (1989); Feigner et al., Proc. Natl. Acad. Sci. USA 84:7413-7417 (1987); U.S. Patent No. 4,897,355. Furthermore, the compound can be administered as a component of microcapsules that can target specific cell types, such as macrophages, or in which the diffusion of the compound or delivery of the compound from the microcapsule is designed for a specific rate or dose.

[0062] Host cells modified to provide expression of the disclosed modified Hla peptide are also envisioned. Such host cells can be modified to express the Hla peptide from free nucleic acid or nucleic acid integrated into the genome. Such host cells can be generated by any suitable method, such as electroporation, transfection or transformation with a vector encoding the disclosed modified Hla peptide. Host cells can be selected according to the desired use (e.g., mammalian cell expression) and modified to provide Hla expression according to methods well known in the art. Techniques for introducing a vector into host cells and subsequently culturing the host cells are well known in the art.

[0063] Host cells (e.g., mammalian host cells) suitable for replicating and expressing Hla-containing vectors are provided, wherein the cells can stably or transiently express and / or stably or transiently express the disclosed modified Hla polypeptide. Such Hla-expressing mammalian cells can be used, for example, to produce the modified Hla polypeptide. Hla production in mammalian cells can provide post-translational modifications of Hla and / or heterologous amino acids fused thereto (e.g., glycosylation, cleavage of the signal peptide, if present)). Furthermore, mammalian cell lines can be selected for replication, packaging, and production of high-titer viral particles containing the disclosed modified Hla polypeptide of interest or nucleic acid encoding the disclosed modified H1a polypeptide. This Hla-containing virus can then be used to provide delivery of nucleic acid encoding Hla and the Hla polypeptide to subjects in need.

[0064] Exemplary host cells include bacteria, yeast, mammalian cells (e.g., human cells or cell lines), insect cells, etc. Examples of bacterial host cells include *Escherichia coli* and other bacteria that can be used to clone, manipulate, and produce Hla nucleic acids or produce Hla peptides. Examples of mammalian cells include, but are not limited to, Chinese hamster ovary (CHO) cells, HEK 293 cells, human cervical cancer cells (HeLa), canine kidney cells (MDCK), human hepatocytes (HepG2), young hamster kidney cells (BHK) and monkey kidney cells (CV1), Vero, CEM, 721.221, H9, Jurkat, Raji, W138, COS-7, 293, HepG2, 3T3, and RIN cells.

[0065] Immunogenic and / or pharmaceutical compositions In some aspects, this disclosure also includes immunogenic and pharmaceutical compositions comprising the modified H1a polypeptide or polynucleotide encoding the modified H1a polypeptide disclosed herein, and at least one pharmaceutically acceptable excipient.

[0066] Pharmaceutically acceptable excipients can be adjuvants, diluents, binders, fillers, buffers, pH adjusters, disintegrants, dispersants, preservatives, lubricants, flavor masking agents, flavoring agents, or coloring agents. The amount and type of excipients used to form the pharmaceutical composition can be selected based on known pharmaceutical principles. In each aspect described herein, in addition to Hla, the compositions disclosed herein may optionally contain one or more other pharmaceutical or therapeutically active agents. Thus, in addition to the therapies described herein, subjects may be provided with other therapies known to be effective in treating diseases, symptoms, or conditions.

[0067] In one respect, pharmaceutically acceptable excipients are adjuvants. Any functional adjuvant that enhances the immunogenicity of the composition may be added to the immunogenicity and / or pharmaceutical composition. Non-limiting examples of adjuvants for use with the disclosed modified Hla peptides or polynucleotides include alum, monophospholipid A (MPL), AddaSO3 (AS03-like), MPLA+alum (AS04-like), CpG-ODN1585, ADJUPHOS®, aluminum hydroxide, Advax, MF9, IL-1, IL-2, IL-4, IL-7, IL-12, g-interferon, GMCSP, BCG, MDP compounds such as thur-MDP and nor-MDP, CGP (MTP-PE), and lipid A, or any combination thereof.

[0068] In some respects, the excipient can be a diluent. The diluent can be compressible (i.e., plastically deformable) or easily ground and crumbly. Non-limiting examples of suitable compressible diluents include microcrystalline cellulose (MCC), cellulose derivatives, cellulose powder, cellulose esters (i.e., mixed esters of acetate and butyrate), ethyl cellulose, methyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, sodium carboxymethyl cellulose, corn starch, phosphorylated corn starch, pregelatinized corn starch, rice starch, potato starch, tapioca starch, starch-lactose, starch-calcium carbonate, sodium glycolate starch, glucose, fructose, lactose, lactose monohydrate, sucrose, xylose, lactitol, mannitol, maltitol, sorbitol, xylitol, maltodextrin, and trehalose. Non-limiting examples of suitable easily ground and crumbly diluents include dicalcium phosphate (anhydrous or dihydrate), tricalcium phosphate, calcium carbonate, and magnesium carbonate.

[0069] In some respects, excipients can be binders. Suitable binders include, but are not limited to, starch, pregelatinized starch, gelatin, polyvinylpyrrolidone, cellulose, methylcellulose, sodium carboxymethyl cellulose, ethylcellulose, polyacrylamide, polyvinyloxazolidinone, polyvinyl alcohol, C12-C18 fatty acid alcohols, polyethylene glycol, polyols, sugars, oligosaccharides, polypeptides, oligopeptides, and combinations thereof.

[0070] In some respects, excipients can be fillers. Suitable fillers include, but are not limited to, carbohydrates, inorganic compounds, and polyvinylpyrrolidone. As non-limiting examples, fillers can be calcium sulfate (dibasic and tribasic calcium sulfate), starch, calcium carbonate, magnesium carbonate, microcrystalline cellulose, calcium hydrogen phosphate, magnesium carbonate, magnesium oxide, calcium silicate, talc, modified starch, lactose, sucrose, mannitol, or sorbitol.

[0071] In some respects, excipients can be buffers. Representative examples of suitable buffers include, but are not limited to, phosphates, carbonates, citrates, Tris buffers, and buffered saline solutions (e.g., Tris buffered saline or phosphate buffered saline).

[0072] In some respects, excipients can be pH adjusters. As non-limiting examples, pH adjusters can be sodium carbonate, sodium bicarbonate, sodium citrate, citric acid, or phosphoric acid.

[0073] In some respects, the excipient may be a disintegrant. Disintegrants may be non-effervescent or effervescent. Suitable examples of non-effervescent disintegrants include, but are not limited to, starches such as corn starch, potato starch, their pregelatinized and modified starches, sweeteners, clays such as bentonite, microcrystalline cellulose, alginate, sodium glycolate starch, and gums such as agar, guar gum, locust bean gum, carrageenan, pectin, and tragacanth gum. Non-limiting examples of suitable effervescent disintegrants include combinations of sodium bicarbonate and citric acid, and combinations of sodium bicarbonate and tartaric acid.

[0074] In some respects, excipients can be dispersants or dispersion enhancers. Suitable dispersants may include, but are not limited to, starch, alginate, polyvinylpyrrolidone, guar gum, kaolin, bentonite, purified wood cellulose, sodium glycolate starch, isoamorphous silicate, and microcrystalline cellulose.

[0075] In some respects, excipients can be preservatives. Non-limiting examples of suitable preservatives include antioxidants such as BHA, BHT, vitamin A, vitamin C, vitamin E, or retinyl palmitate, citric acid, sodium citrate; chelating agents such as EDTA or EGTA; and antimicrobial agents such as parabens, chlorobutanol, or phenol.

[0076] In some respects, excipients can be lubricants. Non-limiting examples of suitable lubricants include minerals, such as talc or silica; and fats, such as vegetable stearin, magnesium stearate, or stearic acid.

[0077] In some respects, excipients can be flavor maskers. Flavor masking materials include cellulose ethers; polyethylene glycol; polyvinyl alcohol; copolymers of polyvinyl alcohol and polyethylene glycol; monoglycerides or triglycerides; acrylic polymers; mixtures of acrylic polymers and cellulose ethers; cellulose acetate phthalate; and combinations thereof.

[0078] In some respects, excipients can be flavoring agents. Flavoring agents can be selected from synthetic flavor oils and spices and / or natural oils, extracts from plants, leaves, flowers, fruits, and combinations thereof.

[0079] In some respects, excipients can be colorants. Suitable colorants include, but are not limited to, colorants for food, pharmaceutical and cosmetic use (FD&C), colorants for pharmaceutical and cosmetic use (D&C), or colorants for topical pharmaceutical and cosmetic use (Ext.D&C).

[0080] The weight fraction of excipients or combinations of excipients in the composition may be about 99% or less, about 97% or less, about 95% or less, about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 45% or less, about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, about 5% or less, about 2% or about 1% or less, or about 1% or less, of the total weight of the composition.

[0081] The compositions described herein may be formulated in any conventional manner using one or more pharmaceutically acceptable carriers or excipients, such as those described in, for example, Remington's Pharmaceutical Sciences (edited by ARGennaro), 21st edition, ISBN: 0781746736 (2005), all of which are incorporated herein by reference. Such formulations will contain a therapeutically effective amount of the bioactive agent described herein (which may be in a purified form), and a suitable amount of carrier to provide a form suitable for administration to a subject.

[0082] The term "formulation" refers to a medicine prepared in a form suitable for administration to a subject, such as a human. Therefore, "formulation" can include pharmaceutically acceptable excipients, including diluents or carriers.

[0083] As used herein, the term "pharmaceuticalally acceptable" can describe a substance or component that does not cause an unacceptable loss of pharmacological activity or unacceptable adverse side effects. Examples of pharmaceutically acceptable ingredients may be those monographed in the United States Pharmacopeia (USP 29) and the United States Formulary (NF 24), the United States Pharmacopeial Convention, Inc., Rockville, Maryland, 2005 (“USP / NF”), or later editions, as well as those listed in the FDA’s continuously updated online database of inactive ingredients. Other useful ingredients not described in USP / NF, etc., may also be used.

[0084] As used herein, the term "pharmaceutically acceptable excipient" can include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents, or absorption delay agents. The use of such media and agents in pharmaceutical active substances is well known in the art (for general information see Remington's Pharmaceutical Sciences (edited by ARGennaro), 21st edition, ISBN: 0781746736 (2005)). The use of any conventional media or agent in a therapeutic composition is contemplated unless it is incompatible with the active ingredient. Complementary active ingredients may also be incorporated into the composition.

[0085] A “stable” formulation or composition may refer to a composition that has sufficient stability to allow storage at a convenient temperature (e.g., between about 0°C and about 60°C) for a commercially reasonable period of time, such as at least about one day, at least about one week, at least about one month, at least about three months, at least about six months, at least about one year, or at least about two years.

[0086] The formulation should be adapted to the mode of administration. The pharmaceutical agents used in this disclosure can be formulated by known methods for administration to subjects via a variety of routes, including but not limited to parenteral, pulmonary, oral, topical, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, ocular, sublingual, and rectal administration. The agent alone can also be administered in combination with one or more other agents or with other biologically active or biologically inert agents. Such biologically active or inert agents can be in fluid or mechanical communication with the agent, or can adhere to the agent by ionic forces, covalent forces, van der Waals forces, hydrophobic forces, hydrophilic forces, or other physical forces.

[0087] Controlled-release (or sustained-release) formulations can be formulated to prolong the activity of a drug and reduce the frequency of administration. Controlled-release formulations can also be used to influence the onset of action or other characteristics, such as blood levels of the drug, and thus affect the occurrence of side effects. Controlled-release formulations can be designed to initially release a fixed amount of drug to produce the desired therapeutic effect, and then gradually and continuously release additional amounts of drug to maintain the level of therapeutic effect over an extended period of time. To maintain a nearly constant drug level in the body, the drug can be released from the dosage form at a rate that replaces the amount of drug that is metabolized or excreted from the body. Controlled release of a drug can be stimulated by various inducing factors, such as changes in pH, temperature, enzymes, water, or other physiological conditions or molecules.

[0088] application Dosage form Compositions can be formulated into various dosage forms and administered via a number of different methods that deliver a therapeutically effective amount of the active ingredient. Such compositions can be administered orally (e.g., by inhalation), parenterally, or topically, as needed, in dosage units containing conventionally non-toxic, pharmaceutically acceptable carriers, adjuvants, and mediators. Topical administration can also involve percutaneous administration, such as the use of percutaneous patches or iontophoresis devices. As used herein, the term parenterally includes subcutaneous, intravenous, intramuscular, intra-articular, or intrasternal injection or infusion techniques. Formulations of pharmaceuticals are discussed, for example, in Gennaro, AR, Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. (18th edition, 1995) and Liberman, HA and Lachman, L, eds., Pharmaceutical Dosage Forms, Marcel Dekker Inc., New York, NY (1980). In certain aspects, the composition may be a food supplement, or the composition may be a cosmetic.

[0089] Solid dosage forms for oral administration include capsules, tablets, capsules, pills, powders, pellets, and granules. In such solid dosage forms, the active ingredient is typically combined with one or more pharmaceutically acceptable excipients, examples of which are detailed above. Oral formulations can also be administered as aqueous suspensions, elixirs, or syrups. For these, the active ingredient can be combined with various sweeteners or flavorings, colorings, and, if necessary, emulsifiers and / or suspending agents, as well as diluents such as water, ethanol, glycerin, and combinations thereof. For administration by inhalation, the compound is delivered as an aerosol spray from a pressurized container or dispenser or nebulizer containing a suitable propellant (e.g., a gas, such as carbon dioxide).

[0090] For parenteral administration (including skin, subcutaneous, intraocular, intradermal, intravenous, intramuscular, intra-articular, and intraperitoneal), the formulation may be an aqueous solution or an oil-based solution. Aqueous solutions may include sterile diluents such as water, saline solution, pharmaceutically acceptable polyols such as glycerol, propylene glycol, or other synthetic solvents; antibacterial and / or antifungal agents such as benzyl alcohol, methylparaben, chlorobutanol, phenol, thimerosal, etc.; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates, or phosphates; and / or agents for tension adjustment such as sodium chloride, dextran, or polyols such as mannitol or sorbitol. The pH of the aqueous solution may be adjusted with an acid or base, such as hydrochloric acid or sodium hydroxide. Oil-based solutions or suspensions may further contain sesame oil, peanut oil, olive oil, or mineral oil. The composition can be present in single-dose or multi-dose containers, such as sealed ampoules and vials, and can be stored under lyophilized (freeze-dried) conditions, requiring only the addition of the accompanying sterile liquid, such as water for injection, just before use. Immediate-use solutions and suspensions can be prepared from sterile powders, granules, and tablets.

[0091] For topical (e.g., transdermal or transmucosal) application, formulations typically contain a penetrant suitable for the barrier to be penetrated. Pharmaceutical compositions suitable for topical application can be formulated as ointments, creams, suspensions, lotions, powders, solutions, pastes, gels, sprays, aerosols, or oils. In some aspects, pharmaceutical compositions are applied as topical ointments or creams. When formulated as an ointment, the active ingredient can be used with a paraffin or water-miscible ointment base. Alternatively, the active ingredient can be formulated as a cream having an oil-in-water or water-in-oil base. Pharmaceutical compositions suitable for topical application to the eye include eye drops, wherein the active ingredient is dissolved or suspended in a suitable carrier, particularly an aqueous solvent. Pharmaceutical compositions suitable for topical application in the oral cavity include lozenges, tablets, and mouthwashes. Transmucosal application can be achieved by using nasal sprays, aerosol sprays, tablets, or suppositories, and transdermal application can be achieved by ointments, creams, gels, patches, or creams as known in the art.

[0092] In some aspects, compositions comprising modified H1a peptides or modified H1a polynucleotides or variants thereof can be encapsulated in suitable media to aid in the delivery of the compound to target cells, to increase the stability of the composition, or to minimize the potential toxicity of the composition. As those skilled in the art will understand, a variety of media are suitable for delivering the compositions disclosed herein. Non-limiting examples of suitable structured fluid delivery systems may include nanoparticles, liposomes, microemulsions, micelles, dendritic polymers, and other phospholipid-containing systems. Methods of incorporating compositions into delivery media are known in the art.

[0093] In some applications, liposomes can be used as delivery mediators. Due to their structure and chemical properties, liposomes (depending on the application) are well-suited for delivering modified H1a peptides or modified H1a polynucleotides. Generally, liposomes are spherical vesicles with a phospholipid bilayer. The lipid bilayer of a liposome can be fused with other bilayers (e.g., cell membranes) to deliver the contents of the liposome into the cell. In this way, compositions containing H1a or variants thereof can be selectively delivered into cells by encapsulation in liposomes fused to the membrane of the target cell.

[0094] Liposomes can contain a variety of different types of phospholipids with varying hydrocarbon chain lengths. Phospholipids typically consist of two fatty acids linked by glycerol phosphate to one of a variety of polar groups. Suitable phospholipids include phosphatidic acid (PA), phosphatidylserine (PS), phosphatidylinositol (PI), phosphatidylinositol (PG), diphosphatidylglycerol (DPG), phosphatidylcholine (PC), and phosphatidylethanolamine (PE). The fatty acid chains containing phospholipids can range in length from about 6 to about 26 carbon atoms, and the lipid chains can be saturated or unsaturated. Suitable fatty acid chains include (common names shown in parentheses) n-Lauryl ester, n-Tridecanoate, n-Palmyl ester, n-Octadecanoate, n-Arachidoate, n-Dodecanoate, n-Tetradecanoate, cis-9-hexadecenoic acid, cis-9-octadecenoate, cis-9,12-octadecadienoate, cis-9,12,15-octadecanetrienoic acid, and cis-5,8,11,14-eicosatetraenoate. The two fatty acid chains of a phospholipid can be the same or different. Acceptable phospholipids include dioleoyl PS, dioleoyl PC, distearyl PS, distearyl PC, dimyristic PS, dimyristic PC, dipalmitoyl PG, stearoyl, oleoyl PS, palmitoyl, linoleoyl PS, etc.

[0095] Phospholipids can be derived from any natural source and therefore can be mixtures of phospholipids. For example, egg yolks are rich in PC, PG, and PE; soybeans contain PC, PE, PI, and PA; and animal brains or spinal cords are rich in PS. Phospholipids can also be derived from synthetic sources. Mixtures of individual phospholipids with different ratios can be used. Mixtures of different phospholipids can produce liposome compositions with favorable activity or stability of active properties. The phospholipids described above can be mixed with cationic lipids in an optimal ratio, such as N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride, 1,1'-di(octadecyl)-3,3,3',3'-tetramethylindole carbocyanine perchlorate, 3,3'-diheptyloxacarbocyanine iodide, 1,1'-di(dodecyl)-3,3,3',3'-tetramethylindole carbocyanine perchlorate, 1,1'-dioleoyl-3,3,3',3'-tetramethylindole carbocyanine methanesulfonate, N-4-(dilinoleoylaminostyryl)-N-methylpyridine iodide, or 1,1'-dilinoleoyl-3,3,3',3'-tetramethylindole carbocyanine perchlorate.

[0096] Liposomes may optionally contain sphingolipids (where sphingosine is the structural counterpart of glycerol and one of the fatty acids of glycerophosphate esters) or cholesterol (a major component of animal cell membranes). Liposomes may optionally contain PEGylated lipids, which are lipids covalently linked to a polymer of polyethylene glycol (PEG). The size of the PEG can range from about 500 to about 10,000 Daltons.

[0097] Liposomes may further contain a suitable solvent. The solvent may be an organic or inorganic solvent. Suitable solvents include, but are not limited to, dimethyl sulfoxide (DMSO), methylpyrrolidone, N-methylpyrrolidones, acetonitrile, alcohols, dimethylformamide, tetrahydrofuran, or combinations thereof.

[0098] Liposomes carrying one or more of tricyclic antipsychotics, vasodilators, antibiotics / antibacterial agents, arylpiperazines, or derivatives thereof can be prepared by any known method for preparing liposomes for drug delivery, detailed in, for example, U.S. Patent Nos. 4,241,046, 4,394,448, 4,529,561, 4,755,388, 4,828,837, 4,925,661, 4,954,345, 4,957,735, 5,043,164, 5,064,655, 5,077,211, and 5,264,618, the entire disclosure of which is incorporated herein by reference. For example, liposomes can be prepared by sonicating lipids in an aqueous solution, solvent injection, lipid hydration, reverse evaporation, or freeze-drying by repeated freezing and thawing. In a preferred aspect, liposomes are formed by sonication. Liposomes can be multilayered, having many layers like an onion, or they can be monolayered. Liposomes can be large or small. Sustained high-shear sonication tends to form smaller monolayer liposomes.

[0099] As will be apparent to those skilled in the art, all parameters controlling liposome formation can be varied. These parameters include, but are not limited to, temperature, pH, concentration of one or more protein toxicity depressants or their derivatives, concentration and composition of lipids, concentration of polyvalent cations, mixing rate, and the presence and concentration of solvents.

[0100] In some aspects, the compositions of this disclosure can be delivered to cells as microemulsions. Microemulsions are typically transparent, thermodynamically stable solutions comprising an aqueous solution, a surfactant, and an “oil.” In this case, the “oil” is a supercritical fluid phase. The surfactant is located at the oil-water interface. Any of a variety of surfactants is suitable for microemulsion formulations, including those described herein or otherwise known in the art. The aqueous microregions suitable for this disclosure typically have a characteristic structural size of about 5 nm to about 100 nm. Aggregates of this size are weak scatterers of visible light, and therefore, these solutions are optically transparent. As those skilled in the art will understand, microemulsions can and will have a variety of different microstructures, including spherical, rod-shaped, or disc-shaped aggregates. In one aspect, the structure can be micelles, the simplest microemulsion structure, typically spherical or cylindrical objects. Micelles are like oil droplets in water, while antimicelles are like water droplets in oil. In an alternative aspect, the microemulsion structure is a sheet. It comprises a continuous layer of water and an oil layer separated by a surfactant layer. The “oil” of the microemulsion preferably comprises phospholipids. Any phospholipids used in liposomes as detailed above are applicable to microemulsions. One or more of tricyclic antipsychotics, vasodilators, antibiotics / antibacterial agents, arylpiperazines, or their derivatives can be encapsulated in microemulsions by any method known in the art.

[0101] In some respects, Hla can be delivered in dendritic macromolecules or dendritic polymers. Generally, dendritic polymers are branched, tree-like molecules, where each branch is an interconnected molecular chain that splits into two new branches (molecules) after a certain length. This branching continues until the branches (molecules) become so densely packed that the canopy forms a sphere. Typically, the properties of dendritic polymers are determined by the functional groups on their surface. For example, hydrophilic end groups, such as carboxyl groups, typically form water-soluble dendritic polymers. Alternatively, phospholipids can be incorporated into the surface of dendritic polymers to facilitate transdermal absorption. Any phospholipid detailed for use in liposomes is applicable to dendritic polymers. Any method known in the art can be used to prepare dendritic polymers and to encapsulate compositions of this disclosure therein. For example, dendritic polymers can be generated by an iterative sequence of reaction steps, where each additional iteration produces a higher-order dendritic polymer. Thus, they have a regular, highly branched 3D structure with nearly uniform size and shape. Furthermore, the final size of the dendritic polymer is typically controlled by the number of iterative steps used in the synthesis process. Various dendritic polymer sizes are applicable to this disclosure. Typically, the size range of dendritic polymers can be from about 1 nm to about 100 nm.

[0102] Generally, a safe and effective amount of modified Hla composition is, for example, an amount that produces the desired effect in subjects while minimizing undesirable side effects. In all respects, the effective amounts of Hla described herein can substantially induce an immune response in subjects.

[0103] The amounts of compositions described herein that can be combined with pharmaceutically acceptable carriers to produce a single dosage form will vary depending on the host being treated and the specific mode of administration. Those skilled in the art will understand that the unit amount of the drug contained in a single dose of each dosage form need not, on its own, constitute a therapeutically effective amount, as the necessary therapeutically effective amount can be achieved by administering multiple individual doses.

[0104] The toxicity and therapeutic efficacy of the compositions described herein can be determined by measuring LD50 in cell culture or laboratory animals. 50 (Dose lethal to 50% of the population) and ED 50 The standard drug procedure is used to determine the dose (the effective dose in 50% of the population). The dose ratio between toxicity and therapeutic effect can be expressed as LD50. 50 / ED 50 The therapeutic index of the ratio, where a larger therapeutic index is generally considered optimal in the art.

[0105] In some aspects, there is a total polypeptide of about 0.001 mg to about 10 mg per milliliter. Therefore, the protein concentration in the composition can be about, at least about or at most about 0.001, 0.010, 0.050, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0 pg / ml, mg / ml or higher (or any range thereof). Among them, approximately, at least approximately, or at most approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100% can be Hla peptides as disclosed herein.

[0106] This disclosure envisions the application of modified Hla polypeptides or peptides to achieve preventative treatment against the development of diseases or conditions associated with Staphylococcus aureus pathogen infection.

[0107] This disclosure describes polypeptides, peptides, and proteins used in various aspects of this disclosure. For example, the ability of a particular polypeptide to elicit an immune response can be determined. In certain aspects, all or part of the proteins of this disclosure can also be synthesized in solution or on a solid support using conventional techniques. Various automated synthesizers are commercially available and can be used according to known protocols. See, for example, Stewart and Young (1984); Tam et al. (1983); Merrifield, (1986); Barany and Merrifield (1979), each of which is incorporated herein by reference. Alternatively, recombinant DNA techniques can be employed, wherein a nucleotide sequence encoding a peptide of this disclosure is inserted into an expression vector, transformed or transfected into a suitable host cell, and cultured under conditions suitable for expression.

[00129] One aspect of this disclosure includes the transfer of genes into cells (including microorganisms) for the production and / or presentation of proteins. Genes of proteins of interest can be transferred into suitable host cells, and the cells can then be cultured under suitable conditions. In fact, nucleic acids encoding any polypeptide described herein can be used. The generation of recombinant expression vectors and the elements contained therein are discussed herein. Alternatively, the protein to be produced can be an endogenous protein that is typically synthesized by cells used for protein production.

[0108] Another aspect of this disclosure uses an autologous B lymphocyte line transfected with a viral vector expressing an immunogenic composition, and more specifically, a protein having immunogenic activity.

[0109] Other examples of mammalian host cell lines include, but are not limited to, Vero and HeLa cells, other B and T cell lines such as CEM, 721.221, H9, Jurkat, Raji, and Chinese hamster ovary cell lines, W138, BHK, COS-7, 293, HepG2, 3T3, RIN, and MDCK cells. Furthermore, host cell lines that regulate the expression of inserted sequences or modify and process gene products in desired ways can be selected. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products can be important for protein function. Different host cells possess characteristic and specific mechanisms of post-translational protein processing and modification. Appropriate cell lines or host systems can be selected to ensure the proper modification and processing of expressed exogenous proteins.

[0110] Various selection systems can be used, including but not limited to those for the HSV thymidine kinase gene, hypoxanthine-guanine phosphoribosyltransferase gene, and adenine phosphoribosyltransferase gene, respectively, for tk-cells, hgprt-cells, or aprt-cells. Furthermore, antimetabolite resistance can be used as a basis for selection: dhfr, which confers resistance to trimethoprim and methotrexate; gpt, which confers resistance to mycophenolic acid; neo, which confers resistance to the aminoglycoside G418; and hygro, which confers resistance to hygromycin.

[0111] Animal cells can reproduce in vitro in two modes: as non-anchor-dependent cells that grow in suspension throughout the culture body, or as anchor-dependent cells that require attachment to a solid matrix for reproduction (i.e., monolayer cell growth).

[0112] Continuous establishment of cell lines through anchorage-independent culture or suspension culture is the most widely used method for large-scale production of cells and cell products. However, suspension cultured cells have limitations, such as the potential for tumorigenesis and lower protein yields compared to adherent cells.

[0113] This disclosure includes methods for preventing or improving staphylococcal infection. Therefore, this disclosure contemplates vaccines for both active and passive immunization. The proposed immunogenic compositions suitable for use as vaccines can be most readily prepared directly from immunogenic Hla peptides prepared in the manner disclosed herein. Preferably, the antigen material is adequately dialyzed to remove unwanted small molecular weight molecules and / or lyophilized for easier formulation into a desirable medium. This disclosure includes compositions that can be used to induce an immune response against peptides or polypeptides derived from the disclosed modified Hla peptides to protect against staphylococcal infection and the development of resulting conditions or diseases. In some aspects, the compositions are formulated for application to mucosal surfaces, such as aerosol formulations.

[0114] Alternatively, other feasible and important options for protein / peptide-based vaccines include the introduction of nucleic acids encoding antigens as DNA or mRNA vaccines. In this regard, recent reports describe the construction of recombinant vaccinia viruses expressing 10 consecutive minimal CTL epitopes or combinations of B-cell epitopes, CTL epitopes, and TH epitopes from several microorganisms, and the successful immunization of mice with such constructs to elicit a protective immune response. Therefore, there is ample evidence in the literature that peptides, peptide pulse APCs, and constructs encoding peptides have been successfully used to effectively elicit a protective immune response in vivo. U.S. Patent Nos. 5,958,895 and 5,620,896 exemplify the use of nucleic acid sequences as vaccines.

[0115] The preparation of vaccines containing polypeptides or peptide sequences as active ingredients is generally well understood in this field. Typically, such vaccines are prepared as liquid solutions or suspensions for injection; they can also be prepared in a solid form suitable for dissolving or suspending in a liquid prior to injection.

[0116] The formulation can also be emulsified. The active immunogenic component is typically mixed with a pharmaceutically acceptable excipient that is compatible with the active ingredient. Suitable excipients are, for example, water, saline, dextran, glycerol, ethanol, and combinations thereof. Furthermore, if desired, vaccines may contain amounts of excipients, such as wetting agents or emulsifiers, pH buffers, or adjuvants to enhance vaccine efficacy. In certain respects, vaccines are formulated together with combinations of substances.

[0117] Vaccines can be routinely administered parenterally, via mucosal, intranasal, by inhalation, and / or by injection, such as subcutaneous or intramuscular injection. Other formulations suitable for other modes of administration include suppositories, and in some cases, oral formulations.

[0118] For suppositories, conventional binders and carriers may include, for example, polyalkylene glycols or triglycerides; such suppositories may be formed from a mixture containing an active ingredient in the range of about 0.5% to about 10%, preferably about 1% to about 2%. Oral formulations include commonly used excipients such as pharmaceutical-grade mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, etc. These compositions are in the form of solutions, suspensions, tablets, pills, capsules, sustained-release formulations, or powders, and contain about 10% to about 95% of the active ingredient, preferably about 25% to about 70%.

[0119] Peptides and DNA constructs encoding peptides can be formulated into vaccines in neutral or salt forms. Pharmaceutically acceptable salts include acid addition salts (forming with the free amino group of the peptide) and salts formed with inorganic acids (e.g., hydrochloric acid or phosphoric acid) or organic acids (e.g., acetic acid, oxalic acid, tartaric acid, mandelic acid, etc.). Salts formed with the free carboxyl group can also be derived from inorganic bases such as sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium ammonium hydroxide, or ferric hydroxide, as well as organic bases such as isopropylamine, trimethylamine, 2-ethylaminoethanol, histidine, procaine, etc.

[0120] Typically, vaccines are administered in a dosage form compatible with the treatment, and the amount will be therapeutically effective and immunogenic. The amount to be administered depends on the subject being treated, including the individual's immune system's ability to synthesize antibodies and the level of protection required. The precise amount of active ingredient to be administered depends on the physician's judgment. However, a suitable dosage range is approximately several hundred micrograms of active ingredient per vaccination. The appropriate regimen for initial administration and booster shots is also variable, but typically follows the initial administration with subsequent vaccinations or other administrations.

[0121] The methods of administration can vary widely. Any conventional method of administering a vaccine is applicable. These methods are believed to include oral administration on a solid, physiologically acceptable matrix or in a physiologically acceptable dispersion, parenteral administration, mucosal administration, intranasal administration, inhalation, injection, etc. The dosage of the vaccine will depend on the route of administration and will vary depending on the subject's body size and health condition.

[0122] The immunogenicity of a given composition can vary. Therefore, it is often necessary to enhance the host's immune system, which can be achieved by conjugating a peptide or polypeptide to a carrier. Exemplary and preferred carriers are keyhole hemocyanin (KLH) and bovine serum albumin (BSA). Other albumins, such as ovalbumin, mouse serum albumin, or rabbit serum albumin, can also be used as carriers. Methods of conjugating polypeptides to carrier proteins are well known in the art and include glutaraldehyde, m-maleimide benzoyl-N-hydroxysuccinimide, carbodiimide, and bis(azobenzidine).

[0123] The immunogenicity of a polypeptide or peptide composition can be enhanced by using a nonspecific stimulant of the immune response (called an adjuvant). Suitable adjuvants include all acceptable immunostimulatory compounds, such as cytokines, toxins, or synthetic compositions. A variety of adjuvants can be used to enhance antibody responses against the disclosed modified Hla polypeptides. Adjuvants can (1) capture antigens in vivo to result in slow release; (2) attract cells involved in the immune response to the site of administration; (3) induce the proliferation or activation of immune system cells; or (4) improve the diffusion of antigens throughout the subject's body.

[0124] Adjuvants include, but are not limited to, oil-in-water emulsions, water-in-oil emulsions, mineral salts, polynucleotides, and natural substances. Specific adjuvants that may be used include alum, monophospholipid A (MPL), AddaSO3 (AS03-like), MPLA+alum (AS04-like), CpG-ODN1585, ADJUPHOS®, aluminum hydroxide, Advax, MF9, or any combination thereof. Other adjuvants that may be used include IL-1, IL-2, IL-4, IL-7, IL-12, g-interferon, GMCSP, BCG, aluminum hydroxide or other aluminum compounds, MDP compounds such as thur-MDP and nor MDP, CGP (MTP-PE), and lipid A. RIBI contains three bacterial components extracted in a 2% squalene / Tween 80 emulsion: MPL, trehalose dimethicone (TDM), and cell wall skeleton (CWS). MHC antigens may even be used. Other adjuvants or methods are illustrated in U.S. Patent Nos. 6,814,971, 5,084,269, and 6,656,462 (each incorporated herein by reference).

[0125] Various methods for achieving adjuvant action in vaccines include: using reagents such as aluminum hydroxide or aluminum phosphate (alum), typically in a solution of about 0.05% to about 0.1% in phosphate-buffered saline; mixing with a synthetic polymer of sugar (Carbopol®) (typically used in a solution of about 0.25%); and aggregating the proteins in the vaccine by heat treatment at a temperature range of about 70°C to about 101°C for 30 seconds to 2 minutes. Aggregation can also be induced by reactivation with pepsin-treated (Fab) anti-albumin antibodies; mixing with bacterial cells (e.g., Corynebacterium parvum), endotoxins of Gram-negative bacteria, or lipopolysaccharide components; forming emulsions in physiologically acceptable oil mediators (e.g., mannose monooleate (Aracel A)); or forming emulsions with a 20% perfluorocarbon solution (Fluosol-DA®) used as a block substitute.

[0126] Exemplary, generally preferred adjuvants include complete Freund's adjuvant (which is a nonspecific stimulant of the immune response containing killed Mycobacterium tuberculosis), incomplete Freund's adjuvant, alum, AddaSO3 (AS03-like), MPLA and alum (AS04-like), CpG-ODN1585, or any combination thereof. In addition to adjuvants, co-administration of biological response modulators (BRMs) to enhance the immune response may also be desirable. BRMs have been shown to upregulate T-cell immunity or downregulate suppressor cell activity. Such BRMs include, but are not limited to, cimetidine (CIM; 1200 mg / d) (Smith / Kline, PA); low-dose cyclophosphamide (CYP; 300 mg / m2) (Johnson / Mead, NJ); and cytokines such as interferon-gamma, IL-2, or IL-12, or genes encoding proteins.

[0127] In some aspects, this disclosure relates to compositions comprising one or more lipids associated with nucleic acids or polypeptides / peptides. Lipids are substances insoluble in water and can be extracted with organic solvents. Those skilled in the art will understand compounds other than those specifically described herein as lipids, and that these are included in the compositions and methods of this disclosure. Lipid components and non-lipid components may be covalently or non-covalently attached to each other.

[0128] Lipid-associated nucleic acid molecules or polypeptides / peptides can be dispersed in a lipid-containing solution, dissolved with lipids, emulsified with lipids, mixed with lipids, bound to lipids, covalently bonded to lipids, contained in lipids as a suspension, or otherwise associated with lipids. The lipids or lipid-Hla-associated compositions disclosed herein are not limited to any particular structure. For example, they can also be simply dispersed in solution, possibly forming aggregates of non-uniform size or shape. In another instance, they can exist in a bilayer structure, as micelles, or have a “collapsed” structure. In another non-limiting example, lipofectamine (Gibco BRL)-poxvirus or Superfect (Qiagen)-poxvirus complexes are also contemplated.

[0129] In some aspects, the composition may contain about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 19%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 5%, etc. 6%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or any range thereof, of a specific lipid, lipid type, or non-lipid component, such as adjuvants, antigens, peptides, polypeptides, sugars, nucleic acids, or other materials disclosed herein or known to those skilled in the art. In a non-limiting example, the composition may comprise about 10% to about 20% neutral lipids, about 33% to about 34% cerebrosides, and about 1% cholesterol. In another non-limiting example, the liposomes may comprise about 4% to about 12% terpenes, wherein about 1% of the micelles are particularly lycopene, and the remaining about 3% to about 11% of the liposomes comprise other terpenes; and about 10% to about 35% phosphatidylcholine and about 1% non-lipid components. Therefore, it is contemplated that the compositions of this disclosure may comprise any combination or percentage range of any lipids, lipid types, or other components.

[0130] The compositions and related methods disclosed herein, particularly the administration of the disclosed modified Hla peptides or Hla polynucleotides to patients / subjects, can also be used in combination with the administration of conventional therapies. These include, but are not limited to, the administration of antibiotics such as streptomycin, ciprofloxacin, doxycycline, gentamicin, chloramphenicol, trimethoprim, sulfamethoxazole, ampicillin, tetracycline, oxacillin, vancomycin, or various combinations of antibiotics. Furthermore, the administration of the disclosed modified Hla peptides or Hla polynucleotides or anti-HIa antibodies to patients / subjects can be combined with the administration of antiviral agents such as RIP.

[0131] In one aspect, it is envisioned that the Hla composition be used in combination with antibacterial and / or antiviral therapy. Alternatively, the therapy may be administered before or after other drug treatments, with intervals ranging from minutes to weeks. In the case of separate administration of other drugs and / or proteins or polynucleotides, it is generally ensured that there is not an excessively long interval between each administration so that the drugs and compositions of this disclosure can still produce a beneficial combined effect on the subject. In this case, it is envisioned that the two administrations may be administered at intervals of approximately 12-24 hours, more preferably, at intervals of approximately 6-12 hours. However, in some cases, significantly prolonged administration intervals may be desirable, with intervals of several days (2, 3, 4, 5, 6, or 7 days) to several weeks (1, 2, 3, 4, 5, 6, 7, or 8 weeks) between administrations.

[0132] Various combinations can be used, such as antibiotic therapy as "A", and immunogenic molecules or antibodies, such as Hla antigen as "B", given as part of an immunotherapy or passive immunotherapy regimen: A / B / AB / A / BB / B / AA / A / BA / B / BB / A / AA / B / B / BB / A / B / BB / B / B / AB / B / A / BA / A / B / BA / B / A / BA / B / B / A / BA / B / B / AB / B / A / AB / A / B / AB / A / B / AB / A / A / A / BA / A / A / BB / A / A / AA / B / A / AA / B / A / A / B / A.

[0133] In some aspects, the pharmaceutical composition is administered to a subject. Different aspects of this disclosure relate to administering an effective amount of the composition to a subject. In some aspects of this disclosure, a modified Hla polypeptide or polynucleotide may be administered to a patient to protect against infection by one or more staphylococcal pathogens. Alternatively, a nucleic acid sequence encoding one or more such polypeptides or peptides, or an expression vector containing such a nucleic acid sequence, may be given to the subject as a prophylactic treatment. Furthermore, such compounds may be administered in combination with antibiotics and / or antiviral agents. Such compositions are typically dissolved or dispersed in pharmaceutically acceptable carriers or aqueous media.

[0134] The active compounds of this disclosure can be formulated for parenteral administration, for example, for injection via intravenous, intramuscular, subcutaneous, or even intraperitoneal routes. According to this disclosure, the preparation of aqueous compositions containing one or more of the compositions of this disclosure will be known to those skilled in the art. Typically, such compositions can be prepared as liquid solutions or suspensions for injection; they can also be prepared in solid forms suitable for use in preparing solutions or suspensions after addition of liquid prior to injection; and the formulations can also be emulsified.

[0135] The active compound, as a solution of a free base or a pharmacologically acceptable salt, can be prepared in water appropriately mixed with a surfactant such as hydroxypropyl cellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycol and mixtures thereof, and oils. Under normal storage and use conditions, these formulations contain preservatives to prevent microbial growth.

[0136] Suitable drug forms for injection include sterile aqueous solutions or dispersions; formulations including aqueous solutions of sesame oil, peanut oil, or propylene glycol; and sterile powders for the immediate preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and must be a liquid readily injectable. It should also be stable under manufacturing and storage conditions and must be protected against contamination by microorganisms such as bacteria and fungi.

[0137] The composition can be formulated in a neutral or salt form. Pharmaceutically acceptable salts include acid addition salts (forming with the free amino group of a protein) and those formed with inorganic acids (e.g., hydrochloric acid or phosphoric acid) or organic acids (e.g., acetic acid, oxalic acid, tartaric acid, mandelic acid, etc.). Salts formed with free carboxyl groups can also be derived from inorganic bases such as sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium ammonium hydroxide, or ferric hydroxide, and organic bases such as isopropylamine, trimethylamine, 2-ethylaminoethanol, histidine, procaine, etc.

[0138] The carrier can also be a solvent or dispersion medium, comprising, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), suitable mixtures thereof, and vegetable oils. For example, by using a coating (e.g., lecithin), suitable flowability can be maintained in the dispersed state by maintaining the desired particle size, and by using a surfactant. Prevention of microbial action can be achieved by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. In many cases, isotonic agents, such as sugars or sodium chloride, are preferred. Extended absorption of the injectable composition can be achieved by using agents that delay absorption, such as aluminum monostearate and gelatin.

[0139] Sterile injection solutions are prepared by incorporating the desired amount of the active compound, along with various other components listed above (as needed), into a suitable solvent, followed by filtration and sterilization. Typically, dispersions are prepared by incorporating various sterile active ingredients into a sterile medium containing a base dispersion medium and desired other components from those listed above. In the case of preparing sterile powders for sterile injection solutions, preferred methods include vacuum drying and freeze-drying techniques, which produce powders of the active ingredient plus any additional desired components from its previous sterile filtration solution.

[0140] The effective amount of the therapeutic or preventative composition is determined based on the intended target. The term "unit dose" or "dose" refers to a physically discrete unit suitable for use in a subject, each unit containing a predetermined amount of the composition, calculated in conjunction with its administration (i.e., appropriate route and regimen) to produce the desired response described above. The amount to be administered, depending on the number of treatments and the unit dose, depends on the required protection.

[0141] Other formulations of drug delivery systems can be found, for example, in Hoover, John E., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. (1975) and Liberman, H. A. and Lachman, L. (eds.), Pharmaceutical Dosage Forms, Marcel Decker, New York, NY (1980). Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton Pa., 16 Ed ISBN: 0-912734-04-3, latest edition (which is incorporated herein by reference in its entirety), which provides a summary of formulation techniques commonly known to practitioners. Suitable pharmaceutically acceptable carriers for maintaining optimal stability, shelf life, potency, and function of a delivery system will be apparent to those skilled in the art.

[00163] Controlled-release (or sustained-release) formulations can be formulated to prolong the activity of the drug and reduce the frequency of administration. Controlled-release formulations can also be used to influence the onset time of action or other characteristics, such as blood levels of the drug, and thus the occurrence of side effects. Controlled-release formulations can be designed to initially release a fixed amount of drug to produce the desired therapeutic effect, and then gradually and continuously release additional amounts of drug to maintain the level of therapeutic effect over an extended period of time. To maintain a nearly constant drug level in the body, the drug can be released from the dosage form at a rate that replaces the amount of drug that is metabolized or excreted from the body. Controlled release of the drug can be stimulated by various inducing factors, such as changes in pH, temperature, enzymes, water, or other physiological conditions or molecules.

[0142] The compositions described herein may also be used in combination with other treatment modalities, as further described below. Therefore, in addition to the therapies described herein, subjects may be provided with other therapies known to be effective in treating diseases, symptoms, or conditions.

[0143] II. Methods In some aspects, this disclosure provides a method for inducing an immune response against a bacterial pathogen, the method comprising administering to a subject in need a polypeptide, polynucleotide, immunogenic composition, or pharmaceutical composition as described herein. This document also provides compositions for inducing an immune response and their use in the preparation of medicaments for inducing an immune response.

[0144] This disclosure provides the importance of mediating immunity against bacterial pathogens (e.g., Staphylococcus aureus) by inducing germinal center (GC) and T-follicle helper (TFH) responses in subjects in need. In some aspects, it provides the importance of mediating immunity against bacterial pathogens in early life (e.g., in utero to approximately 3 years of age). In some aspects, this disclosure provides the importance of mediating immunity against bacterial pathogens prior to the first infection with the pathogen. In some aspects, this disclosure provides a method of inducing an immune response in subjects in need, the method comprising administering to the subject in need a composition comprising a modified α-hemolysin (Hla) polypeptide or a derivative or fragment thereof containing amino acid substitutions H35L, R66C, and E70C relative to the amino acid sequence shown in SEQ ID NO: 1. HRE The modified Hla polypeptide of claim 1 comprises the amino acid sequence shown in SEQ ID NO:11, or a sequence having at least about 80% identity with it, or a fragment thereof. The disclosed method may include administering to a subject in need a polypeptide comprising the amino acid sequence shown in any one of SEQ ID NO:6-11, or a derivative or fragment thereof, or a polynucleotide encoding a polypeptide, derivative or fragment thereof disclosed in SEQ ID NO:6-11, or an immunogenic composition comprising them.

[0145] As described herein, the method typically involves active immunization (administration) of infants and young children at birth or within three years of life thereafter, followed by booster immunization during the primary series of immunizations for infants and children. For example, methods disclosed herein that include reducing or preventing Staphylococcus aureus infection in a subject typically involve administering the composition described herein to the subject at birth or shortly thereafter. In some aspects, "at birth or shortly thereafter" may include, but is not limited to, approximately 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55 minutes or longer after birth. In some aspects, "shortly thereafter" may include, but is not limited to, approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 hours or longer after birth. In some aspects, "shortly after birth" includes approximately 1, 2, 3, 4, 5, 6, 7 days or longer after birth. In other aspects, "shortly after birth" includes approximately 1, 2, 3, 4, 5, 6, 7, or 8 weeks or longer after birth. In some aspects, active immunization of infants and young children occurs within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 months after birth. The disclosed methods may include active immunization of a subject by administering the composition as described herein, wherein the subject may be a child, adolescent, or adult. In some respects, the immunogenic composition may be administered to subjects at any age, for example, less than 3 years old, between about 3 and about 10 years old, or about 20 and about 30 years old, or about 30 and about 40 years old, or about 40 and about 50 years old, or about 50 and about 60 years old, or about 60 and about 70 years old, or about 70 and about 80 years old, or about 80 and about 90 years old, or about 90 and about 100 years old or older.

[0146] The method further includes administering the composition disclosed herein to the subject once or more after the initial application. In some aspects, the additional applications include approximately 1, 2, 3, 4, 5, 6, 7 days or longer after the initial application. In some aspects, the additional applications include approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months or longer after the initial application. In some aspects, the additional applications include approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 years or longer after the initial application.

[0147] In another aspect, the method provides maternal immunity for neonatal protection, in addition to immunization during the basal immunization series for infants and young children. For example, methods as disclosed herein include methods for reducing or preventing Staphylococcus aureus infection in a subject, which typically involve administering the subject's mother a composition as disclosed herein while the subject is in utero. "In utero" is a Latin term that literally means "in the womb" or "in the uterus." In some aspects, the method induces transplacental transfer of anti-HIa neutralizing antibodies. In some aspects, the composition is administered to the mother during the second or third trimester. Thus, the mother may administer the composition at approximately 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 weeks of gestation. The method further includes administering the composition disclosed herein to the subject once or multiple times after the initial administration to the mother while the subject is in utero, at birth, or shortly after birth.

[0148] In some respects, the compositions disclosed herein can be administered via any of the oral, intranasal, intravenous, intramuscular, subcutaneous, or even intraperitoneal routes.

[0149] In some aspects, the compositions disclosed herein can be administered together with at least one additional immunogenic antigen selected from Opp3a, DltD, HtsA, LtaS, IsdA, IsdB, IsdC, SdrC, SdrD, SdrE, SdrF, SdrG, SdrH, SrtA, SpA, Sbi, FmtB, β-hemolysin, fibronectin-binding protein A (fnbA), fibronectin-binding protein B (fnbB), coagulase, Fig, map, leukocidin (pvl), α-toxin and its variants, γ-toxin (hlg) and its variants, ica, immunodominant ABC transporter, Mg2+ transporter, Ni-ABC transporter, RAP, autolysin, laminin receptor, IsaA / PisA, IsaB / PisB, SpOIIIE, SsaA, EbpS, SasA, SasF, SasH, EFB (FIB), SBI, Npase, EBP, bone sialic acid-binding protein II, Staphylococcus aureus lysin precursor (AUR) / Sepp1, CNA and its fragments, such as M55, TSST-1, mecA, poly-N-acetylglucosamine (PNAG / dPNAG) extracellular polysaccharide, GehD, EbhA, EbhB, SSP-1, SSP-2, HBP, porphyrin-binding protein, HarA, EsxA, EsxB, enterotoxin A, enterotoxin B, enterotoxin C1, and novel autolysins.

[0150] As described above, this disclosure relates to inducing an immune response in a subject against the disclosed modified Hla peptide or a variant or fragment thereof. In one aspect, the immune response can protect a patient from infection or related disease or treat a subject who has an infection or related disease, is suspected of having an infection or related disease, or is at risk of developing an infection or related disease. In some aspects, the method includes inducing an immune response in the subject prior to the subject's first exposure to Staphylococcus aureus. In a non-limiting example, an immune response may be induced in the subject in utero and / or at birth, or within 3 years of birth or later.

[0151] In some aspects of this disclosure, the compositions disclosed herein generate an immune response in a subject, thereby conferring protective immunity upon the subject. Protective immunity refers to the ability of a specific immune response in a body tissue to protect the subject from developing a specific disease or condition involving a pathogen targeted by that immune response. In one exemplary aspect, administration of the compositions disclosed herein generates GC and TFH responses. An immunogenic effective amount is an amount capable of conferring protective immunity upon a subject.

[0152] As used herein, the phrase “immune response” or its equivalent “immunological response” refers to the development in a recipient patient of a humoral (antibody-mediated), cellular (mediated by antigen-specific T cells or their secreted products), or both humoral and cellular responses against the proteins, peptides, or polypeptides of this disclosure. Such responses can be active responses induced by the administration of an immunogen or passive responses induced by the administration of antibodies, antibody-containing materials, or primed T cells. Cellular immune responses are induced by the presentation of polypeptide epitopes associated with class I or II MHC molecules to activate antigen-specific CD4(+) T helper cells and / or CD8(+) cytotoxic T cells. Responses may also involve the activation of monocytes, macrophages, NK cells, basophils, dendritic cells, astrocytes, microglia, eosinophils, or other innate immune components. In some respects, an immune response refers to the generation of a GC response.

[0153] The presence of cell-mediated immunological responses can be determined by proliferation assays (CD4(+) T cells) or CTL (cytotoxic T lymphocytes) assays. The relative contributions of humoral and cellular responses to the protective or therapeutic effects of immunogens can be distinguished by isolating IgG cells and T cells separately from immunized syngeneic animals and measuring the protective or therapeutic effects in a second subject.

[0154] The methods disclosed herein include treating diseases or conditions caused by staphylococcal pathogens, and preventing or reducing infection to prevent or minimize exposure to the pathogens.

[0155] In some respects, treatment may be administered in the presence of adjuvants or carriers, even in the absence or near absence of other staphylococcal antigens and / or proteins. Furthermore, in some instances, treatment may involve the administration of other agents commonly used against bacterial infections, such as one or more antibiotics.

[0156] The administration of the disclosed modified Hla peptides or Hla polynucleotides, or variants thereof, may occur as a single event or over a period of time. For example, one or more of the disclosed modified Hla peptides or Hla polynucleotides may be administered daily, weekly, bi-weekly, or monthly. For the treatment of acute conditions, the duration of treatment is typically at least several days. For some conditions, treatment may be extended from several days to several weeks. For example, treatment may continue for one week, two weeks, or three weeks. For more chronic conditions, treatment may be extended from several weeks to several months, or even a year or longer. The compositions may be applied 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 times or more, and / or they may be applied every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 hours or every 1, 2, 3, 4, 5, 6, 7 days or every 1, 2, 3, 4, 5 weeks or every 1, 9, 10, 11, 12 months, or any range or combination thereof derived therefrom.

[0157] Without further elaboration, it is believed that those skilled in the art can make full use of this disclosure based on the foregoing description. Therefore, the following specific aspects should be interpreted only as illustrative and not in any way limiting the remainder of this disclosure. All publications cited herein are incorporated by reference for the purposes or subjects described herein.

[0158] Since various modifications can be made to the materials and methods described above without departing from the scope of this disclosure, all content contained in the above description and the embodiments given below is intended to be illustrative rather than restrictive.

[0159] definition The wording and terminology used herein are for descriptive purposes and should not be construed as limiting. For example, the use of singular terms, such as "a / a," does not imply a limitation on the number of items. Furthermore, for clarity, relational terms, such as, but not limited to, "top," "bottom," "left," "right," "upper," "lower," "below," "above," and "side," are used in the description with specific reference to the accompanying drawings and are not intended to limit the scope of the inventive concept or the appended claims.

[0160] Any degree term, such as, but not limited to, “substantially” as used in the specification and appended claims, should be understood to include precise or similar but imprecise configurations. For example, “substantially flat surface” means having a precise plane or a similar but imprecise plane. Similarly, the terms “about” or “approximately” as used in the specification and appended claims should be understood to include values ​​that are three times or one-third of the stated value. For example, about 3 mm includes all values ​​from 1 mm to 9 mm, and about 50 degrees includes all values ​​from 16.6 degrees to 150 degrees. For example, they may refer to less than or equal to ±5%, such as less than or equal to ±2%, such as less than or equal to ±1%, such as less than or equal to ±0.5%, such as greater than or equal to ±0.2%, such as less than or equal to ±0.1%, such as less than or equal to ±0.05%.

[0161] In this document, a range may be expressed as “about” a particular value and / or “about” another particular value. When such a range is expressed, the other aspect includes a particular value and / or “about” another particular value. Similarly, when a value is expressed as an approximation using the antecedent “about”, it should be understood that the particular value forms another aspect. It will be further understood that the endpoints of each range are meaningful both with respect to and independently of the other endpoint. It should also be understood that many values ​​are disclosed herein, and each value is also disclosed herein as “about” that particular value, in addition to being the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It should also be understood that each unit between two particular units is also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.

[0162] References to the weight parts of a specific element or component in the description and appended claims indicate a weight relationship between that element or component and any other element or component in the composition or article, expressed in weight parts. Therefore, in a compound containing 2 parts by weight of component X and 5 parts by weight of component Y, X and Y are present in a weight ratio of 2:5, and are present in this ratio regardless of whether the compound contains other components.

[0163] As used herein, the terms “or” and “and / or” should be interpreted as inclusive or implying any one or any combination thereof. Therefore, “A, B, or C” or “A, B, and / or C” means any of the following: “A,” “B,” or “C”; “A and B”; “A and C”; “B and C”; “A, B, and C”. Exceptions to this definition will only occur when the combination of elements, functions, steps, or actions is inherently mutually exclusive to some extent.

[0164] Unless otherwise defined, all technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this disclosure pertains. The following references provide general definitions for many of the terms used herein: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd edition, 1994); The Cambridge Dictionary of Science and Technology (Walker, ed., 1988); The Glossary of Genetics, 5th edition, R. Rieger et al. (eds.), Springer Verlag (1991); and Hale and Marham, The Harper Collins Dictionary of Biology (1991), all of which are incorporated herein by reference. Unless otherwise stated, the following terms as used herein have the meanings assigned to them hereinafter.

[0165] The wording and terminology used herein are for descriptive purposes and should not be construed as limiting. When introducing elements of this disclosure or preferred aspects thereof, the articles “a,” “an,” “the,” and “said” are intended to indicate the presence of one or more elements. The terms “comprising,” “including,” and “having” are intended to be inclusive and mean that other elements may exist in addition to those listed. Wherever the terms “comprising” or “including” are used, it should be understood that this disclosure also expressly contemplates and includes other aspects “composed” of the disclosed elements, excluding elements other than those listed.

[0166] As used herein, the terms “optional” or “optionally” mean that an event or condition described subsequently may or may not occur, and the description includes both the possibility that the event or condition occurs and the possibility that it does not occur. In one aspect, the disclosed method may optionally include one or more additional steps, such as repeating the application step or changing the application step.

[0167] Furthermore, because this disclosure is susceptible to many different aspects, it is intended to be regarded as an example of the principles of this disclosure and not as limiting it to the specific aspects shown and described. Any feature of this disclosure may be used alone or in combination with any other feature. References to the terms "aspect," "aspects," and / or the like in the specification mean that one or more features mentioned are included in at least one aspect of the specification. Individual references to the terms "aspect," "aspects," and / or the like in the specification do not necessarily refer to the same aspect and are not mutually exclusive unless so stated and / or readily apparent to those skilled in the art from the specification. For example, features, structures, processes, steps, actions, etc., described in one aspect may also be included in other aspects, but not necessarily. Therefore, this disclosure may include various combinations and / or integrations of the aspects described herein. Furthermore, as stated herein, not all aspects of this disclosure are essential to its practice. Similarly, other systems, methods, features, and advantages of this disclosure will be apparent or will become apparent to those skilled in the art upon examination of the drawings and specification. All such additional systems, methods, features, and advantages are intended to be included in this specification, within the scope of this disclosure, and encompassed by the claims.

[0168] The term “nucleic acid” or “polynucleotide” refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) in single-stranded or double-stranded form and polymers thereof. Unless specifically limited, the term includes nucleic acids containing known natural nucleotide analogs that have similar binding properties to a reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise stated, a particular nucleic acid sequence also implicitly includes variants of its conserved modifications (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, complementary sequences, and explicitly indicated sequences. Specifically, degenerate codon substitutions can be achieved by generating a sequence in which the third position of one or more selected (or all) codons is substituted with a mixture of bases and / or deoxyinosine residues. See, for example, Batzer et al., Nucleic Acid Res. 19:5081 (1991), the entire contents of which are incorporated herein by reference.

[0169] The terms “peptide,” “polypeptide,” and “protein” are used interchangeably and refer to compounds containing amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that can constitute a protein or peptide sequence. A polypeptide includes any peptide or protein containing two or more amino acids linked together by peptide bonds. As used herein, the term refers to both short chains (which are also commonly referred to in the art, for example, peptides, oligopeptides, and oligomers) and long chains (which are commonly referred to in the art, for example, proteins, which have many types). “Polypeptide” includes, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, fusion proteins, etc. Polypeptides include natural peptides, recombinant peptides, or combinations thereof.

[0170] In the context of this application, proteins are represented by amino acid sequences, and correspondingly, nucleic acid molecules or polynucleotides are represented by nucleic acid sequences. Sequence identity and similarity: Throughout this application, whenever a specific amino acid sequence SEQ ID NO (for example, SEQ ID NO:Y) is mentioned, it can be replaced with: a polypeptide represented by an amino acid sequence containing a sequence having at least 60% sequence identity or similarity to the amino acid sequence SEQ ID NO:Y. Another preferred level of sequence identity or similarity is 65%. Another preferred level of sequence identity or similarity is 70%. Another preferred level of sequence identity or similarity is 75%. Another preferred level of sequence identity or similarity is 80%. Another preferred level of sequence identity or similarity is 85%. Another preferred level of sequence identity or similarity is 90%. Another preferred level of sequence identity or similarity is 95%. Another preferred level of sequence identity or similarity is 98%. Another preferred level of sequence identity or similarity is 99%.

[0171] Each amino acid sequence described herein has, in another preferred aspect, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity or similarity with a given nucleotide or amino acid sequence, based on its percentage of identity or similarity with the given amino acid sequence. The terms “homology,” “sequence identity,” etc., are used interchangeably herein. This document defines sequence identity as the relationship between two or more amino acid (peptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by sequence comparison. In a preferred aspect, sequence identity is calculated based on the full length or a portion thereof of two given SEQ ID NOs. The portion preferably refers to at least 50%, 60%, 70%, 80%, 90%, or 100% of the SEQ ID NO. In the art, “identity” also refers to the degree of sequence relevance between amino acid or nucleic acid sequences (as the case may be) determined by matching such sequence strings. For example, the degree of sequence identity between two sequences can be determined by comparing them using computer programs commonly used for this purpose (e.g., global or local alignment algorithms). Non-limiting examples include BLASTp, BLASTn, Clustal W, MAFFT, Clustal-Omega, AlignMe, Praline, GAP, BESTFIT, or another suitable method or algorithm. The Needleman and Wunsch global alignment algorithms can be used to align two sequences across their entire length or a portion thereof (which can mean at least 50%, 60%, 70%, 80%, or 90% of the sequence length), maximizing the number of matches and minimizing the number of gaps.The default settings can be used, and the preferred programs are Needle for two-sequence alignment (in one aspect, using EMBOSS Needle 6.6.0.0, gap open penalty 10, gap extension penalty: 0.5, terminal gap penalty: false, terminal gap open penalty: 10, terminal gap extension penalty: 0.5) and MAFFT for multiple-sequence alignment (in one aspect, using MAFFT v7 defaults: BLOSUM62 [bl62], gap open: 1.53, gap extension: 0.123, order: aligned, tree reconstruction count: 2, guide tree output: on [true], maximum number of iterations: 2, perform FFTS: none).

[0172] The “similarity” between two amino acid sequences is determined by comparing the amino acid sequence of one polypeptide and its conserved amino acid substitutions with the sequence of a second polypeptide. Similar algorithms used to determine sequence identity can be used to determine sequence similarity. Optionally, those skilled in the art may also consider so-called conserved amino acid substitutions when determining the degree of amino acid similarity. As used herein, a “conserved” amino acid substitution refers to the interchangeability of residues having similar side chains.

[0173] For example, the amino acid group with aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; the amino acid group with aliphatic hydroxyl side chains is serine and threonine; the amino acid group with amide-containing side chains is asparagine and glutamine; the amino acid group with aromatic side chains is phenylalanine, tyrosine, and tryptophan; the amino acid group with basic side chains is lysine, arginine, and histidine; and the amino acid group with sulfur-containing side chains is cysteine ​​and methionine. Preferred conserved amino acid substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine. Substitution variants of the amino acid sequences disclosed herein are those in which at least one residue in the disclosed sequence has been removed and a different residue has been inserted at its position. Preferably, the amino acid changes are conserved. The preferred conservative substitutions for each naturally occurring amino acid are as follows: Ala is substituted with Ser; Arg is substituted with Lys; Asn is substituted with Gln or His; Asp is substituted with Glu; Cys is substituted with Ser or Ala; Gln is substituted with Asn; Gly is substituted with Asp; Gly is substituted with Pro; His is substituted with Asn or Gln; Ile is substituted with Leu or Val; Leu is substituted with Ile or Val; Lys is substituted with Arg; Gln or Glu; Met is substituted with Leu or Ile; Phe is substituted with Met, Leu or Tyr; Ser is substituted with Thr; Thr is substituted with Ser; Trp is substituted with Tyr; Tyr is substituted with Trp or Phe; and Val is substituted with Ile or Leu.

[0174] As used herein, “operably linked” means that gene expression is under the control of a regulatory element spatially linked to it. In some cases, the regulatory element is a promoter, and when used in this case, gene expression is under the control of the promoter spatially linked to it. The regulatory element (e.g., a promoter) may be located at the 5' (upstream) or 3' (downstream) of the gene it controls. The distance between the regulatory element (e.g., a promoter) and the gene may be approximately the same as the distance between the regulatory element (promoter) and the gene it controls in the gene from which the regulatory element (e.g., the promoter) originates. As is known in the art, variations in this distance can be accommodated without loss of function (i.e., without loss of promoter function).

[0175] As used herein, a “regulatory element” refers to any sequence element that positively or negatively regulates the expression of an operatively linked sequence. “Regulatory elements” include, but are not limited to, promoters, enhancers, leader sequences, transcription start sites (TSS), linkers, 5' and 3' untranslated regions (UTRs), introns, polyadenylation signals, and termination regions or sequences, which are adapted to regulate the expression of a gene or transcribed DNA sequence in a cell or enable the expression of a gene or transcribed DNA sequence in a cell, or are necessary or preferred thereto. Such additional regulatory elements may be optional and used to enhance or optimize the expression of a gene or transcribed DNA sequence. For example, regulatory sequences may be inducible, non-inducible, constitutive, cell cycle-regulating, metabolic-regulating, etc. A regulatory sequence may be a promoter. As used herein, the term “promoter” refers to a DNA sequence that contains an RNA polymerase binding site, a transcription start site, and / or a TATA box, and assists or promotes the transcription and expression of an associated transcribed polynucleotide sequence and / or gene (or transgene). Promoters may be synthesized, modified, or derived from known or naturally occurring promoter sequences or other promoter sequences. Promoters may also include chimeric promoters, which contain a combination of two or more heterologous sequences.

[0176] A “fragment” or “part” of an amino acid sequence can be understood as an amino acid sequence that is shorter than, for example, by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250 or more amino acids than a reference amino acid sequence, and that contains, is substantially identical to, or is substantially composed of, the reference amino acid sequence (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) consecutive amino acids. Where appropriate, such amino acid fragments or portions according to this disclosure may be included in a larger amino acid sequence in which they are integral.

[0177] As used herein, "isolated" means a biological component (e.g., nucleic acid molecule, nucleic acid sequence, protein, or virus) that has been substantially isolated or purified from other biological components (e.g., other chromosomal and extrachromosomal DNA and RNA, proteins, and / or organelles). "Isolated" nucleic acids, proteins, and / or viruses include nucleic acids, proteins, and viruses purified using standard purification methods. The term also includes nucleic acids, proteins, and viruses prepared through recombinant expression in host cells, as well as chemically synthesized nucleic acids or proteins. The term "isolated" (or purified) does not require absolute purity; rather, it is considered a relative term. Thus, for example, isolated or purified nucleic acids, proteins, viruses, or other active compounds are nucleic acids, proteins, viruses, or other active compounds that have been completely or partially isolated from the associated nucleic acids, proteins, and other contaminants. In one aspect, the term "substantially purified" means nucleic acids, proteins, viruses, or other active compounds that have been isolated from cells, cell culture media, or other crude products and fractionated to remove various components (e.g., proteins, cell debris, and other components) of the initial product. In one respect, in some instances, the isolated protein or nucleic acid, or the cells containing them, is at least 50% pure, such as at least 75%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 100% pure. The isolated nucleic acid molecule may contain one or more naturally occurring sequences, recombinant sequences, or combinations thereof. The isolated nucleic acid molecule may contain any one or more of genes, transcriptional regulatory sequences, translational regulatory sequences, coding sequences, non-coding sequences, plasmids, vectors, or viral vectors. The isolated nucleic acid molecule may also contain one or more modified nucleotides.

[0178] Example The following embodiments are included to illustrate preferred aspects of this disclosure. Those skilled in the art will understand that the techniques disclosed in the following embodiments represent techniques discovered by the inventors that work well in the practice of this disclosure, and therefore can be considered to constitute a preferred mode of this practice. However, based on this disclosure, those skilled in the art will understand that many changes can be made to the specific aspects disclosed without departing from the spirit and scope of this disclosure, and similar or analogous results can still be obtained.

[0179] In some respects, this disclosure is the result of considerable intellectual and experimental effort to identify an optimized, nontoxic Hla variant immunogen capable of inducing durable protective immunity against SSTI during neonatal vaccination delivery. Staphylococcal alpha toxin (Hla) is a highly conserved pore-forming toxin that contributes to the pathogenesis of every major manifestation of staphylococcal disease. Hla, expressed in almost all clinical isolates, utilizes A deintegrin and metalloproteinase 10 (ADAM10) as cellular receptors to cause host cell damage. ADAM10 is a type I transmembrane protein widely expressed on human cells. Figure 1 Characterized by its N-terminal metalloproteinase domain, ADAM10 contributes to cell and tissue development, homeostasis, and responses to damage, which depend on the proteolytic cleavage of ADAM10 substrates in a cell-type-specific manner. Upon binding of the Hla monomer to ADAM10, the assembly of heptamer pores begins. Pore formation on the host cell membrane leads to upregulation of ADAM10 catalytic activity, accompanied by the cleavage of native ADAM10 substrates, including E-cadherin, VE-cadherin, and platelet glycoprotein VI. These cleavage events, and the cellular damage induced by Hla pore formation, ultimately result in the tissue-specific damage exhibited in Staphylococcus aureus diseases.

[0180] Among staphylococcal virulence factors, Hla is unique in its ability to impair antigen-specific T-cell responses and promote recurrent infections. The data presented in this paper show elevated anti-Hla antibody titers in pediatric subjects exhibiting protection against recurrent infections, indicating a relevance to protective immunity in humans. These findings suggest that eliciting a highly neutralizing anti-Hla antibody response early in life is a strategic goal of vaccine development. Therefore, a vaccine development approach was designed to identify optimized, non-toxic Hla variant immunogens capable of eliciting durable protective immunity against SSTIs upon delivery of the vaccine in the neonatal period. These developmental efforts focused on understanding the Hla-ADAM10 interaction and the dramatic conformational changes that Hla undergoes in forming heptamer pores.

[0181] Example 1: Analysis of serum anti-HLA titers by age.

[0182] Exposure to Staphylococcus aureus occurs within the first few weeks to months of life. In the pediatric population, Staphylococcus aureus skin and soft tissue infections (SSTIs) are associated with recurrent illness in up to 50% of children. Elevated anti-Hla antibody titers were observed in pediatric subjects who showed protection against recurrent infections, indicating the relevance of protective immunity in humans. These findings suggest that eliciting a high-level neutralizing antibody response against Hla early in life is a strategic goal of vaccine-mediated protection against Staphylococcus aureus. Anti-Hla serum titers and neutralizing capacity have been demonstrated in infants <1 year of age compared to individuals >2 years of age. To further address the impact of age on anti-Hla responses in infants and pediatric populations, a cohort of 343 subjects aged <1 to 18 years was evaluated.

[0183] Table 1: Characteristics of participants who donated serum samples Serum anti-Hla titers analyzed by age showed that the half-maximal effective concentration (EC50) was highest during the first five years of life. 50 The titer gradually increases, and the titer in children under 2 years old differs most significantly from that in older children. Figure 2A Analysis of serum Hla neutralizing activity in rabbit erythrocyte (rRBC) protection assays confirmed that subjects <2 years of age exhibited immature responses. Figure 2B Recordedly, exposure to Staphylococcus aureus through colonization occurs within the first few days and weeks of life. In fact, mortality rates from Staphylococcus aureus infection in the first four years of life are comparable to those seen in older adults. In conclusion, these data suggest that the risk of both Staphylococcus aureus disease and altered host response to this microorganism occurs early in life.

[0184] Example 2: Development of modified, nontoxic HLA variants A vaccine development approach was designed to induce immunity against Staphylococcus aureus infection via neonatal vaccination. It was hypothesized that Hla-ADAM10 interactions and subsequent conformational changes inducing pore formation might affect vaccine efficacy. A series of modified Hla antigens were designed based on structural determinants and correlations of toxin function, in part based on anticipated immunogenic properties derived from a combination of previous observations and T-cell epitope prediction algorithms. Six different antigens were generated and evaluated, including three full-length Hla variant antigens with 6x histidine tags added to facilitate affinity purification. Figure 3A ):Hla H35L Hla has been extensively studied as a toxoid vaccine that binds to ADAM10 but cannot form stable pores. D45A / Y118F It is expected to interfere with the unfolding of the b-barrel stem domain, and has already Hla R66C / E70CIt is expected to impair the binding of ADAM10. A group of peptide antigens were also investigated ( Figure 3B Hla50, a tandem array of five amino acids from the first 50 amino acids of Hla that elicited protective immunity in animal models; HlaP1, a synthetic antigen containing a tandem array of five predicted T-cell epitopes from an immune epitope database, Hla36-50; and HlaP2, a synthetic antigen containing three distinct predicted T-cell epitopes from Hla (Hla36-50, Hla51-65, and Hla161-175). Each antigen was screened by delivery to groups of mice to examine vaccine efficacy compared to the Freund's adjuvant control. The vaccine was administered to Staphylococcus aureus (1 × 10⁻⁶) mice. 8 After screening by subcutaneous challenge with colony-forming units (CFU), HLA was administered. H35L Hla D45A / Y118F and Hla R66C / E70C The vaccine-treated mice showed protection against abscess formation and skin necrosis. Figure 3C In contrast, mice receiving the peptide vaccine exhibited lesions similar to or larger than those observed in sham-vaccinated mice.

[0185] To further examine the vaccine properties of the three full-length antigens, Hla... D45A / Y118F The HlaR66C / E70C was modified to incorporate the H35L mutation to ensure complete detoxification, which was verified in rabbit erythrocyte lysis assays. Figure 3D HlaH35L is marked as HlaH, and HlaH35L / D45A / Y118F is marked as Hla. HDY And HlaH15L / R66C / E70C is marked as Hla HRE ).

[0186] Example 3: Characterization of modified nontoxic HLA variants As a preliminary functional immune screening, each candidate antigen was delivered to mice using a primary-boost regimen formulated with Freund's adjuvant. As demonstrated by utilizing the ovalbumin-specific OT-II T cell system and ovalbumin-expressing Staphylococcus aureus strains, each candidate antigen enhanced the antigen-specific memory T cell response to infection. Figure 4A To assess B cell responses to the immune response, serum toxin neutralization capacity was determined in a rabbit erythrocyte (rRBC) lysis protection assay, and the half-maximal anti-Hla titer (EC50) in serum from vaccinated mice was quantified. Vaccine-induced antibody responses varied in an antigen-specific manner, where Hla... HRE Triggers a high degree of toxin neutralization ( Figure 4BThese findings suggest that nearly identical antigens based on primary sequences can exhibit different biological properties that alter antigenicity and the host immune response.

[0187] To further characterize the biochemical properties of the candidate antigen, ADAM10 binding was evaluated in a sensitive rRBC binding assay. Compared to wild-type Hla, Hla... H It exhibits the preservation of binding, in which Hla HDY The binding decreases, and Hla HRE The binding was almost completely lost ( Figure 4C Melting curve analysis of each antigen showed that Hla HDY The variant is structurally similar to Hla and Hla. H and Hla HRE different( Figure 4D This was confirmed by SDS-PAGE analysis, in which Hla HDY The variant forms an oligotoxin (Hla7) in solution without being exposed to the cell membrane. Figure 4E Wild-type Hla and other variants exist only in monomeric form (Hla1). The biological properties of these Hla variants on rRBCs were examined. Oligomers formed from wild-type Hla were observed to exhibit temperature stability at up to 65 °C. Figure 4F (Left), this reveals Hla H Functional defects in variants that prevent the formation of temperature-stable oligomers ( Figure 4F Left). hla HDY It retains the ability to oligomerize on the cell membrane in proportion to its binding capacity. Figure 4F (Right), while Hla HRE Limited monomer binding and oligomer formation were clearly observed in the variants. Figure 4F (Left). To evaluate Hla HRE Oligopolymerization efficiency on the rRBC surface was tested with increasing concentrations of Hla. HRE Until reaching Hla H Observed equal amounts of monomeric toxin rRBC binding ( Figure 4G Oligomer density quantification: monomer ratios show, with Hla HRE Compared to the ratio of 1.9:1, Hla H The ratio is 3.6:1, which indicates that, except in Hla HRE In addition to the binding defects observed in the antigen, there are also functional oligomerization defects. Because Hla undergoes a series of ordered intramolecular movements during binding to form heptamer pores, Hla… HRE The relative defect in functional oligomerization may represent a broader conformational restriction in this antigen, based on the incorporation of two cysteine ​​residues that enable disulfide bond formation. To examine Hla...HRE The presence of a disulfide bond between C66 and E70 was determined by mass spectrometry analysis of the antigen, which showed that most purified Hla... HRE It has indeed incorporated intramolecular disulfide bonds. Figure 4H ).

[0188] Example 4: Characterization of vaccine potency of candidate antigens Recognizing that newborns and infants represent the target population for vaccines that enhance anti-H1N1 responses in humans ( Figure 2A and 2B The protective efficacy of each antigen was evaluated in a primary-booster neonatal vaccination model. Figure 5A Several immunological challenges have emerged in vaccine design for the neonatal population. Neonatal immune responses are characterized by delayed germinal center (GC) formation, leading to reduced quantity and quality of affinity-matured antibody responses. Furthermore, the increased frequency of FoxP3+ T regulatory (TREG) cells in newborns, and the presence of maternally derived antibodies that can modulate vaccine antigen availability and presentation, exacerbate the challenges of vaccine formulations for this population. Preliminary investigations were conducted on each candidate antigen formulated with the following four adjuvants: alum, AddaS03 (AS03-like), MPLA+alum (AS04-like), and CpG-ODN1585. This series of adjuvants was chosen for preliminary studies due to their unique immunostimulatory properties, and the broad-based approach to vaccine formulations would allow us to specifically assess the relevance of antigenic variation. For rigorous testing of vaccine protection, a high inoculum of Staphylococcus aureus (1×10⁻⁶) was used. 8 CFU induced primary SSTI in 5-6 week old mice, followed by a secondary attack on the contralateral flank 21 days after primary infection. Figure 5A When prepared with alum, all antigens trigger a reaction against primary abscess formation. Figure 5B (left) and skin necrosis ( Figure 5B (Right) protection. During repeated infections, Hla HRE It induces high levels of protection against abscess formation and skin necrosis. Figure 5C ), while Hla H and Hla HDY The vaccine provides limited protection. Without a booster shot, it offers limited protection compared to HLA. HRE Compared to (94.4±2.6% to 76.5±8.3%), Hla H (76.9±9.3% to 28.4±11%) and Hla HDY Vaccine-mediated protection was significantly attenuated (from 76.1±13% to 11.5±4.6%). During reinfection, regardless of the adjuvant used, Hla... HRE Enhanced protective immunity was observed in all candidate vaccines. Figure 5F AddaS03 (a), MPLA+ alum (b), CpG-ODN1585 (c)). Analysis of anti-Hla neutralizing antibody titers in the serum of mice in each group prior to primary infection showed that, regardless of the adjuvant, Hla-treated mice... HRE The antigen showed significant benefits in those mice. Figure 5D ).

[0189] Correlation analysis of serum anti-Hla antibody response and toxin neutralization activity in each group of immunized mice reflects the importance of vaccine antigens as a major determinant of vaccine-mediated protection, particularly in relation to Hla. H Compared to vaccines, Hla HRE The vaccine elicited an increased antitoxin-neutralizing antibody response in each adjuvant group. Figure 5E Figure 3e, alum, 92.3 times; AddaSO3, 23.8 times; MPLA+alum, 84.2 times; CpG-ODN1585, 14.6 times).

[0190] Example 5: Hla in mice HRE Characterization of protective efficacy Hla HRE The level of immune protection provided, coupled with an increased neutralizing response from functional antitoxins, indicates that this antigen is more effective than Hla. H More effectively, affinity maturation is induced as a result of the GC response. The GC response requires dynamic interactions between antigen-presenting cells, B cells, and T cells within the draining lymph node (dLN). While antigen-specific T cell activation is required to initiate the dLN response to vaccination, differentiated T follicular helper (T follicular helper) cells also play a role. FH ) cells are crucial for affinity-based B-cell positive selection of GCs. In the activated T-cell subsets within the interfollicular region of the dLN, upregulation of CXCR5 enables T cells to localize to nascent GCs, and upregulation of Bcl6, which is a key component of T cell selection, further enhances their ability to target GCs. FH Cell lineage-determining transcription factors. T FH The crucial role of subsets in B cell maturation of GC is evident in Bcl6 knockout mice lacking GC and therefore unable to generate mature antibody responses. To assess whether the nature of the GC response differentiates Hla... H and Hla HRE Antigens were used to investigate the kinetics of developing anti-Hla neutralizing responses to vaccination. Five-week-old mice underwent primitivism-boost vaccine delivery with each antigen supplemented with alum adjuvant due to blood volume and tissue limitations in newborn mice. As early as one week after the booster, Hla... HRE This triggered a situation relative to Hla H Significantly increased Hla neutralizing antibody response ( Figure 6AThree weeks after the booster, when the expected antibody response had fully matured, Hla was observed. H and Hla HRE The neutralizing antibody titers of both antigens increased, however Hla H The magnitude of the induced response is still lower than that of Hla. HRE The magnitude of the response ( Figure 6A By assessing the blocking of Hla binding of radiolabeled molecules ( Figure 6B ) and oligomerization on rabbit erythrocytes ( Figure 6C To assess the functional properties of these induced antibodies. In both studies, Hla... H Compared to the antibodies induced, Hla HRE The resulting antibodies exhibited enhanced performance.

[0191] These studies were extended to directly evaluate Hla. H or Hla HRE Cellular response in vaccine-drained iliac lymph nodes on day 7 post-primary-boost vaccination. The total population of CD19+ GC B cells co-expressing the GL7 / Fas marker (…). Figure 6D ) or proliferating (Ki67+)CD19+GL7+Fas+B cells ( Figure 6E No differences were observed between the two vaccines. Similarly, no significant differences were observed in the total CD4+ T cell subsets of dLN between the two vaccines. Figure 6F In contrast, in Hla HRE The overall CD4+ population of immunized mice ( Figure 6G ) and Ki67+CD4+ cells ( Figure 6H An increase in the median fluorescence intensity of CXCR5 was observed in the cells. Since CXCR5 expression is an early stage of T cell expression... FH Differentiation, necessary for these cells to migrate to newly formed germinal centers, suggests that Hla... HRE The antigen enhanced the precursor T FH Response (pre-T) FH response).

[0192] guess Hla HRE Vaccine-mediated protection can trigger T FH Enhanced response to infection. Seven days after secondary Staphylococcus aureus SSTI, the CXCR5+ subset in the dLN of vaccinated mice was examined. Following infection, sham and Hla... H Clinical lesions remained prominent in vaccinated mice, however Hla HRE Limited clinical lesions among vaccine recipients ( Figure 6I Due to T FHPopulations are relatively rare in dLNs. We first used mass spectrometry to analyze pooled dLNs to gate CXCR5+ cells co-expressing ICOS and PD1, revealing Hla... HRE The CD4+CXCR5+ICOS+PD1+ subset of vaccinated mice relative to Hla H Increased number of vaccinated mice ( Figure 6L To improve the specificity of this analysis, we used flow cytometry to detect CXCR5hi CD4+ T cells co-expressing Bcl6 in single dLN cells harvested after Staphylococcus aureus infection. (Compared with sham and Hla...) H Compared to mice vaccinated with Hla, mice receiving Hla HRE Animals exhibiting CD4+CXCR5hi-Bcl6+T FH The expansion of the group ( Figure 6J ).

[0193] Next, Hla was studied. HRE Does the beneficial effect of vaccination reflect the role of Hla in regulating T cell subsets? While previous studies have shown that Hla attenuates antigen-specific T cell responses, these studies did not include assessments of the functional specificity of the response. Using wild-type Staphylococcus aureus or its equivalent gene D... hla The variants were infected in each mouse group, and dLN was analyzed by mass cytometry 7 days after primary infection. Hla deletion was associated with CXCR. 5+ ICOS + PD1 + T FH The increase in the population is related to ( Figure 6M ). For infection with WT Staphylococcus aureus, D hla And supplementing with plasmids that enable the restoration of Hla expression D hla Analysis of individual mice with the variant (Dhla::phla) confirmed that Hla expression inhibits CXCR5. hi Bcl6 + T FH The group has a negative impact ( Figure 6K ).

[0194] In the field of Staphylococcus aureus, there is a growing recognition that vaccine failure may be partly due to vaccine delivery to a host that is not experiencing a primary infection, and that has a pre-existing immune response that is enhanced by vaccination. HRE The protective efficacy of the vaccine was evaluated in two clinical settings associated with pre-existing immunity: passive transfer of maternal antibodies that modulate vaccine antigen bioavailability and / or antigenicity, and in the context of prior Staphylococcus aureus infection. First, studies were conducted to test Hla. HREDo immunized female mice confer protection against Staphylococcus aureus infection on their offspring? Figure 7A Compared to offspring of alum-immunized mother mice (black), offspring from Hla... HRE Pups from immunized mother mice exhibited protection against skin abscesses and skin necrosis. Figure 7B (blue), which reflects the neutralization of the anti-Hla response ( Figure 7C To assess whether passive transfer of maternal antibodies impairs protective responses to subsequent infant vaccination, circulating anti-Hla antibodies in offspring were examined to adversely affect clinical outcomes of active vaccination. (From sham (grey) and Hla) HRE The pups of the immunized (green) mother mice received Hla HRE The mice were vaccinated and subsequently infected with Staphylococcus aureus. As observed in pups born to mice receiving passive immunization from their mothers (blue), both groups showed protection against Staphylococcus aureus infection, indicating that prior maternal immunization does not negatively impact the functional outcomes of active immunization. Recognizing that passively transferred antibodies are reported to be present up to ~15 weeks of life in mouse offspring, these maternal-infant studies extended this by assessing the duration of serological responses in offspring. Mice in each vaccine group were sampled at weeks 6, 8, 10, and 16 of life, and serum H1N1 neutralizing properties were assessed. Robust passive transfer of anti-H1N1 neutralizing function was observed, consistent with the protection observed after maternal immunization. Figure 7G (Blue). In the mother body Hla HRE HLA offspring born to mother mice that received active immunization after initial immunization (green) and received a Sham vaccine administered only with alum were compared to offspring of mother mice that received the same vaccine. HRE No difference was observed in vaccinated cubs (grey), indicating that exposure to maternal anti-Hla antibodies does not lead to Hla in offspring. HRE Loss of vaccine response function. As expected based on known vaccine response kinetics, a gradual decline in neutralizing antibody titers was observed in all groups over 10–16 weeks. Following reinfection of mice with Staphylococcus aureus in each group, we observed a decrease in neutralizing antibody titers in the absence or presence of maternal H1N1. HRE In all cases of vaccination, Hla was observed HRE Recall anti-H1a serological response in actively immunized mice.

[0195] To extend these studies to directly assess whether prior Staphylococcus aureus infection modulates Hla HRE The protective efficacy of the vaccine was assessed in uninfected mouse groups at 5 weeks of age using Staphylococcus aureus SSTI, followed by HLA with alum alone or with alum adjuvant. HRE Primitive-boost vaccine regimen ( Figure 7D Two weeks after the intensification, Hla HREIt provides near-complete protection against infection on the contralateral flank. Figure 7E This reflects the neutralizing anti-Hla response ( Figure 7F In summary, these findings suggest that using Hla... HRE Vaccination with antigen variants may be less susceptible to the adverse effects of pre-existing immunity on vaccine outcomes.

[0196] To understand Hla HRE The vaccine's versatility was demonstrated by evaluating its protective efficacy in a range of diverse biological settings. Staphylococcus aureus skin infections are typically modeled in male mice, due to both the differences in skin epidermal structure that facilitates histopathological analysis and the degree of lesion differentiation resulting from androgen-mediated Staphylococcus aureus virulence enhancement. First, Hla... HRE The efficacy of the vaccine in protecting female mice from severe SSTI after neonatal vaccination ( Figure 8A This is consistent with triggering an anti-H1N1 neutralizing antibody response. Figure 8B Secondly, the protective efficacy in juvenile mice not exposed to the vaccine at the neonatal stage was evaluated. Three-week-old uninfected mice received Hla with alum alone or with alum adjuvant. HRE The initial immunization, followed by a booster 14 days later. Figure 8C When undergoing a primary Staphylococcus aureus infection, Hla HRE Vaccinated mice showed protection against infection. Figure 8D This also reflects an effective neutralizing anti-Hla antibody response. Figure 8E ).

[0197] Successful vaccine design, evaluation, and implementation in a population requires antigen optimization and an understanding of the mechanisms by which different adjuvants enhance the desired host immune response. Firstly, ensuring Hla... HRE Unlabeled variants of the antigen are functional. With labeled Hla... HRE (HIS-Hla HRE Both the 0.0 and 0.05 portions of the newborn vaccine resulted in significant protection against Staphylococcus aureus skin infections. Figure 9A Although a slight improvement in clinical efficacy was observed in the early stages of infection with the unlabeled variant, the neutralizing IC50 of both antigens was low. 50 Almost the same ( Figure 9B As provided in Example 4, in Hla HRE The adjuvant-specific differences observed in the efficacy of vaccine-mediated protection (alum, AddaSO3, MPLA+alum, and CpG-ODN1585) reflect T in dLN. FH The degree of response. Assess T. FH A negative correlation was observed between cell recovery and clinical abscess size. Figure 9C Based on this finding, IC was observed. 50 and T FH There is a direct correlation between the responses. Figure 9D In summary, these findings highlight the importance of T. FH Response as Hla HRE The importance of immune-related factors in the protective efficacy of vaccines, and the indication that the extent of this response can be modulated by vaccine formulations.

[0198] Example 6: Discussion These findings are based on the observation that the anti-Hla response is a clearly relevant factor in protective immunity against Staphylococcus aureus in the pediatric population. Through population-level analysis of the developmental characteristics of the anti-Hla response in children, a specific window of opportunity for enhancing this functional response was identified in the first two years of life. A novel candidate Hla antigen (Hla) was developed. HRE This drug is characterized by its ability to elicit a strong toxin-neutralizing response when delivered in the context of preclinical vaccination in newborn mice. (Regarding Hla...) HRE Analysis of the protective immune mechanism triggered by T showed FH As Hla HRE The importance of functionally relevant factors for vaccine-mediated protection suggests that prior exposure to Hla (which, according to serological findings, is virtually ubiquitous in adults) is not a successful induction of Hla immunity. HRE A priori limitations on the protective immune response to vaccination.

[0199] It has been recognized that the development of vaccines targeting Staphylococcus aureus is hampered by a lack of understanding of the T-cell response to this pathogen. Therefore, vaccines designed to elicit T-cell-specific immune protection factors have not yet been developed. H1N1 neutralization is crucial for protecting antigen-specific T-cell responses during infection, thus contributing to the observed H1N1 neutralization. HRE The clinical efficacy of vaccines provides a mechanistic explanation. Detoxified Hla variants (including HlaH35L and HlaH35L / H48A) have previously been considered or are being evaluated for vaccine development. The research published in this paper shows that specific antigenic forms of Hla affect the degree of neutralizing antibody response, indicating that some Hla variants may only produce moderate vaccine protection. While this difference in response can be overcome by delivering higher amounts of antigen or alternatively by using a booster regimen, Hla... HRE The efficacy of antigens in enhancing the host immune response can be advantageous for achieving antigen conservation and in settings such as newborns and the elderly where vaccine-induced responses may be limited by the inherent nature of the host's immune system.

[0200] Currently, Hla is a result of the initial vaccine delivery. HRE Antigen Enhancement TFH The exact molecular mechanisms underlying the response and maturation of anti-Hla antibodies are not fully understood. Antigen specificity and the duration of antigen availability to GC B cells are key determinants of the GC response. H Compared to observations after immunization, during Hla delivery HRE Increased CXCR5 expression was subsequently observed on CD4+ T cells, indicating that Hla HRE More effectively stimulates the IL-21 response in dLN because this cytokine is effective against T cells. FH Differentiation is crucial. Surprisingly, relative to Hla... H Hla HRE The substitution of two amino acids in Hla significantly alters vaccination outcomes. Detailed analyses of antigen transport kinetics, cellular uptake, and the duration of antigen availability in GC are needed to fully elucidate the biological differences underlying the observed antigen specificity. H and Hla HRE Functionally, the Hla-ADAM10 complex varies depending on its ADAM10 binding capacity, so it would be meaningful to understand whether the cellular transport of the Hla-ADAM10 complex on specialized and non-specialized antigen-presenting cells modulates antigen distribution and processing.

[0201] Hla was observed when formulated with a variety of different adjuvants. HRE The unique properties of the antigens, as disclosed findings, offer several opportunities to enhance the development of Staphylococcus aureus vaccines. First, they compel attention to the vaccine antigens themselves to optimize vaccination outcomes. Regardless of Hla HRE Whether used in a monovalent environment or in the presence of other vaccine antigens, its biological properties are expected to enhance the induced H1A neutralizing antibody response. Secondly, these studies indicate that T... FH The response can act as a second immune-related factor in vaccine-mediated protection, which can be assessed and potentially targeted in populations through the selection of adjuvants, depending on the target population of the vaccine. Finally, these studies further highlight the importance of Hla neutralization in Staphylococcus aureus vaccines. As a toxin that interferes with the development of T-cell-mediated immunity against Staphylococcus aureus, Hla neutralization is expected not only to protect against Hla-mediated cellular damage during disease, but perhaps more importantly, to ensure the viability of T-cell subsets and their readiness to support a diverse immune response to the pathogen. Therefore, early delivery of Hla-containing vaccines is crucial. HRE The vaccine can provide protection against Staphylococcus aureus infection early in life, but it also allows Staphylococcus aureus vaccines developed for later-life administration to successfully protect against disease-specific virulence factors. Therefore, Hla... HREVaccines could provide a new opportunity to advance the development of Staphylococcus aureus vaccines targeting population levels.

[0202] Example 7: Method Participant group and sample and data collection This study was approved by the University of Chicago Institutional Review Board. Written informed consent was obtained from all participants. Participants were children aged 18 years and younger who had undergone sedation for surgery or imaging studies at Comer Children's Hospital. Upon enrollment, researchers collected swab samples from each participant's anterior nasal cavity, armpit, and groin folds to determine Staphylococcus aureus colonization status using a culture-based approach. Participants or their parents / legal guardians were asked to complete a questionnaire regarding their demographics, current and past medical history, and a history of Staphylococcus aureus infection or known skin and soft tissue infection in the participant or a family member. Finally, serum samples were obtained from each participant. Samples were delabeled and stored in a safe storage facility at -80°C.

[0203] ELISA and antibody neutralization assay Human serum analysis NUNC MAXISORP™ 384-well plates (Fisher Scientific) were prepared with 1 μg / ml HLA in PBS. H35L The plates were coated and incubated overnight at 4°C. The plates were blocked for 2 hours at room temperature with 0.1% bovine serum albumin (BSA) in PBS. Patient serum samples were diluted 1:10 and then doubled for a total of 24 dilutions, and transferred to 384-well MAXISORP™ plates and incubated for 1 hour at room temperature. The plates were washed three times with PBS / 0.05% Tween-20 and incubated for 1 hour at room temperature with goat anti-human HRP conjugated antibody (Southern Biotech) diluted 1:20000. The plates were washed three times and developed with the QUANTABLU™ fluorescent peroxidase substrate kit for 30 minutes at room temperature, stopping the reaction with QUANTALU™ stop solution. Fluorescence was measured at excitation 320 nm and emission 400 nm using a TECAN INFINITE M200 PRO plate reader. For the neutralization assay, patient serum samples were diluted 1:10 in 0.1% BSA / PBS and incubated for 1 hour at room temperature with purified toxin. After incubation, 5 × 10⁻⁶ toxins were added. 7 Pre-washed rRBCs were incubated on a platform shaker at room temperature for 1 hour. The final concentration of the toxin used for assay was 2 nM. Cells were precipitated and the absorbance readings of the supernatant (450 nm) were used to generate a nonlinear regression curve with log(inhibitor) versus response-variable slope using GraphPad Prism software.

[0204] Serum analysis of juvenile mice Serum was diluted 1:25 and then serially diluted fourfold for a total of eight dilutions. Anti-Hla titers were determined by ELISA as previously described, and ELISA absorbance readings (450 nm) were used to generate a four-parameter log(dose)-response curve using Prism software. For the neutralization assay, serum was diluted 1:100 and then serially diluted twice for a total of eight dilutions. The diluted serum was incubated with 2 nM purified toxin at room temperature for 15 minutes, followed by the addition of 5 × 10⁻⁶ toxin. 7 Identify rRBCs and incubate at room temperature for 1 hour. Precipitate cells and debris, and use absorbance readings of the supernatant (450 nm, TECAN INFINITE M200 Pro) to generate a nonlinear regression curve with log(inhibitor) versus response-variable slope using GraphPad Prism software. ELISA and neutralization assays were performed in triplicate.

[0205] Newborn mouse serum analysis 384-well MAXISORP™ plates (Thermo Fisher) were prepared with 50 µL of 1 µg / mL HLA. H35L The plates were coated and incubated overnight at 4°C. Blocked with 0.1% BSA in PBS for 2 hours at room temperature, then incubated with 15 µL of pre-infection neonatal serum for 1 hour at room temperature. The plates were washed three times with PBS / 0.05% Tween-20 and then incubated for 1 hour at room temperature with 15 µL of goat anti-mouse IgG-HRP antibody diluted 1:20000 (Southern Biotech). The plates were washed three times and developed with a 20 µL LMB substrate kit (Thermo Scientific Pierce PI34021) for 15 minutes at room temperature, stopping the reaction with 20 µL of 4N sulfuric acid (Fisher Scientific). Absorbance values ​​were read at 450 nm using a Tecan Infinite M200 Pro plate reader. For the neutralization assay, pre-infection neonatal serum was double-diluted to a total of 16 dilutions and incubated for 1 hour at room temperature with 0.8 pM purified Hla. After incubation, 10 µL of the toxin / serum mixture was added to 1 × 10⁻⁶ ppm of the toxin / serum solution. 7 Pre-washed rabbit red blood cells were incubated in a V-bottom 384-well plate (Thomas Scientific) for 1 hour at room temperature. Cells and debris were precipitated, and the absorbance reading of the supernatant (450 nm, TecanInfinite M200 Pro) was used to generate a nonlinear regression curve with log(inhibitor) versus response-variable slope using GraphPad Prism software.

[0206] Serum analysis of adult mice immunized with high doses Serum was collected at 1, 2, and 3 weeks after the initial and booster 20 µg vaccination. The serum was diluted 1:4 in PBS and assayed as described above.

[0207] Plasmid construction and Hla antigen purification The toxin variant was cloned into the pET24b expression vector containing a C-terminal polyhistidine tag. Hla H35L As previously stated 5 Hla D45A / Y118F It was generated by site-directed mutagenesis using template DNA from the pET24b construct, which contained previously generated wild-type Hla cDNA. The following oligomers were used: D45A positive – 5'GTATTTTATAGTTTTATCGATGCTAAAAATCACAATAAAA 3' (SEQ ID NO: 39); D45A antisense – 5' TTTTATTGTGATTTTTAGCATCGATAAAACTATAAAATAC 3' (SEQ ID NO: 40); Y118F positive – 5' GTATATGAGTACTTTAACTTTTGGATTCAACGGTAATGTTA 3' (SEQ ID NO: 41); Y118F antisense – 5' TAACATTACCGTTGAATCCAAAAGTTAAAGTACTCATATAC 3' (SEQ ID NO: 42). HlaR66C / E70C was previously generated as a GST fusion protein in pGEX6P1 in the Bubeck Wardenburg laboratory. To generate the polyhistidine-tagged protein, template DNA from a pGEX6P1 construct containing R66C / E70C cDNA was used, and primers with restriction sites were used to clone it into the pET24b vector using XbaI and XhoI (New England Biolabs).

[0208] The following primers were used: for sense – 5' CGGCGGCTCGAGATTTGTCATTTCTTCTTT 3'; (SEQ IDNO: 43), antisense – 5'CGGCGGTCTAGAAGGAGGATATATATGGCAGATTCTGATATAATATT 3' (SEQ IDNO: 44).

[0209] The H35L mutation was incorporated into Hla using site-directed mutagenesis with the following primers. D45 / Y118F and Hla R66C / E70CThe constructs contained: 5' CTTATGATAAAGAAAATGGCATGCTCAAAAAAGTATTTTATAGTTTTATCGATG 3' (SEQ ID NO: 45); and 5' CATCGATAAAACTATAAAATACTTTTTTGAGCATGCCATTTTCTTTATCATAAG 3' (SEQ ID NO: 46). The mutants were digested with DpnI (New England Biolabs) and transformed into *E. coli* DH5α on selective agar. Each construct was sequenced (Azenta Life Sciences) for validation. The confirmed clones were then transformed into *E. coli* BL21 for recombinant protein expression and purification.

[0210] peptide sequence Hla 50 Hla P1 and Hla P2 The construct was generated by SynBio Technologies and transformed into BL21 for protein expression and purification. The recombinant toxin variant was purified using the previously described standard protocol, LPS was extracted, and the variant was evaluated by 10% SDS-PAGE followed by Coomassie Brilliant Blue staining.

[0211] Characterization of Hla antigen Hemolysis assay. Rabbit erythrocyte (rRBC) hemolysis was determined by incubating rabbit erythrocytes (Hemostat Labs) with a purified toxin variant ranging from 0.08 to 10 µg / mL at room temperature for 1 hour. After incubation, the cells were pelleted by centrifugation, and the absorbance of the supernatant was measured at 450 nm using a TecanInfinite M200 Pro plate reader. The percentage of rRBC hemolysis relative to the 1% Triton X-100 maximum lysis control was calculated. The assay was performed in triplicate and repeated on different days to ensure reproducibility.

[0212] Analysis of binding and oligomerization of radiolabeled toxins. According to the manufacturer's instructions, Hla is produced by supplementing with T7 RNA polymerase, rifampin (rifamycin), and [ 35In vitro transcription and translation synthesis of [S]methionine was performed using *E. coli* S30 extract (Promega). For the binding assay, 125 µL of 12.5% ​​rabbit erythrocytes (rRBCs) in K-PBSA / βME (20 mM potassium dihydrogen phosphate, 150 mM NaCl, pH 7.4, 1 mg / ml bovine serum albumin, 1 mM β-mercaptoethanol) were incubated with 10 µL of a radiolabeled Hla mixture at room temperature for 5 min. The cells were pelleted, washed twice with ice-cold PBS, resuspended in 200 μL of PBS, and scintillation buffer (Research Products International, Econo-Safe) was added. The radioactivity of the cell-bound toxin was quantified using a Beckman LS6000 scintillation counter. For the oligomerization assay, rRBCs were used as described above, but incubated with 10 μL of a radiolabeled Hla mixture (~1 nM) at room temperature for 1 h. After incubation, cells were pelleted, washed with 500 μl K-PBSA / βME, and then resuspended in 90 μl 1×Laemmli buffer. Samples were aliquoted into 30 μl aliquots and incubated at 37°C, 62°C, and 80°C for 10 min, then loaded onto 10% sodium dodecyl sulfate (SDS)-PAGE gels for electrophoresis. The gels were dried, and the results were visualized using a GE Healthcare Typhoon Trio Imager. For analysis of Hla... HRE Oligomerization capacity was assessed as described above by treating rRBCs with 10 μl of incremental concentrations of radiolabeled Hla mixtures (1× = ~1 nM; 2× = ~2 nM and 5× = ~5 nM) and incubating at 37 °C. Samples were then separated by SDS-PAGE and prepared as described above. For binding and oligomerization assays using vaccine-treated mouse serum, each serum sample was diluted 1:5 in PBS and incubated with 10 µl of radiolabeled Hla for 10 min at room temperature, followed by the addition of rabbit erythrocytes. Assays were performed as described above. Binding assays were performed in triplicate and repeated on different days to ensure reproducibility. Oligomerization assays were performed in single replicates and repeated on different days to ensure reproducibility.

[0213] Hla HRE Proteomics disulfide bond analysisThe purified protein sample was digested with 250 ng of trypsin and incubated overnight at 37°C. The resulting peptides were desalted using a C18 column, and the eluent was dried under a SpeedVac vacuum concentrator. The peptides were analyzed by LC-MS / MS using a Vanquish Neo UHPLC system (Thermo Fisher Scientific) connected to an ORBITRAP ECLIPSE™ Tribrid mass spectrometer with a FAIMS Pro Duo interface. The sample was loaded onto a Neo trap connected to the analytical column (75 µm ID × 50 cm PEPMAP™ Neo C18, 2 µm). The sample was separated over 120 min using a linear gradient of solvent A (0.1% formic acid in water) and solvent B (0.1% formic acid in ACN). For MS acquisition, the FAIMS was switched between -35 V and -65 V CV cycles, with a cycle time of 1.5 sec per CV. MS1 spectra were acquired at 60,000 m / s resolution, with a scan range of 380 to 1400 m / s. Normalized AGC target was set to standard mode, and maximum injection time was set to automatic mode. Single isotope peak determination was performed using peptides, charge states 3 to 8, with a dynamic exclusion filter precursor of 60 ms and a tolerance of ±10 ppm. For MS2 analysis, separated ions were fragmented by 25% and 30% assisted high-energy collisional dissociation (HCD) and acquired in a 30,000 m / s orbital trap. AGC and maximum IT were 200% and 70 ms, respectively.

[0214] The acquired MS / MS data were retrieved using MeroX 2.0 software to identify disulfide crosslinks in the target protein sequence. Disulfide bonds were selected as the crosslinking agent, and the maximum number of missed cleavage sites was set to 4. The precursor quality tolerance was set to 20 ppm, and the fragment quality tolerance was set to 50 ppm. The search results were validated using 5% FDR and precise scoring settings.

[0215] Thermal displacement measurement. Stability of each toxin variant was measured by quantitatively analyzing its melting temperature (50% denaturation point) compared to the wild-type toxin. Each well contained 5 μM protein in 20 mM Tris pH 7.5 and 150 mM NaCl buffer, and 5 × SYPRO™ Orange stock solution diluted 1:20 (Thermo Fisher S6650). Plates were heated from 20 °C to 90 °C in 0.3 °C increments using a STEPONEPLUS™ real-time PCR system (Thermo Fisher). Excitation and emission wavelengths were 490 and 575 nm, respectively.

[0216] bacterial strains Staphylococcus aureus strains USA300 / LAC and syngeneic strains USA300 / LCC Δ hla The mutant was grown overnight at 37°C in trypsin-treated soybean broth (Bacto TSB, Fisher Scientific) with stirring for 14–16 hours. The next day, the strain was passaged in TSB at a 1:100 ratio and prepared for infection modeling as previously described.

[0217] Animal modeling Vaccine preparation and immunization The vaccine antigens were extracted with LPS and prepared with the following: ALHYDROGEL® (InvivoGen), 1:1 antigen with AddaS03 (InvivoGen, 10253-42-02), an AS04-like formulation containing antigen plus 500 µg / mL ALHYDROGEL® (InvivoGen, vac-alu-250) and 50 µg / mL MPLA-SM VacciGrade (InvivoGen, vac-mpla), or a CpG-ODN1585 (InvivoGen) formulation containing antigen plus 2 µg CpG-ODN1585. For immunization of juvenile and adult mice, 20 μg of each antigen was delivered intramuscularly (IM) to 3-week-old male or female C57BL / 6J mouse cohorts on days 0 and 14. For immunization of newborn mice, 2 µg of each antigen was delivered to C57BL / 6 littermates in a total volume of 10 µl IM between P1 and P3, and a booster was delivered at P21 (weaning day).

[0218] Modeling of skin and soft tissue infections All animal experiments were reviewed, approved, and supervised by the Institutional Animal Care and Use Committee (IACUC) of Washington University in St. Louis. To determine antibody titers, serum was collected from 5 mice in each group one week after booster immunization and before Staphylococcus aureus challenge. 5–6-week-old male C57BL / 6 mice were anesthetized by intraperitoneal injection of ketamine (20 mg / kg) and toluidine (5 mg / kg), followed by administration of 1×10⁻⁶ styrosine in 50 µL PBS. 8 Mice were subcutaneously challenged in the right flank using CFU Staphylococcus aureus strain USA300 / LAC. The area of ​​abscesses and skin necrosis (mm²) was measured at 24-hour intervals over 10 days. Mice were then reinfected in the left flank 21–28 days after the initial infection. The size of abscesses and skin necrosis in all studies was determined using the formula A = (π / 2) (length mm) (width mm).

[0219] Cell-based immunoassays Mass spectroscopy flow cytometry analysis As shown, 10 days after primary or secondary infection, inguinal draining lymph nodes (dLNs) were harvested from the ipsilateral side of Staphylococcus aureus-infected mice and processed to obtain single-cell suspensions. For each case, at least three dLNs from individual mice were pooled together. Cells (3 × 10⁶ cells per sample) 6 (1) cells were labeled with cisplatin, and then the cell surface markers and intracellular antigens of interest were stained with the antibody reagents shown in Table 2.

[0220] Table 2. Antibody reagents used in mass cytometry Following the manufacturer's protocol, intracellular staining and cell permeabilization were performed using EBIOSCIENCE™ permeabilization buffer and FoxP3 transcription factor staining buffer. Stained cells were washed, barcoded according to sample, pooled, and analyzed on a Fluidigm CyTOF2 HELIOS™ mass cytometer at the Bursky Center for Human Immunology and Immunotherapy Programs, University of Washington. Debarcoded samples were analyzed using Cytobank software (Beckman Coulter).

[0221] Statistical analysis Statistical analyses of serological studies and all in vitro assays were performed using GraphPad Prism software, employing one-way ANOVA and Tukey or Dunn multiple comparison tests or independent t-tests, with p < 0.05. Statistical significance in skin infection studies was assessed using GraphPad Prism software, employing two-way ANOVA and Tukey multiple comparison tests, with p < 0.05.

[0222] sequence list

Claims

1. A modified alpha-hemolysin (Hla) polypeptide or a derivative or fragment thereof comprising the amino acid substitutions H35L, R66C, and E70C (Hla HRE ) relative to the amino acid sequence set forth in SEQ ID NO:

1.

2. The modified Hla polypeptide of claim 1, comprising the amino acid sequence set forth in SEQ ID NO: 11, or a sequence having at least about 80% identity thereto, or a fragment thereof.

3. A polynucleotide comprising a nucleic acid sequence encoding the modified Hla polypeptide of claim 1.

4. The polynucleotide sequence of claim 3, wherein the modified Hla polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 11, or a fragment thereof, or an amino acid sequence having at least about 80% identity thereto.

5. The polynucleotide sequence of claim 3, wherein the polynucleotide sequence is an isolated polynucleotide sequence, a plasmid, an expression vector, a cosmid, a viral vector, a virus, or a virus-like particle (VLP).

6. A host cell comprising the polynucleotide sequence of claim 3.

7. The host cell of claim 6, wherein the host cell is any of a Chinese hamster ovary (CHO) cell, a HEK 293 cell, a human cervical carcinoma cell (Hela), a Madin-Darby canine kidney (MDCK) cell, a human hepatocellular carcinoma cell (HepG2), a baby hamster kidney cell (BHK), a monkey kidney cell (CV1), a Vero cell, a CEM cell, a 721.221 cell, a H9 cell, a Jurkat cell, a Raji cell, a W138 cell, a COS-7 cell, a 293 cell, a HepG2 cell, a 3T3 cell, or a RIN cell.

8. An immunogenic composition comprising the modified Hla polypeptide of claim 1 or a derivative or fragment thereof, or a polynucleotide sequence encoding an Hla polypeptide, and at least one pharmaceutically acceptable excipient.

9. The immunogenic composition of claim 8, further comprising a pharmaceutically acceptable adjuvant.

10. The immunogenic composition of claim 9, wherein the adjuvant is selected from the group consisting of alum, AddaS03 (AS03-like), MPLA and alum (AS04-like), Freund's, CpG-ODN 1585, and any combination thereof.

11. The immunogenic composition of claim 8, further comprising at least one additional active agent.

12. A method of inducing an immune response against a bacterial pathogen in a subject in need thereof, comprising administering to the subject the modified Hla polypeptide of claim 1.

13. The method of claim 12, wherein administration of the modified Hla polypeptide to the subject results in an enhanced germinal center (GC) or T follicular helper (TFH) response or a reduced severity of skin and soft tissue infections, invasive Staphylococcus aureus disease, sepsis, and carriage as compared to administration of an immunogenic composition comprising a modified Hla polypeptide having only the substitution H35L relative to the amino acid sequence set forth in SEQ ID NO:

1.

14. The immunogenic composition of claim 12, wherein the subject is a mammal.

15. The immunogenic composition of claim 14, wherein the subject is a human.

16. The immunogenic composition of claim 15, wherein the subject is a child less than 3 years of age, or less than 2 years of age, or less than 1 year of age, or less than 12 months, or 11 months, or 10 months, or 9 months, or 8 months, or 6 months, or 5 months, or 4 months, or 3 months, or 2 months, or 1 month, or less than 4 weeks, or 3 weeks, or 2 weeks, or 1 week of age.

17. The immunogenic composition of claim 15, wherein the human is a pregnant woman.

18. The method of claim 12, wherein the bacterial pathogen is Staphylococcus aureus.

19. The method of claim 12, wherein the method further comprises at least 1, at least 2, at least 3, or more additional administrations of the immunogenic composition.

20. The method of claim 12, further comprising administering at least one additional immunogenic antigen.

21. The method of claim 20, wherein the at least one additional immunogenic antigen is selected from the group consisting of antigens selected from Opp3a, DltD, HtsA, LtaS, IsdA, IsdB, IsdC, SdrC, SdrD, SdrE, SdrF, SdrG, SdrH, SrtA, SpA, Sbi, FmtB, beta-hemolysin, fibronectin binding protein A (fnbA), fibronectin binding protein B (fnbB), coagulase, Fig, Map, leukocidin (Pvl), alpha-toxin and variants thereof, gamma-toxin (hlg) and variants, Ica, immunodominant ABC transporter, Mg 2+ transporter, Ni-ABC transporter, RAP, autolysin, laminin receptor, IsaA / PisA, IsaB / PisB, SPOIIIE, SsaA, EbpS, SasA, SasF, SasH, EFB (FIB), SBI, Npase, EBP, bone sialoprotein II, staphylohemolysin precursor (AUR) / Sepp1, CNA and fragments thereof, e.g., M55, TSST-1, mecA, poly-N-acetylglucosamine (PNAG / dPNAG) exopolysaccharide, GehD, EbhA, EbhB, SSP-1, SSP-2, HBP, vitronectin binding protein, HarA, EsxA, EsxB, enterotoxin A, enterotoxin B, enterotoxin CI, and novel autolysins.

22. The method of claim 12, wherein the administration is by intravenous, intramuscular, subcutaneous, oral, or intraperitoneal route.

Images