Acid-resistant cyclodextrin glucosyltransferase mutant and application thereof

Abstract

The invention discloses an acid-resistant cyclodextrin glycosyl transferase (CGTS) mutant and an application of the acid-resistant cyclodextrin glycosyl transferase CGTase mutant. The acid-resistant cyclodextrin glycosyl transferase CGTase mutant has the advantages that the acid-resistant cyclodextrin glycosyl transferase CGTase mutant can be used as an acid-resistant mutant; the CGTase is subjected to multi-site directed mutation based on an artificially designed wild type sequence (the amino acid sequence is as shown in SEQ ID NO: 2), and an acid-resistant mutant (the amino acid sequence is as shown in SEQ ID NO: 16) with the optimal reaction pH of 5.0 is obtained. The mutant can maintain more than 80% of catalytic activity in a pH range of 4.0-5.5, and can be stabilized for 10 hours under a strong acid condition (pH is 4.0). Compared with a wild type, the mutant has a higher conversion rate, a shorter reaction period and better substrate stability in the process of synthesizing 2-O-alpha-D-glucopyranosyl-L-ascorbic acid (AA-2G), the industrial production efficiency of the AA-2G can be remarkably improved, and the mutant has an important application value.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering and enzyme engineering, and particularly relates to a cyclodextrin glucosyltransferase (CGTase) mutant with an optimal pH of 5.0 and excellent stability in a highly acidic environment, a coding gene thereof, a recombinant expression vector, a recombinant bacterium and application thereof in catalyzing synthesis of 2-O-alpha-D-glucopyranosyl-L-ascorbic acid (AA-2G). BACKGROUND

[0002] L-ascorbic acid (vitamin C) is an essential nutrient for the human body, which is involved in various physiological processes such as collagen synthesis, antioxidant defense and iron absorption. However, the enolic hydroxyl group at C-2 position of the vitamin C molecule is extremely active in chemical properties, and is easily oxidized and inactivated in the presence of light, heat, oxygen and metal ions, which seriously affects its storage stability and application effect in the fields of food, medicine and cosmetics. To overcome this defect, the development of stable vitamin C derivatives has become an important research direction. Among them, 2-O-alpha-D-glucopyranosyl-L-ascorbic acid (AA-2G) is considered to be one of the most promising vitamin C derivatives due to its stable structure, high bioavailability and good safety. AA-2G can be hydrolyzed by alpha-glucosidase in vivo to release vitamin C and glucose with complete biological activity, and therefore has wide application potential in high-value skincare products, functional foods and pharmaceuticals.

[0003] At present, the industrial production of AA-2G mainly adopts the enzyme catalysis method, in which cyclodextrin glucosyltransferase (CGTase, EC 2.4.1.19) is widely used due to its high transglycosylation capacity. CGTase can specifically catalyze the synthesis of AA-2G by taking cyclodextrin, starch or its derivatives as a glycosyl donor and vitamin C as a receptor. However, there is a key contradiction in this process: vitamin C is most stable under acidic conditions and is easily degraded in neutral or alkaline environments, so the reaction system usually needs to be controlled between pH 4.0-5.5; and the optimal pH of most CGTases from natural sources or reported is in the neutral or weak alkaline range (pH 6.0-8.0), and the enzyme activity significantly decreases under acidic conditions, which limits the catalytic efficiency, prolongs the reaction period and increases the loss of raw materials.

[0004] Some studies in the prior art have attempted to optimize the catalytic properties of CGTases through protein engineering. For example, CN112626094A discloses a CGTase derived from a deep-sea metagenome, which has an optimum pH of 7.0 and maintains a certain activity in a relatively wide pH range, but the catalytic efficiency under acidic conditions is still not ideal. CN111534498B reports that a CGTase derived from Paenibacillus macerans was subjected to tyrosine site-directed mutation (Y195F, Y260F), and a mutant with an optimum pH of 5.5 was obtained, which significantly improved the production of AA-2G, but its optimum pH was still higher than the optimal stable pH of vitamin C (about 5.0), and in actual production, a trade-off between activity and stability still needs to be made. In addition, CN104531629B discloses a CGTase mutant (K228R, D367S) derived from Bacillus stearothermophilus NO2, which has an optimum reaction pH of 5.0, which is consistent with the stable pH of vitamin C, but the long-term operational stability of this mutant in a wider acidic range has not been fully verified.

[0005] On the other hand, to reduce production costs, research has also focused on developing CGTase variants that can utilize inexpensive substrates (such as soluble starch, malt dextrin) and their efficient expression systems. For example, CN103589699B improved the affinity of CGTase for soluble starch by fusing self-assembling peptides; CN113025590B improved the secretion expression and activity of CGTase through fermentation process optimization. However, these works, although helpful in improving catalytic economy, have not fundamentally solved the core problem of insufficient catalytic activity of the enzyme at pH 5.0, the optimal stable point.

[0006] In summary, there is still a lack of CGTases in the prior art that have an optimum pH matching the optimal stable pH of vitamin C (5.0) and simultaneously have high catalytic activity and excellent stability in a wide acidic range. Although some studies have achieved partial optimization of pH properties through rational design, or adjusted the optimum pH to 5.0, achieving high enzyme activity and high stability at this pH is still a technical problem that needs to be overcome. Therefore, developing an acid-resistant CGTase that has the highest catalytic efficiency at pH 5.0, while maintaining high stability in the pH range of 4.0-5.5, is suitable for the large-scale production of AA-2G, and is of great significance for promoting the industrialization process of this product. SUMMARY

[0007] Based on this, the application successfully obtains an acid-resistant mutant with an optimum pH of 5.0 by systematic protein engineering modification, rational design and mutation screening of CGTase from a specific source. The mutant not only exhibits the highest catalytic activity at pH 5.0, but also can maintain more than 80% relative enzyme activity in the pH range of 4.0-5.5, and has excellent operating stability under strong acid conditions, truly realizing the unification of "enzyme activity maximization" and "substrate stabilization" at the optimum pH point, and providing an innovative enzyme catalysis solution for efficient, low-consumption and large-scale production of AA-2G.

[0008] The technical scheme adopted by the application is:

[0009] The application provides an acid-resistant cyclodextrin glucosyltransferase mutant, the mutant is that the asparagine at the 143th position of the amino acid sequence shown in SEQ ID NO.2 is mutated into aspartic acid, the tyrosine at the 261th position is mutated into phenylalanine, and the histidine at the 389th position is mutated into asparagine.

[0010] The mutant has an optimum reaction pH of 5.0, and more than 80% relative enzyme activity in the pH range of 4.0-5.5.

[0011] After the mutant is incubated at pH 4.0 and 30 DEG C for 10 hours, the residual enzyme activity is more than 80% of the initial enzyme activity.

[0012] The application further provides a gene encoding the acid-resistant cyclodextrin glucosyltransfer mutant, and the nucleotide sequence is shown in SEQ ID NO.9.

[0013] The present invention also provides mutants of cyclodextrin glucosyltransferase as one of the following: (1) the asparagine at position 143 of the amino acid sequence shown in SEQ ID NO.2 is mutated to aspartic acid (i.e., mutant N143D, nucleotide sequence of SEQ ID NO.3, amino acid sequence of SEQ ID NO.4); (2) the tyrosine at position 261 of the amino acid sequence shown in SEQ ID NO.2 is mutated to phenylalanine (i.e., mutant Y261F, nucleotide sequence of SEQ ID NO.5, amino acid sequence of SEQ ID NO.6); (3) the histidine at position 389 of the amino acid sequence shown in SEQ ID NO.2 is mutated to asparagine (i.e., mutant H389N, nucleotide sequence of SEQ ID NO.7, amino acid sequence of SEQ ID NO.8); (4) the asparagine at position 143 of the amino acid sequence shown in SEQ ID NO.2 is mutated to aspartic acid, and the tyrosine at position 261 is mutated to phenylalanine (i.e., mutant N143D / Y261F, nucleotide sequence of SEQ ID NO.9, amino acid sequence of SEQ ID NO.4). NO.10; (5) The asparagine at position 143 of the amino acid sequence shown in SEQ ID NO.2 is mutated to aspartic acid, and the histidine at position 389 is mutated to asparagine (i.e., mutant N143D / H389N, nucleotide sequence is SEQ ID NO.11, amino acid sequence is SEQ ID NO.12); (6) The tyrosine at position 261 of the amino acid sequence shown in SEQ ID NO.2 is mutated to phenylalanine, and the histidine at position 389 is mutated to asparagine (i.e., mutant Y261F / H389N, nucleotide sequence is SEQ ID NO.13, amino acid sequence is SEQ ID NO.14); (7) The asparagine at position 143 of the amino acid sequence shown in SEQ ID NO.2 is mutated to aspartic acid, and the tyrosine at position 261 is mutated to phenylalanine, and the histidine at position 389 is mutated to asparagine (i.e., mutant N143D / Y261F / H389N, nucleotide sequence is SEQ ID NO.15, amino acid sequence is SEQ ID NO.16).

[0014] The present invention also provides a recombinant expression vector containing the said gene.

[0015] The present invention also provides recombinant genetically engineered bacteria comprising the gene or the recombinant expression vector.

[0016] The present invention also provides the application of the mutant, the gene, the expression vector, or the recombinant genetically engineered bacteria in catalyzing glycosyltransfer reactions.

[0017] The glycosyl transfer reaction is catalytic synthesis of 2-O-α-D-glucopyranosyl-L-ascorbic acid (AA-2G) with cyclodextrin or starch derivatives as a glycosyl donor, L-ascorbic acid as a glycosyl acceptor.

[0018] The application also provides a method for catalytic production of 2-O-α-D-glucopyranosyl-L-ascorbic acid (AA-2G), comprising the following steps:

[0019] In the reaction system with pH of 4.0-5.5, L-ascorbic acid and maltodextrin are added, and the mutant, the recombinant genetically engineered bacteria expressing the mutant or the crude enzyme solution thereof is used for catalytic reaction at 30-50 DEG C; the concentration of the L-ascorbic acid is 100 g / L, the concentration of the maltodextrin is 100 g / L; the pH of the reaction is 5.0, and the reaction time is 12-24 hours.

[0020] Beneficial effects:

[0021] The mutant provided by the application has an optimal reaction pH of 5.0, which is completely matched with the optimal pH value of L-ascorbic acid in solution, so that the enzyme can exert the highest catalytic activity in the most stable environment of the substrate; the mutant not only has the highest activity at the optimal pH of 5.0, but also can maintain a relative enzyme activity of more than 80% in a wide acid range of pH 4.0 to 5.5, showing excellent pH adaptability; compared with the low conversion rate of the wild-type enzyme at pH 5.0 or the serious degradation of the substrate at pH 6.0, the mutant catalytically synthesizes AA-2G at pH 5.0, and the conversion rate can be increased from less than 26.2% of the wild-type to 58.4%, and the reaction period can be shortened from more than 24 hours to about 12 hours. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 pH effect on the enzyme activity of wild-type CGTase and mutant N143D / Y261F / H389N;

[0023] Figure 2 pH tolerance experiment of wild-type CGTase and mutant N143D / Y261F / H389N, the line of square dot in the figure is the residual relative enzyme activity data of wild-type CGTase, and the line of round dot is the residual relative enzyme activity data of mutant N143D / Y261F / H389N. DETAILED DESCRIPTION

[0024] In order to better explain the purpose, technical scheme and advantages of the application, the following examples are provided to further illustrate the application. It should be understood that the specific examples described herein are only used to explain the application, and are not used to limit the application.

[0025] Example 1: Transformation of recombinant plasmid pET-28a-CGTase

[0026] The wild-type CGTase was obtained by synthesizing a gene (after codon optimization, the nucleotide sequence is shown as SEQ ID NO. 1) derived from microorganism Acidobacteria bacterium (NCBI: MCU1268007.1) by General Biosystems (Anhui) Co., Ltd. The obtained wild-type cyclodextrin glucosyltransferase gene was inserted into the expression vector pET-28a(+) using restriction endonucleases Nde I and BamH I, thereby producing the recombinant vector pET-28a-CGTase. The recombinant vector was transformed into E. coli BL21(DE3) by a conventional transformation method, obtaining the genetically engineered bacterium E. coli BL21(DE3)-pET-28a-CGTase containing the wild-type cyclodextrin glucosyltransferase gene and preserving it in a -80°C ultra-low temperature refrigerator.

[0027] Example 2: Obtaining of mutants

[0028] Single-point mutants or combined mutants were obtained by site-directed mutagenesis, and the primers for site-directed mutagenesis were designed by CE Design V1.04 provided by Qiagen. The mutant primers are shown in Table 1.

[0029] Table 1 Mutant primers

[0030] mutation Nucleotide sequence of the mutation primer Corresponding sequence number N143D -F ACTTCGACGATCTCGTTACCGCGGCTCACCAG SEQ ID NO :17 N143D -R AACGAGATCGTCGAAGTCAGTCCAGCTATTGC SEQ ID NO :18 Y261F -F TGGGAATTCAGCTTTGCGAATTCTATCTACAGC SEQ ID NO :19 Y261F -R GCAAAGCTGAATTCCCAACCCCAGGTCACGTG SEQ ID NO :20 H389N-F GCAGTACTTGAACAACGATACCAGCGGAGGCA SEQ ID NO :21 H389N -R CGTTGTTCAAGTACTGCTCAGTACCATAGTAAATACA SEQ ID NO :22

[0031] The site-directed mutation used the pET-28a-CGTase recombinant plasmid as a template, and the Vazyme 2xphanta master mix was used for whole plasmid amplification. The reaction system was set according to Table 2.

[0032] Table 2 Site-directed mutation system

[0033] Name Volume (μl) Vazyme 2x phanta master mix 12.5 μL pET-28a-CGTase vector template 1 μL Primer-F 1 μL Primer-R 1 μL ddH2O Added to 25 μL

[0034] The PCR program was as follows: 94°C pre-denaturation for 3 min, 94°C denaturation for 30 s, 65°C annealing for 30 s, 72°C extension for 5 min, 30 cycles of reaction, then 72°C extension for 10 min, and finally 4°C incubation. After the PCR reaction was completed, 1 μL of DpnI digestion enzyme was added, and the template was digested at 37°C for 2 h. The purified PCR product was recovered and transformed into E. coli BL21 (DE3) competent cells.

[0035] Transformation method: 10 μL PCR product was mixed with 100 μL of Novagen commercial E. coli BL21 (DE3) competent cells, and then placed in ice bath for 20 min. After 42°C heat shock for 90 s, the mixture was quickly taken out and placed in ice bath for 2 min. Then, 400 μL of LB liquid medium was added, and the mixture was incubated at 37°C and 200 rpm for 60 min. 100 μL of the bacterial solution was spread on a solid LB plate containing 50 μg / mL of kanamycin, and then incubated at 37°C overnight.

[0036] The next day, three recombinant E. coli BL21 strains were selected from the plate. The recombinant bacteria were inoculated into 50 mL of liquid LB medium containing the corresponding resistance (LB (g / L): peptone 10, sodium chloride 10, yeast extract 5) in a 50 mL shaking tube, and then incubated at 37°C and 200 rpm for 12 h. After the incubation, the plasmid was extracted and sent to the General Company for sequencing. Finally, the sequencing results were compared with the wild-type enzyme protein nucleic acid sequence to determine whether the mutation was successful.

[0037] According to the above method, single-site mutation was first performed to obtain recombinant expression bacteria E. coli BL21 (DE3)-pET-28a-N143D, E. coli BL21 (DE3)-pET-28a-Y261 and E. coli BL21 (DE3)-pET-28a-H389N. Then, the recombinant plasmid after the first mutation was used as a template for secondary mutation, and the double-site mutant recombinant expression bacteria E. coli BL21 (DE3)-pET-28a-N143D / Y261F, E. coli BL21 (DE3)-pET-28a-N143D / H389N, E. coli BL21 (DE3)-pET-28a-Y261F / H389N containing cyclodextrin glucosyltransferase mutants were obtained. Finally, the recombinant plasmid pET-28a-N143D / Y261F after the second mutation was used as a template for tertiary mutation, and the triple-site mutant recombinant expression bacteria E. coli BL21 (DE3)-pET-28a-N143D / Y261F / H389N containing cyclodextrin glucosyltransferase mutants were obtained. All the sequencing-corrected recombinant strains were preserved in 10% glycerol at -80°C in an ultra-low temperature refrigerator.

[0038] Example 3: Fermentation of recombinant E. coli

[0039] Eight recombinant Escherichia coli strains containing cyclodextrin glucosyltransferase and its mutant genes obtained in Examples 1 and 2 were inoculated into 5 ml of LB medium containing kanamycin (50 μg / mL) resistance, cultured at 37°C for 8 h, and then transferred to 400 mL of TB fermentation medium at a 2% inoculum size. The medium was then incubated at 37°C and 200 rpm until the bacterial OD reached its maximum. 600 When the concentration reached 0.6, the mixture was transferred to 30℃ and 200rpm for shake-flask induction fermentation for 18 hours. After fermentation, the cells were collected by centrifugation at 8000rpm for 5 minutes. 2g of each of the eight enzyme-fermented cells was weighed, resuspended in 20ml of 50mM Thris pH 8.0 buffer, and sonicated (1s, 2s, 20min). The mixture was then centrifuged at 8000rpm for 30 minutes, and the supernatant was used as the crude enzyme solution of wild-type cyclodextrin glucosyltransferase and the cyclodextrin glucosyltransferase mutant.

[0040] Example 4: Enzyme purification

[0041] To purify the above-mentioned wild-type cyclodextrin glucosyltransferase and cyclodextrin glucosyltransferase mutant, an AKTA prime chromatography system from GE was used, employing a 5 mL HisTrap HP nickel column for affinity chromatography. The column was pre-equilibrated with pH 8.5, 0.5 M NaCl, 20 mM imidazole, and 20 mM sodium phosphate buffer (buffer A). The elution buffer was pH 8.5, 0.5 M NaCl, 0.5 M imidazole, and 20 mM phosphate buffer (buffer B), using a 0%–100% buffer B gradient elution for a total elution time of 60 min. The collected active protein was then further desalted using a Sephacryl S-300 gel column to remove contaminating proteins. The target protein was collected at high concentrations as monitored by UV light. The purified enzyme was then stored at -80°C after determining the protein concentration using the Bradford method for subsequent activity assays.

[0042] Example 5: Enzyme activity assay of wild-type CGTase and mutant CGTase under acidic conditions

[0043] Enzyme activity definition: The amount of enzyme that converts 1 μmol EPS per minute, measured by the dismutation reaction, is defined as one unit of enzyme activity (U). The relative enzyme activity of mutants is compared with the wild-type enzyme activity as 100%.

[0044] Disproportionation activity determination steps: 50 mmol / L pH 5.0 citric acid-sodium phosphate buffer as solvent, respectively, 10 mM EPS (4, 6-ethylene-p-nitrobenzene-α-D maltose heptaglucoside) and 40 mM maltose were prepared, and 300 ul of each was mixed and incubated in a 50°C water bath for 10 min. Immediately add 100 ul of appropriately diluted 8 kinds of pure enzyme liquid obtained in Example 4 to obtain 8 groups of wild type and mutant enzyme mutual control reaction, 10 min later, stop the reaction by boiling. Then add 100ul, 10U / mL α-glucosidase (purchased from Shanghai Yuan Ye Biological Technology Co., Ltd.), and react at 37°C water bath for 1h. Immediately add 100ul lM Na2C03 to terminate the reaction and adjust the pH to about 8.0 to develop color, and measure the absorbance of the sample at 401 nm and calculate the enzyme activity.

[0045] The results are shown in Table 3 below. The enzyme disproportionation activity of the mutant N143D / Y261F / H389N is the highest under acidic conditions at pH 5.0, which is 2.2 times higher than that of the wild type cyclodextrin glucosyltransferase.

[0046] Table 3 Enzyme activity comparison

[0047] Enzyme Enzyme specific activity (100%) Wild type cyclodextrin glucosyltransferase 100% N143D 144% Y261F 181% H389N 163% N143D / Y261F 175% N143D / H389N 166% Y261F / H389N 189% N143D / Y261F / H389N 220%

[0048] Example 6: Enzymatic property determination of wild type CGTase and mutant N143D / Y261F / H389N

[0049] 1. Optimum pH determination:

[0050] According to the enzyme activity determination method described in Example 5, 50 mM citric acid-sodium phosphate buffer (pH 3.0-6.0) and 50 mM pH 7.0 phosphate buffer were used to prepare reaction buffer to determine the optimum pH of wild type CGTase and mutant N143D / Y261F / H389N enzyme. The relative enzyme activity at each pH was calculated based on the highest enzyme activity as 100%.

[0051] Results: As shown in Figure 1 , the optimum pH of wild type CGTase is about 6.0, and the relative enzyme activity at pH 5.0 is only 55%. The optimum pH of mutant N143D / Y261F / H389N is 5.0, and the relative enzyme activity at pH 4.5 and 5.5 is still higher than 90%, and the enzyme activity at pH 4.0 remains about 81%, showing excellent wide acid adaptability.

[0052] 2. pH stability (acid resistance) test:

[0053] Equal amount of pure enzyme solution was mixed with equal volume of 50 mM buffer at different pH (4.0, 5.0, 6.0) to make enzyme solution at different pH environment. Incubation was carried out at 30 °C water bath, and samples were taken at 0, 2, 4, 6, 8, 10 hours and immediately put on ice. The sampled enzyme solution was diluted with buffer at optimal pH (pH 5.0 for mutant, pH 6.0 for wild type), and residual enzyme activity was determined according to the enzyme activity determination method described in Example 5 (at respective optimal pH condition). Relative residual enzyme activity at each time point was calculated based on 0 hour enzyme activity as 100%.

[0054] Results: As shown in Figure 2 wild type CGTase was extremely unstable at pH 4.0, enzyme activity was lost more than 60% after 2 hours of incubation, and completely inactivated after 6 hours. While mutant N143D / Y261F / H389N still maintained more than 80% of initial enzyme activity after 10 hours of incubation at pH 4.0, and more than 93% of initial enzyme activity after 10 hours of incubation at pH 5.0. This indicated that the mutant had extremely strong acid resistance and operational stability.

[0055] Example 7: Synthesis of AA-2G catalyzed by acid-resistant mutant N143D / Y261F / H389N

[0056] 1. Catalytic reaction:

[0057] Reaction system: A total reaction volume of 10 mL was prepared, and L-ascorbic acid (VC) and maltodextrin were added as substrates at a final concentration of 100 g / L, respectively. The pH of the system was adjusted to 5.0 with 1 M NaOH solution, and equal total amount of protein of wild type or mutant N143D / Y261F / H389N crude enzyme solution was added. The reaction system was placed in a constant temperature shaker at 30 °C and 150 rpm for 12 hours in the dark.

[0058] 2. Saccharification and reaction termination:

[0059] 100 U / mL of saccharifying enzyme (used to convert byproduct AA-2Gn to AA-2G) was added to the above reaction solution, and the pH was adjusted to 5.0. The reaction was continued at 50 °C for 24 hours. After the reaction was completed, the reaction solution was boiled in a water bath for 10 minutes to terminate the enzyme reaction, and then quickly cooled to room temperature.

[0060] 3. AA-2G yield analysis:

[0061] The sample after termination reaction was centrifuged at 12000 rpm for 5 min, then filtered with a 0.22 μm filter membrane, and the AA-2G content was detected by high performance liquid chromatography (HPLC). The chromatographic conditions were as follows: Agilent 1200 HPLC system, C18 reversed-phase chromatographic column (4.6 mm x 250 mm), mobile phase was 20 mM dilute phosphoric acid, flow rate was 0.8 mL / min, column temperature was 35℃, ultraviolet detector, injection volume was 10 μL. The AA-2G concentration and conversion rate (calculated based on the molar conversion rate of input L-ascorbic acid) were calculated by external standard method.

[0062] Experimental results: Under the optimum pH 6.0 condition of wild-type CGTase, although its own enzyme activity is high, VC is severely degraded (the color of the reaction solution is obviously yellow), which limits the final AA-2G conversion rate. When the pH is adjusted to 5.0, which is the most stable pH of VC, the wild-type enzyme activity is greatly reduced, and the conversion rate is only 26.2%. However, the acid-resistant mutant N143D / Y261F / H389N provided by the present application shows the highest catalytic efficiency at pH 5.0, which greatly improves the AA-2G conversion rate to 58.4%, which is significantly better than the wild type. This proves that the mutant successfully maximizes the catalytic efficiency at the most stable pH condition of VC, and solves the core contradiction in industrial production.

[0063] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. Any modification, equivalent replacement or improvement made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. An acid-resistant cyclodextrin glucosyltransferase mutant, characterized in that, The mutant is a mutant of the amino acid sequence shown in SEQ ID NO. 2, in which the asparagine at position 143 is mutated to aspartic acid, the tyrosine at position 261 is mutated to phenylalanine, and the histidine at position 389 is mutated to asparagine.

2. The mutant according to claim 1, wherein The mutant has an optimal reaction pH of 5.0 and maintains a relative enzyme activity of 80% or more in the pH range of 4.0-5.

5.

3. The mutant according to claim 2, wherein After incubation of the mutant at 30°C for 10 hours at pH 4.0, the residual enzyme activity is 80% or more of the initial enzyme activity.

4. A gene encoding the acid-resistant cyclodextrin glucosyltransferase mutant of claim 1, the nucleotide sequence of which is shown in SEQ ID NO.

9.

5. A recombinant expression vector comprising the gene of claim 4.

6. A recombinant genetically engineered bacterium comprising the gene of claim 4 or the recombinant expression vector of claim 5.

7. Use of the mutant of any one of claims 1-3, the gene of claim 4, the expression vector of claim 5, or the recombinant genetically engineered bacterium of claim 6 in catalyzing a glycosyltransfer reaction.

8. Use according to claim 7, characterized in that, The glycosyltransfer reaction is a reaction for catalyzing the synthesis of 2-O-α-D-glucopyranosyl-L-ascorbic acid (AA-2G) using cyclodextrin or starch derivatives as a glycosyl donor and L-ascorbic acid as a glycosyl acceptor.

9. A method of catalytic production of 2-0-α-D-glucopyranosyl-L- ascorbic acid (AA-2G), characterized in that, The method comprises the following steps: In a reaction system with a pH of 4.0-5.5, L-ascorbic acid, maltodextrin, and the mutant of any one of claims 1-3, the recombinant genetically engineered bacterium expressing the mutant, or the crude enzyme solution thereof are added, and a catalytic reaction is performed at 30-50°C; the concentration of the L-ascorbic acid is 100 g / L, the concentration of the maltodextrin is 100 g / L, the pH of the reaction is 5.0, and the reaction time is 12-24 hours.

Images