Application of saikoside B4 in preparation of medicine for resisting porcine epidemic diarrhea virus
By using saikosaponin B4 to inhibit the ribosomal frameshift process of PEDV, the problem of inhibiting PEDV replication and proliferation in existing technologies has been solved, achieving effective inhibition of multiple genotype strains and showing good application prospects.
Patent Information
- Application Number
- CN202511807027.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-03
- Publication Date
- 2026-01-20
AI Technical Summary
Existing technologies are insufficient to effectively inhibit the replication and proliferation of porcine epidemic diarrhea virus (PEDV), especially against multiple genotypes of the virus, and face the challenge of high viral mutation rates, which increases the difficulty of prevention and control.
Using saikosaponin B4 as a drug component, it blocks viral replication by inhibiting the -1 ribosome frameshift process of PEDV, selectively inhibiting PEDV proliferation, and is suitable for preparing anti-PEDV drugs.
Saikosaponin B4 exhibits significant inhibitory effects against multiple genotypes of PEDV, is insensitive to viral mutations, and can effectively prevent and treat porcine epidemic diarrhea with high safety.
Smart Images
Figure CN121360127A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of chemical medicine, and particularly relates to application of saikosaponin B4 in preparation of a medicine for resisting porcine epidemic diarrhea virus. BACKGROUND
[0002] Porcine epidemic diarrhea virus (PEDV) is a highly infectious coronavirus belonging to the alpha genus of the coronavirus family, which mainly infects pigs, especially newborn piglets. The mortality rate of newborn piglets after infection is extremely high, and it often brings huge economic losses to the breeding industry. The genome of PEDV is a single-stranded positive-sense RNA of about 28 kb, which encodes various structural proteins and non-structural proteins. In recent years, PEDV has continuously emerged in variant strains, and the pathogenicity and transmission ability of some strains have significantly increased, making it more difficult to prevent and control. At present, the research on PEDV mainly focuses on viral receptor recognition, immune escape mechanism and vaccine development. Although some candidate vaccines have entered the experimental stage, the high mutation rate of the virus is still a major challenge for prevention and control. Therefore, it is urgent to develop an antiviral drug that is not sensitive to virus variation. SUMMARY
[0003] In view of the above problems in the prior art, the application aims to provide application of saikosaponin B4 in preparation of a medicine for resisting porcine epidemic diarrhea virus.
[0004] The technical solution adopted by the application is as follows:
[0005] Application of saikosaponin B4 in preparation of a medicine for resisting porcine epidemic diarrhea virus.
[0006] Saikosaponin B4 is a saponin component in the roots of Bupleurum, which can regulate lipid metabolism and selectively inhibit lipolysis induced by adrenocorticotropic hormone (ACTH) without toxicity to adipocytes.
[0007] The molecular formula of saikosaponin B4 is: 43 H 72 O 14 ;
[0008] The structural formula of saikosaponin B4 is:
[0009]
[0010] In an embodiment of the application, the medicine is a medicine for preventing and / or treating porcine epidemic diarrhea disease caused by PEDV infection.
[0011] In an embodiment of the application, the medicine is a medicine for inhibiting replication of PEDV.
[0012] In an embodiment of the present application, the drug is a drug for inhibiting the proliferation of porcine epidemic diarrhea virus.
[0013] In an embodiment of the present application, the porcine epidemic diarrhea virus comprises one or more genotypes of G1a, G1b, G2a, G2b, G2c.
[0014] In an embodiment of the present application, the drug comprises B4 saikosaponin and a pharmaceutically acceptable adjuvant.
[0015] In an embodiment of the present application, the B4 saikosaponin inhibits the replication, proliferation or prevention of porcine epidemic diarrhea virus by inhibiting the -1 ribosomal frameshifting process of the porcine epidemic diarrhea virus.
[0016] In an embodiment of the present application, the drug is an oral preparation or an injection.
[0017] Compared with the prior art, the present application has the following beneficial effects:
[0018] There is a ribosomal frameshifting element in the middle of the open reading frame 1 (ORF1) of the PEDV genome, and the virus precisely regulates the expression of the genes in the rear part of the ORF1 through the element, and these genes contain the key component RdRP (RNA-dependent RNA polymerase) of the virus replication complex. Inhibiting ribosomal frameshifting can effectively prevent the amplification of PEDV, so the ribosomal frameshifting element is an ideal target for small molecule drugs, and the ribosomal frameshifting element has the characteristics of low mutation rate, so the inhibitors targeting the element are not sensitive to mutations.
[0019] The present application finds a new use of B4 saikosaponin in inhibiting PEDV. Experiments prove that B4 saikosaponin has a significant inhibitory and blocking effect on the -1 ribosomal frameshifting process of PEDV, can effectively inhibit the replication of PEDV, and further inhibit the proliferation of PEDV; and it has an inhibitory effect on various genotypes of PEDV, that is, the process of B4 saikosaponin inhibiting the proliferation of PEDV is not sensitive to the mutation of PEDV. Therefore, B4 saikosaponin can be used for treating and preventing porcine epidemic diarrhea disease caused by PEDV infection, for preparing an anti-PEDV drug, and for preparing a drug for treating and preventing porcine epidemic diarrhea disease caused by PEDV infection, which is a broad-spectrum antiviral drug, not sensitive to the variation of PEDV, and has a good application prospect.
[0020] PEDV is mainly divided into two genotypes: G1 (classical strain) and G2 (variant strain). Among them, G1 type is further divided into G1a and G1b two subgroups, and G2 type is divided into G2a, G2b and G2c three subgroups. The saikosaponin B4 discovered in this application has a very significant inhibitory effect on the five subgroups of PEDV strains (G1a, G1b, G2a, G2b and G2c). BRIEF DESCRIPTION OF DRAWINGS
[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or prior art description will be briefly introduced below.
[0022] Figure 1 The design principle schematic diagram (a), experimental process schematic diagram (b) and experimental results (c) of saikosaponin B4 inhibiting the ribosome frameshifting process of PEDV in the luciferase reporter system.
[0023] Figure 2 The design principle schematic diagram (a), experimental process schematic diagram (b) and experimental results (c) of saikosaponin B4 inhibiting the ribosome frameshifting process of PEDV in the fluorescent protein reporter system.
[0024] Figure 3 The experimental results of saikosaponin B4 of different concentrations on the toxicity of Vero cells and the antiviral activity on PEDV in cells.
[0025] Figure 4 The experimental results of saikosaponin B4 on the inhibition effect of Vero cell CPE (cytopathic effect) caused by PEDV G2c strain.
[0026] Figure 5 The antiviral experimental results of saikosaponin B4 on PEDV (G1a, G1b, G2a, G2b, G2c strains) detected by RT-PCR.
[0027] Figure 6 The antiviral experimental results of saikosaponin B4 on PEDV in live pigs. DETAILED DESCRIPTION
[0028] In the following, only certain exemplary embodiments are simply described. As those skilled in the art can recognize, the described embodiments can be modified in various different ways without departing from the spirit or scope of the present application. Therefore, the drawings and the description are considered to be exemplary in nature rather than limiting.
[0029] Example 1
[0030] Evaluation of saikosaponin B4 on the inhibition of -1 Ribosomal Frameshifting of PEDV (luciferase reporter system).
[0031] 1. Experimental method
[0032] The in vitro cultured cells were used to study the inhibition of saikosaponin B4 on the -1 Ribosomal Frameshifting of PEDV. First, a dual luciferase reporter gene lentivirus vector containing the PEDV viral genome slippage sequence was constructed, and the effect of the drug was detected in the PK15 porcine kidney cell line. The initial screening concentration of the drug was 10 μM.
[0033] 1.1. Luciferase reporter gene vector construction
[0034] (1) Synthesis of PEDV virus -1 Ribosomal Frameshift sliding region gene sequence (5 strains of frameshift elements: G1a, G1b, G2a, G2b, G2c were synthesized respectively). Double enzyme digestion was performed on the lentivirus backbone vector, and the enzyme digestion site was selected as EcoRI + BamHI. The enzyme digestion condition was 37℃ for 15 minutes. After enzyme digestion, the enzyme digestion product was recovered by nucleic acid electrophoresis. For the synthesized PEDV virus -1 Ribosomal Frameshift sliding region gene sequence, first denature at 95℃ for 10 minutes, then anneal at 72℃ for 30 seconds. Then mix the annealing product with the enzyme digestion product at a ratio of 3:1, and add 10 microliters of T4 ligase to the above mixture and incubate at 16℃ constant temperature metal bath for 16 hours. Transform competent cells with plasmid: Take competent cells from -80℃ freezer, thaw on ice, and mix 100 microliters of competent cells with 10 microliters of plasmid (plasmid is a lentivirus vector containing PEDV virus -1 Ribosomal Frameshift sliding region gene sequence) at a ratio of 10 microliters of plasmid. Incubate the mixture on ice for 30 minutes, then heat shock the mixture at 42℃ for 90 seconds. After heat shock, cool the mixture on ice for 10 seconds. Transfer the cooled mixture to a solid LB plate, evenly spread the liquid on the surface of the solid LB medium with a glass rod, then invert the solid LB medium and incubate at 37℃ for 16 hours. After incubation, pick a single colony with a pipette tip and inoculate liquid LB medium. Incubate at 37℃ for 8 hours, then send the sample to a commercial company for sequencing. The correct single colony was expanded and the plasmid was extracted.
[0035] (2) Construct Renilla luciferase to the upstream of -1 Ribosomal Frameshift region and construct Firefly luciferase to the downstream of -1 Ribosomal Frameshift region by homologous recombination.
[0036] The specific method is as follows: the Renilla luciferase and Firefly luciferase gene sequences are amplified by PCR method, and homologous arms are added to the upstream and downstream of the sequences. The vector obtained in step (1) is subjected to PCR to obtain a linearized vector. Nucleic acid electrophoresis and gel recovery are performed to obtain the Renilla luciferase and Firefly luciferase gel recovery products and the linearized vector gel recovery product. Homologous recombination: mix the Renilla luciferase and Firefly luciferase recovery products with the linearized vector gel recovery product at a mass ratio of 3:1, and add 2 microliters of homologous recombination enzyme, and react at 37°C for 15 minutes.
[0037] (3) Transform the competent cells with the plasmid, select single clones and sequence, and amplify and extract the plasmid of the virus backbone vector with correct sequencing. The transformation of competent cells and the extraction step are synchronized with step (1).
[0038] 1.2. Establishment of luciferase reporter gene screening cell system
[0039] (1) Mix the virus backbone vector containing double luciferase and -1 Ribosomal Frameshift region, PMD2.G, and pspax2 packaging vector at a volume ratio of 4:2:1 with PEI, add 70 microliters of PEI per 35 microliters of DNA, and transfect 293T cells.
[0040] (2) Collect the 293T cell culture supernatant after transfection of the virus plasmid for 48h and 72h, centrifuge at 12000g for 10min, remove the cell impurities, and collect the lentivirus particles by cesium chloride gradient centrifugation.
[0041] (3) Add the lentivirus particles to PK15 cells, and after 7 days of infection, select positive cells by Puro. Digest the cells with trypsin to prepare a single cell suspension, and sort the single clones by flow cytometry.
[0042] (4) Genotype the cultured single clone cells, and expand the positive clones to obtain PK15 cells containing -1 Ribosomal Frameshift region (CMV-Renilla-framshift-Firefly).
[0043] 1.3. Drug screening based on luciferase reporter gene
[0044] (1) Five PK15 cells containing -1 Ribosomal Frameshift region were mixed in a ratio of 1:1:1:1:1 and cultured in a 96-well plate. After 24 hours, different test compounds (control group: DMSO; experimental group: saikosaponin B4) were added to the cells, and the drug concentration was 10 μM.
[0045] (2) After 8 hours of culture, the cells were lysed, and luciferase substrate was added to the lysate. After 0.5 hours, the luminescence value was detected by an enzyme marker.
[0046] (3) The luciferase substrate was added, and the luminescence value was detected by an enzyme marker.
[0047] (4) The ratio of firefly luciferase to sea cucumber luciferase was used as a reference for -1 Ribosomal Frameshift efficiency. The higher the ratio, the higher the -1 Ribosomal Frameshift efficiency. The lower the ratio, the lower the -1 Ribosomal Frameshift efficiency, i.e. the lower the ratio, the higher the efficiency of the drug in inhibiting the -1 Ribosomal Frameshift process, and the better the inhibition of the -1 Ribosomal Frameshift process.
[0048] 2. Experimental results
[0049] The experimental results are shown in Figure 1 , Figure 1 The design principle diagram, experimental process diagram, and experimental results of saikosaponin B4 in the luciferase reporter system to inhibit the PEDV ribosome frameshift (-1 Ribosomal Frameshifting) process. Specifically, Figure 1 a is the design scheme of the reporter system. When the ribosome frameshift occurs normally, the reporter genes Renilla and Firefly are expressed, while when the ribosome frameshift is prevented, the reporter gene Renilla is expressed, and the Firefly is not expressed; Figure 1 b is the working process of the multi-mixed screening reporter system. First, the reporter vector is stably integrated into the host cells (porcine kidney cell line PK15) by a lentiviral vector. The mixed system of five positive monoclonal cells is treated with compounds (control group: DMSO; experimental group: saikosaponin B4), and the effect of the compounds on the PEDV ribosome frameshift process is determined by a dual luciferase reporter gene detection kit and an enzyme marker; Figure 1 c is the luciferase reporter gene screening experiment results. From Figure 1As can be seen from Table C, 10 μM of saikosaponin B4 has a significant inhibitory effect on the -1 Ribosomal Frameshifting process of PEDV (G1a, G1b, G2a, G2b, G2c strains) (* indicates P<0.05).
[0050] Example 2
[0051] Evaluation of the inhibitory effect of saikosaponin B4 on the -1 Ribosomal Frameshifting process of PEDV (fluorescent protein reporter system).
[0052] 1. Experimental method
[0053] 1.1. Construction of fluorescent protein reporter gene vector
[0054] (1) Synthesis of PEDV virus -1 Ribosomal Frameshift sliding region gene sequence (synthesis of 5 strains of frameshift elements: G1a, G1b, G2a, G2b, G2c respectively). Double enzyme digestion was performed on the lentivirus backbone vector, and the enzyme digestion site was selected as EcoRI + BamHI. The enzyme digestion conditions were 37°C for 15 minutes. After enzyme digestion, the enzyme digestion product was recovered by nucleic acid electrophoresis. For the synthesized PEDV virus -1 Ribosomal Frameshift sliding region gene sequence, first denature at 95°C for 10 minutes, then anneal at 72°C for 30 seconds, then mix the annealing product with the enzyme digestion product at a ratio of 3:1, add 10 microliters of T4 ligase to the above mixture, and incubate in a 16°C constant temperature metal bath for 16 hours. Transform competent cells with plasmid: Take competent cells from -80°C freezer, thaw on ice, add 10 microliters of plasmid (plasmid is a lentivirus vector carrying PEDV virus -1 Ribosomal Frameshift sliding region gene sequence) to 100 microliters of competent cells, mix well, and place on ice for 30 minutes. Place the mixture of competent cells and plasmid in a 42°C water bath for 90 seconds. After heat shock, cool the mixture of competent cells and plasmid on ice for 10 seconds. Transfer the cooled mixture to a solid LB plate, evenly spread the liquid on the surface of the solid LB medium with a glass rod, then invert the solid LB medium and incubate in a 37°C incubator for 16 hours. After incubation, pick a single colony with a pipette tip and inoculate liquid LB medium. Incubate at 37°C for 8 hours, then send to a commercial company for sequencing. The correct single colony was expanded and plasmid extraction was performed.
[0055] (2) Construct ubiquitin-green fluorescent protein (Ub-GFP) to the upstream of -1 Ribosomal Frameshift region and red fluorescent protein (RFP) to the downstream of -1 Frameshift region by homologous recombination.
[0056] The specific method is as follows: the Ub-GFP and RFP gene sequences are amplified by PCR method, and homologous arms are added to the upstream and downstream of the sequences. The vector obtained in step (1) is subjected to PCR to obtain a linearized vector. Nucleic acid electrophoresis and gel recovery are performed to obtain Ub-GFP and RFP gel recovery products and linearized vector gel recovery products. Homologous recombination: mix the Ub-GFP and RFP gel recovery products with the linearized vector gel recovery products at a mass ratio of 3:1, and add 2 microliters of homologous recombination enzyme, and react at 37°C for 15 minutes.
[0057] (3) Transform the competent cells with the plasmid, select single clones and sequence, and amplify and extract the plasmid of the virus backbone vector with correct sequencing. The transformation of competent cells and the extraction step are synchronized with step (1).
[0058] 1.2. Establishment of fluorescent protein reporter gene screening cell system
[0059] (1) Mix the virus backbone vector containing double fluorescent proteins and -1 Ribosomal Frameshift region, PMD2.G, and pspax2 packaging vector at a volume ratio of 4:2:1 with PEI, add 70 microliters of PEI per 35 microliters of DNA, and transfect 293T cells.
[0060] (2) Collect the 293T cell culture supernatant after transfection of the virus plasmid for 48h and 72h, centrifuge at 12000g for 10min, remove the cell impurities, and collect the lentivirus particles by cesium chloride gradient centrifugation.
[0061] (3) Add the lentivirus particles to PK15 cells, and after 7 days of infection, select positive cells by Puro. Digest the cells to prepare a single cell suspension, and sort the single clones by flow cytometry.
[0062] (4) Genotype the cultured single clone cells, and expand the positive clones to obtain PK15 cells containing -1 Ribosomal Frameshift region (CMV-Ub-GFP-framshift-RFP).
[0063] 1.3. Drug screening based on fluorescent protein reporter gene
[0064] (1) Five PK15 fluorescent reporter gene cells containing -1 Ribosomal Frameshift region were mixed and cultured in a 96-well plate at a ratio of 1:1:1:1:1. After the cells were plated for 24 hours, different test compounds (control group: DMSO; experimental group: saikosaponin B4) were added to the plates. The drug concentration was 10 μM for all groups, and autofluorescent compounds were excluded.
[0065] (2) After culturing for 8 hours, MG132 was added, and after culturing for 4 hours, the changes in fluorescence signal were observed under a high-content fluorescence microscope.
[0066] (3) The ratio of RFP to GFP is used as a reference for the efficiency of -1 Ribosomal Frameshift. The larger the ratio, the higher the efficiency of -1 Ribosomal Frameshift; the lower the ratio, the lower the efficiency of -1 Ribosomal Frameshift. In other words, the lower the ratio, the higher the efficiency of the drug in inhibiting the -1 Ribosomal Frameshift process, and the better it can inhibit the -1 Ribosomal Frameshift process.
[0067] 2. Experimental Results
[0068] Experimental results are as follows Figure 2 As shown, Figure 2 This document presents a schematic diagram of the design principle, experimental procedure, and experimental results for the inhibition of PEDV ribosomal frameshifting by saikosaponin B4 in a fluorescent protein reporter system. Specifically, Figure 2 In the design scheme of the fluorescent protein reporter system, when the ribosome is frameshifted, both the reporter genes GFP and RFP are expressed. When the ribosome frameshift is blocked, the reporter gene GFP is expressed, but RFP is not expressed. Figure 2 The workflow of the multi-stage mixed screening fluorescent protein reporter system is as follows: First, the reporter vector is stably integrated into the host cell (PK15 cell) via a lentiviral vector. Positive monoclonal cells are then treated with compounds (control group: DMSO; experimental group: saikosaponin B4). Fluorescence images are obtained using a high-content fluorescence microscope, and the inhibitory effect of the compounds on the PEDV ribosome frameshift process is determined by fluorescence signal analysis. Figure 2 In the figure, c represents the experimental results of the fluorescent protein reporter system. Figure 2 As shown in Figure c, 10 μM saikosaponin B4 significantly inhibited the -1 ribosomal frameshifting process of PEDV (G1a, G1b, G2a, G2b, and G2c strains) (* indicates P < 0.05).
[0069] Example 3
[0070] Evaluation of the in vitro antiviral activity and cytotoxicity of saikosaponin B4
[0071] 1. Experimental Methods
[0072] Experiments were conducted under P2 laboratory conditions. PEDV virus (G2c strain) was cultured in Vero (African green monkey kidney) cells, and trypsin was added to promote viral adsorption. Two hours after infection, the culture medium was replaced with normal medium, and saikosaponin B4 was added at concentrations of 0.01, 0.0625, 0.125, 0.25, 0.5, 1, 2, 5, 10, 20, 40, and 80 μM. Lesions were observed after 48 hours. Viral replication levels were detected using quantitative real-time PCR. The relationship between drug concentration and viral inhibition rate was calculated, and the viral inhibition rate EC was determined by fitting a curve. 50 Cells were treated with drugs at concentrations of 0.01, 0.0625, 0.125, 0.25, 0.5, 1, 2, 5, 10, 20, 40, and 80 μM individually. Cell viability was determined by the CCK8 assay, and the cytotoxicity rate (CC) was calculated using a fitted curve. 50 The calculation of the selection index SI is CC. 50 / EC 50 .
[0073] 2. Experimental Results
[0074] Experimental results are as follows Figure 3 As shown, the toxicity index CC of saikosaponin B4 in Vero cells 50 The concentration was 38.15 μM, which is the half-maximal cytotoxic concentration (CMC) of saikosaponin B4 against Vero cells. 50 The concentration was 38.15 μM; saikosaponin B4 inhibited the -1 Ribosomal Frameshifting process of PEDV, with a half-maximal effective concentration (EC50) of 38.15 μM. 50 The concentration was 0.08 μM; the selectivity index (SI) was 476.87. An SI value greater than 5.00 indicates that the drug is effective and has high safety, and the larger the value, the wider the safety range of the drug.
[0075] Example 4
[0076] To evaluate the antiviral effect of saikosaponin B4 in in vitro cultured cells.
[0077] 1. Experimental Methods
[0078] Experiments were conducted under P2 laboratory conditions. PEDV virus (G2c strain) was cultured in Vero (African green monkey kidney) cells, and trypsin was added to promote viral adsorption. Two hours after infection, the culture medium was replaced with normal medium, and a compound (DMSO or saikosaponin B4) at a concentration of 1 μM was added. The images were taken under a bright-field microscope after 48 hours.
[0079] 2. Experimental results
[0080] The experimental results are shown in Table 1. Figure 4 As shown in Table 1, the Vero cells without PEDV infection grew well without cytopathic effect (CPE) caused by virus infection. After PEDV infection, the solvent treatment group (DMSO) showed a large amount of CPE, and the cell state was very poor, while the Saikosaponin B4 treatment group showed significantly reduced CPE, and the cell state was close to that of the group without PEDV infection. This indicates that Saikosaponin B4 has a significant inhibitory effect on the Vero cell CPE caused by PEDV G2c strain.
[0081] Example 5
[0082] The antiviral effect of Saikosaponin B4 on different strains (G1a, G1b, G2a, G2b, G2c) of PEDV was evaluated.
[0083] 1. Experimental method
[0084] The experiment was carried out under P2 laboratory conditions, and PEDV virus (G1a, G1b, G2a, G2b, G2c) was cultured in Vero (African green monkey kidney) cells, and trypsin was added to promote virus adsorption. After 2 hours of infection, normal culture medium was replaced, Saikosaponin B4 was added at a concentration of 1 μM, and the virus replication level was detected by fluorescence quantitative PCR after 48 hours.
[0085] The qPCR primers are as follows:
[0086] PEDV M-F GGTTGCTACTGGCGTACAGGTA,
[0087] PEDV M-R GAAGCATTGACTGAACGACCAACA;
[0088] GAPDH-F GAAGGTGAAGGTCGGAGTCA,
[0089] GAPDH-R CATGTAAACCATGTAGTTGAGGTC.
[0090] 2. Experimental results
[0091] The experimental results are shown in Table 1. Figure 5 Figure 5 The results of RT-PCR detection of the antiviral effect of Saikosaponin B4 on G1a, G1b, G2a, G2b, and G2c strains of PEDV are shown in Table 1. Figure 5 As can be seen, saikosaponin B4 has very high significant antiviral effect on G1a, G1b, G2a, G2b and G2c strains of PEDV (*** represents P<0.001), indicating that saikosaponin B4 has a broad-spectrum antiviral effect on PEDV.
[0092] Example 6
[0093] The antiviral effect of saikosaponin B4 on PEDV in live pigs was evaluated.
[0094] 1. Experimental method
[0095] Saikosaponin B4 (drug) was dissolved with DMSO. Twenty-one-day-old PEDV antibody-negative weaned piglets (10 per group) were selected and divided into an experimental group (infection + drug treatment), a positive control group (infection + DMSO) and a negative control group (no infection). After 7 days of pre-feeding, the piglets were orally inoculated with 10.0 TCID50 (half the amount of tissue culture infective dose) of PEDV-G2c strain. The drug was administered by intramuscular injection at a dose of 10 mg / kg body weight. The piglets were treated once a day. The diarrhea score, body temperature and feed intake were recorded. Seven days after infection, the jejunum tissue was collected for virus load detection. Biosafety measures were implemented throughout the experiment (glutaraldehyde disinfection and protective clothing operation).
[0096] 2. Experimental results
[0097] The experimental results are shown in Figure 6 , Figure 6 which are the virus loads in the jejunum tissue of the experimental group and the positive control group, respectively. Figure 6 As can be seen, saikosaponin B4 has very high significant antiviral effect on PEDV (*** represents P<0.001).
Claims
1. Use of saikosaponin B4 in the preparation of a medicine for resisting porcine epidemic diarrhea virus.
2. The use of saikosaponin B4 according to claim 1 in the preparation of a drug for resisting porcine epidemic diarrhea virus, characterized in that, The medicine is a medicine for preventing and / or treating porcine epidemic diarrhea disease caused by porcine epidemic diarrhea virus infection.
3. The use of saikosaponin B4 according to claim 1 in the preparation of a drug for resisting porcine epidemic diarrhea virus, characterized in that, The medicine is a medicine for inhibiting the replication of porcine epidemic diarrhea virus.
4. The use of saikosaponin B4 according to claim 1 in the preparation of a drug for resisting porcine epidemic diarrhea virus, characterized in that, The medicine is a medicine for inhibiting the proliferation of porcine epidemic diarrhea virus.
5. The use of saikosaponin B4 according to claim 1 in the preparation of a drug for resisting porcine epidemic diarrhea virus, characterized in that, The porcine epidemic diarrhea virus includes one or more genotypes of G1a, G1b, G2a, G2b, G2c strains.
6. The use of saikosaponin B4 according to claim 1 in the preparation of a drug for resisting porcine epidemic diarrhea virus, characterized in that, The medicine includes saikosaponin B4 and a pharmaceutically acceptable excipient.
7. The use of saikosaponin B4 according to any one of claims 1 to 6 for the preparation of a drug for resisting porcine epidemic diarrhea virus, characterized in that, The saikosaponin B4 inhibits the replication, proliferation or prevention of porcine epidemic diarrhea virus by inhibiting the -1 ribosome frameshift process of the porcine epidemic diarrhea virus.
8. The use of saikosaponin B4 according to any one of claims 1, 2 or 6 for the preparation of a medicine against porcine epidemic diarrhea virus, characterized in that, The medicine is an oral preparation, an injection.