Application of combination of high-oxygen water and Wuji decoction in medicine for treating helicobacter pylori infectious gastrointestinal diseases
The combination of hyperoxygenated water and Wuji decoction addresses the issues of Helicobacter pylori drug resistance and intestinal dysbiosis by regulating signaling pathways and improving gut microbiota, thus achieving effective treatment of Helicobacter pylori-related gastrointestinal diseases and restoring gut microbiota.
Patent Information
- Application Number
- CN202511534253.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-26
- Publication Date
- 2026-01-20
AI Technical Summary
Due to the widespread use of antibiotics, Helicobacter pylori has become more resistant to antibiotics, reducing the effectiveness of existing treatments for Helicobacter pylori-related gastrointestinal diseases and increasing the risk of intestinal flora imbalance.
The combination of hyperoxygenated water and Wuji decoction inhibits the S100A8/S100A9-TLR4-p38 signaling pathway, downregulates the expression of S100A8, S100A9, TLR4, and p38, suppresses the production of inflammatory factors IL-8 and TNF-α, and upregulates the expression of HSP70 by regulating the HSP70/NF-κB signaling pathway, thereby alleviating the gastric mucosal inflammatory response and improving the expression level of SIgA and the structure of intestinal flora.
High-oxygen water combined with Wuji Decoction can effectively improve gastrointestinal diseases caused by Helicobacter pylori infection, reduce gastric mucosal inflammation, restore intestinal flora balance, adjust intestinal flora structure, and improve treatment efficacy.
Smart Images

Figure CN121360164A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of biological medicine, and particularly relates to application of high-oxygen water combined with Wuji decoction in medicine for treating gastrointestinal diseases caused by Helicobacter pylori infection. BACKGROUND
[0002] Helicobacter pylori (HP) is a microaerophilic bacterium found in the gastric mucosa, which is in the form of a spiral. HP is highly infectious. It is a common pathogenic bacterium in clinical practice and has been listed as a class I carcinogen by the World Health Organization. Many common digestive system diseases such as gastric cancer, gastric ulcer and some diseases outside the digestive system are highly related to HP infection. Epidemiology shows that more than 50% of people in the world have been infected with HP, and the HP infection rates in developed countries and developing countries are about 30% and 80% respectively, and the HP infection rate in China is about 59%. Anti-HP treatment has always been a difficult problem.
[0003] At present, the methods for treating HP in western medicine mainly include triple therapy, quadruple therapy, sequential therapy and concomitant therapy. However, due to the extensive use of antibiotics, the drug resistance of HP to antibiotics increases, and the eradication effect of the four combined schemes composed of different antibiotics on HP is continuously decreasing, and it is easy to cause intestinal flora imbalance and other problems. Therefore, under the current circumstances, it is particularly important to develop effective anti-Helicobacter pylori drugs for treating gastrointestinal diseases caused by Helicobacter pylori infection.
[0004] Wuji pill is composed of three Chinese medicines, namely, Coptis chinensis, Evodia rutaecarpa and Radix Paeoniae Alba. The prescription is simple, and the efficacy is clear. It is widely used in the treatment of digestive system related diseases in clinical practice. High-oxygen water can effectively kill HP. The combination of the two in a certain proportion can effectively resist HP and treat gastrointestinal diseases caused by Helicobacter pylori infection. SUMMARY
[0005] The present application aims to provide application of high-oxygen water combined with Wuji decoction in medicine for treating gastrointestinal diseases caused by Helicobacter pylori infection, so as to solve the problem of increasing drug resistance of Helicobacter pylori to antibiotics due to extensive use of antibiotics.
[0006] To achieve the above-mentioned purpose, the present application provides the following technical scheme:
[0007] The present application provides, in a first aspect, application of high-oxygen water combined with Wuji decoction in medicine for treating gastrointestinal diseases caused by Helicobacter pylori infection.
[0008] Further, the application of high-oxygen water combined with Wuji decoction in the preparation of products for inhibiting or killing Helicobacter pylori.
[0009] Further, the high-oxygen water combined with Wuji decoction can inhibit the S100A8 / S100A9-TLR4-p38 signal pathway, down-regulate the expression of S100A8, S100A9, TLR4, and p38, inhibit the production of inflammatory factors IL-8 and TNF-α, and reduce the inflammatory reaction of the gastric mucosa.
[0010] Further, the high-oxygen water combined with Wuji decoction can regulate the HSP70 / NF-κB signal pathway, up-regulate the expression of HSP70, reduce the expression of NF-κB, and reduce the inflammatory reaction of the gastric mucosa.
[0011] Further, the high-oxygen water combined with Wuji decoction can improve the expression level of SIgA, protect the intestinal barrier, restore the ratio of Firmicutes to Bacteroidetes, improve the intestinal flora species richness, and adjust the intestinal flora structure.
[0012] The second aspect of the present application provides a preparation method of high-oxygen water combined with Wuji decoction, characterized by comprising the following steps:
[0013] S1, preparing Wuji freeze-dried powder: weighing the raw materials according to the following components and weight parts: 1 part of Coptis chinensis, 1 part of Evodia rutaecarpa, and 1 part of Radix Paeoniae Alba, preparing Wuji decoction, and then preparing Wuji freeze-dried powder containing 0.9 g / ml of medicinal effective components from the Wuji decoction;
[0014] S2, preparing high-oxygen water with a dissolved oxygen content of greater than or equal to 18 ml / L;
[0015] S3, mixing the Wuji freeze-dried powder and the high-oxygen water in a ratio of 1:2 to prepare high-oxygen water combined with Wuji decoction.
[0016] Further, the Wuji freeze-dried powder is prepared by weighing the raw materials according to the following components and weight parts: 6 parts of Coptis chinensis, 1 part of Evodia rutaecarpa, and 6 parts of Radix Paeoniae Alba.
[0017] The principle and beneficial effects of the technical solution are at least:
[0018] 1. The high-oxygen water combined with Wuji decoction can improve the general physiological state of HP-infected mice, up-regulate the expression of HSP70 by regulating the HSP70 / NF-κB signal pathway, reduce the expression of NF-κB, and reduce the inflammatory reaction of the gastric mucosa.
[0019] 2. The high-oxygen water combined with Wuji decoction can inhibit the S100A8 / S100A9-TLR4-p38 signal pathway, down-regulate the expression of S100A8, S100A9, TLR4, and p38, inhibit the production of inflammatory factors IL-8 and TNF-α, and reduce the inflammatory reaction of the gastric mucosa.
[0020] 3. High oxygen water combined with Wuji decoction can improve the expression level of SIgA, protect the intestinal barrier, restore the ratio of Firmicutes to Bacteroidetes, improve the intestinal flora species richness, and adjust the intestinal flora structure. BRIEF DESCRIPTION OF DRAWINGS
[0021] Figure 1 Fig. 3 is a schematic diagram of the colon tissue pathological morphology of mice in each group (HE staining, x200);
[0022] Figure 2 Fig. 4 is a schematic diagram of the gastric mucosa pathological morphology of mice in each group (HE staining, x200);
[0023] Figure 3 Fig. 5 is a schematic diagram of the expression of NF-κB protein and HSP70 protein in the gastric mucosa of mice;
[0024] Figure 4 Fig. 6 is a schematic diagram of the protein expression in the gastric mucosa of mice;
[0025] Figure 5 Fig. 7 is a schematic diagram of the expression of NF-κB mRNA and HSP70 mRNA in the gastric mucosa of mice;
[0026] Figure 6 Fig. 8 is a mouse intestinal flora wayne diagram;
[0027] Figure 7 Fig. 9 is a dilution curve, wherein A is a Chao1 dilution curve; B is an Observed_species dilution curve; C is a Shannon dilution curve; D is a Simpson dilution curve; each curve is a sample; K is a blank group (n=6); M is a model group (n=6); G is a high oxygen Wuji decoction group (n=6); X is a western medicine group (n=6);
[0028] Figure 8 Fig. 10 is an alpha diversity index violin diagram, wherein A is a Chao1 index; B is an Observed_species index; C is a Shannon index; D is a Simpson index; K is a blank group (n=6); M is a model group (n=6); G is a high oxygen Wuji decoction group (n=6); X is a western medicine group (n=6); * P<0.05, ** P<0.01;
[0029] Figure 9 Fig. 11 is a principal coordinate analysis (PCoA), wherein K is a blank group; M is a model group; G is a high oxygen Wuji decoction group; X is a western medicine group;
[0030] Figure 10 Fig. 12 is a comparison of the intestinal flora door level of mice in each group, wherein K is a blank group; M is a model group; G is a high oxygen Wuji decoction group; X is a western medicine group;
[0031] Figure 11 For each group of mice intestinal flora genus level comparison, K blank group; M model group; G high oxygen Wuji decoction group; X western medicine group; DETAILED DESCRIPTION
[0032] In order to make the purpose, technical scheme and advantages of the present application more clear, the present application is further described in detail below in combination with embodiments and drawings. Herein, the illustrative embodiments of the present application and their descriptions are used to explain the present application, but not as a limitation of the present application.
[0033] Here, it also needs to be explained that, in order to avoid the unnecessary details from obscuring the present application, only the processing steps closely related to the scheme according to the present application are shown in the drawings, and other details not closely related to the present application are omitted.
[0034] It should be emphasized that the term "comprise / comprising" is used herein to indicate the presence of a feature, element or step, but not to exclude the presence or addition of one or more other features, elements or steps.
[0035] It should be emphasized here that the step marks mentioned below are not a limitation of the order of the steps, but should be understood as that the steps can be performed in the order mentioned in the embodiments, or different from the order in the embodiments, or several steps are performed simultaneously.
[0036] The present application provides, in one aspect, the application of high-oxygen water combined with Wuji decoction in the treatment of Helicobacter pylori infection of gastrointestinal diseases, and specifically, the application in the preparation of products for inhibiting or killing Helicobacter pylori.
[0037] And a preparation method of high-oxygen water combined with Wuji decoction product is provided, comprising the following steps:
[0038] S1, preparing Wuji freeze-dried powder: weighing the raw materials according to the following components and weight parts: 1 part of Huanglian, 1 part of Wuzhuyu and 1 part of Baishao, preparing Wuji decoction, and then preparing Wuji freeze-dried powder containing 0.9g / ml of medicinal effective components from the Wuji decoction;
[0039] S2, preparing high-oxygen water with dissolved oxygen content ≥18ml / L;
[0040] S3, mixing the Wuji freeze-dried powder with the high-oxygen water in a ratio of 1:2 to prepare high-oxygen water combined with Wuji decoction.
[0041] As another embodiment of the present application, the raw materials of Wuji freeze-dried powder can also be weighed according to the following components and weight parts: 6 parts of Huanglian, 1 part of Wuzhuyu and 6 parts of Baishao.
[0042] Among them, Wuji Pill is recorded in many books, and Huanglian Wuji Pill is composed of Huanglian, Wuzhuyu and Baishao in a ratio of 1:1:1 according to the Ancient and Modern Records of Health Preserving Essential Prescriptions, and Wuji Pill recorded in the 2020 edition of the People's Republic of China Pharmacopoeia is composed of Huanglian, Wuzhuyu and Baishao in a ratio of 6:1:6. Wuji Pill is commonly used for the treatment of digestive system diseases, and the number of medicinal ingredients is small, but the curative effect is remarkable. Huanglian, the monarch drug, is bitter and cold, and can clear heat, drain fire and dry dampness; Baishao, the ministerial drug, is bitter, sour and cold, and can harmonize the interior, relieve urgency and stop pain; combined with Wuzhuyu, the assistant drug, which can lower qi, it can help Huanglian to harmonize the stomach and descend adverse qi, and its pungent and hot nature can regulate the excessive bitter and cold of Huanglian and prevent it from damaging the stomach. The three drugs are combined to treat stomach burning pain, abdominal pain and diarrhea caused by liver fire invading the stomach and liver-stomach disharmony.
[0043] In order to verify the effect of the present scheme in the treatment of Helicobacter pylori infection of gastrointestinal diseases, the following experimental examples are provided for verification.
[0044] Experimental preparation: After the mice were adaptively fed for 1 week, in order to avoid the influence of miscellaneous bacteria in the stomach of the mice, ampicillin solution (concentration 0.25 mg / ml) was added to the water, and after 4 days of feeding, modeling was started. According to the random number table method, 38 mice were randomly divided into 11 mice in the blank group and 27 mice in the modeling group, and all the mice were marked with ear tag pliers. The mice in the modeling group were given 0.2 ml of HP bacterial solution per mouse by gavage, and the mice in the blank group were given 0.2 ml of distilled water per mouse by gavage. After 5 times of gavage, 3 mice from each of the blank group and the modeling group were sacrificed by cervical dislocation, and the gastric mucosa was taken for rapid urease test.
[0045] Rapid urease test for Helicobacter pylori infection:
[0046] (1) Put the washed and cut gastric mucosa into a 2 ml centrifuge tube, grind it into a slurry with buffer, and centrifuge at 1000 x g at 4°C.
[0047] (2) The homogenate was taken with a brush and dropped on the central part of the Helicobacter pylori test paper, and then covered with adhesive tape.
[0048] (3) After standing at room temperature for 3 min, the Helicobacter pylori test paper showed purple red as positive, and no color change as negative.
[0049] If the results show that there is no color change on the Helicobacter pylori test paper in the blank group, and the Helicobacter pylori test paper in the modeling group shows purple red as positive, then the modeling group is successfully infected with HP.
[0050] After the modeling was successful, 24 mice in the modeling group were randomly divided into the following three groups according to the random number table method: model group, high-oxygen Wuji decoction group and western medicine group, each group of 8 mice.
[0051] Administration method: gavage, for 2 weeks.
[0052] The blank group and the model group: each mouse was given 0.2 ml (0.1 / 10 g for mice) of distilled water for gavage every day.
[0053] The Gaoyuxiejia decoction group was treated with Gaoyuxiejia decoction 0.2 ml per mouse per day by gavage.
[0054] The western medicine group: according to the four-drug guide for adult treatment of HP infection: the daily required drugs for adult include bismuth potassium citrate granules 440 mg, amoxicillin capsules 2000 mg, clarithromycin tablets 1000 mg and pantoprazole sodium enteric-coated tablets 80 mg. Taking adult body weight 60 kg as the dose standard, and according to the equivalent ratio of 9.1 between mice and human, the required bismuth potassium citrate granules for 20 g mice per day is 1.33 mg, amoxicillin capsules 6.1 mg, clarithromycin tablets 3 mg, and pantoprazole sodium enteric-coated tablets 0.24 mg. The 14-day drug amount is calculated, which is dissolved in 22.4 ml of normal saline, 0.2 ml per mouse per day by gavage.
[0055] Material collection: after the last gavage administration of each group of mice, the mice were sacrificed after fasting for 12 hours. The method of killing was decapitation. The stomach tissue, colon tissue and intestinal feces were taken out, washed with sterile normal saline, and the tissues were divided and stored for detection: one part of the stomach and intestinal tissue was fixed in 4% paraformaldehyde for routine pathological sectioning and staining. The rest of the specimens were frozen in a-80℃ refrigerator, and the protein expression of gastric mucosa S100A8, S100A9, TLR4, p38 and NF-κBp65, HSP70 was detected by Western Blot method; the mRNA expression of S100A8, S100A9, TLR4, p38 and NF-κBp65, HSP70 was detected by qRT-PCR method, and the content of gastric mucosa inflammatory factors IL-8, TNF-α and intestinal tissue SIgA was detected by ELISA method. The change of intestinal flora in feces was detected and analyzed by 16S rDNA sequencing technology.
[0056] Experimental Example 1
[0057] General condition of mice: during the experiment, the spirit, activity, hair, body weight, diet and two excretion conditions of mice were observed and recorded every day.
[0058] Through the observation of each group of mice during the whole experiment, it was found that compared with the blank group, the activity of the model group mice was significantly reduced, the mental state was poor, and drowsiness, rough hair, reduced luster, no obvious weight gain or even weight loss, reduced water intake, yellowish urine and unformed stool appeared. Compared with the model group, the activity, mental state, hair luster, body weight, water intake, and two excretion conditions of mice in the Gaoyuxiejia decoction group and the western medicine group were improved after gavage.
[0059] Experimental Example 2
[0060] HE staining method to observe and evaluate the pathological changes of colon tissue
[0061] (1) Paraffin section deparaffinization: The paraffin section sample is sequentially placed in xylene I, xylene II for 20 min, and after the wax on the sample is dissolved, the sample is sequentially transferred to anhydrous ethanol I, anhydrous ethanol II for 5 min, washed with anhydrous ethanol for 20 s, and then the sample is washed with tap water to remove the alcohol on the sample.
[0062] (2) Staining, dehydration, and mounting: Hematoxylin staining is performed for 5 min, and then the section is washed with water until it is colorless, placed in differentiation solution for 3-5 s, quickly washed with water, placed in return blue solution for 3-5 s, quickly washed with water, stained with eosin for 5 min, and then washed with 85% ethanol, 95% ethanol, anhydrous ethanol I, anhydrous ethanol II, anhydrous ethanol III, n-butanol, xylene I, and xylene II for 3-5 min each. The section is taken out and quickly dried in the air outlet, and then mounted with neutral resin.
[0063] (3) Observation, image capture, and analysis.
[0064] Results: Figure 1 The colon tissue morphology of the mice in the blank group was complete, the gland arrangement was orderly, and no obvious inflammatory cell infiltration was observed. The colon tissue morphology of the mice in the model group was destroyed, the intestinal gland arrangement was disordered, and there was obvious inflammatory cell infiltration. Compared with the model group, the colon tissue morphology of the mice in the high-oxygen Guxi decoction group and the western medicine group was relatively well preserved, the gland structure was restored and improved, and the inflammatory exudation was reduced.
[0065] Experimental Example 3
[0066] HE staining method to observe and evaluate the pathological changes of gastric mucosa
[0067] The HE staining process is referred to Experimental Example 2, and the high-oxygen Guxi decoction group is further subdivided into a low-concentration high-oxygen Guxi decoction group, a medium-concentration high-oxygen Guxi decoction group, a high-concentration high-oxygen Guxi decoction group, and a super-high-concentration high-oxygen Guxi decoction group.
[0068] Under a microscope, the HE-stained sections of the gastric mucosa of the mice in each group were observed. Figure 2 The gastric gland structure was normal, the mucosal layer gland arrangement was regular, the gastric pit cells were still present, and the structure arrangement was normal; the submucosal layer and muscle layer structure were normal; no obvious dilation or hyperemia of the blood vessels in the interstitium was observed; and no obvious lymphocyte infiltration was observed. The model group: The gastric gland structure was severely disordered, the surface mucosal layer gland was severely eroded and missing, a large amount of mucus was secreted, the gastric pit cells were significantly reduced, the structure arrangement was disordered and fused; the submucosal layer was severely edematous and loose; the blood vessels in the interstitium were moderately dilated, hyperemic, and hemorrhagic; and a large number of lymphocytes infiltrated the lamina propria.
[0069] Low concentration high oxygen Wuji group: gastric gland structure moderate disorder, surface mucosa layer glands moderate erosion, loss, a small amount of mucus secretion, gastric pits cells moderate reduction, structure arrangement disorder, fusion; submucosal layer moderate edema, loose; interstitial blood vessels moderate expansion, hyperemia, hemorrhage; more lymphocytes infiltrate in lamina propria.
[0070] Medium concentration high oxygen Wuji group: gastric gland structure moderate disorder, surface mucosa layer glands moderate erosion, loss, a small amount of mucus secretion, gastric pits cells mild reduction, structure arrangement disorder, fusion; submucosal layer mild edema, loose; interstitial blood vessels mild expansion, hyperemia, hemorrhage; more lymphocytes infiltrate in lamina propria.
[0071] High concentration high oxygen Wuji group: gastric gland structure normal, mucosa layer glands arranged regularly, gastric pits cells still exist, structure arrangement normal; submucosal layer and muscle layer structure normal; interstitial blood vessels no obvious expansion, hyperemia; individual lymphocytes infiltrate in lamina propria.
[0072] Super high concentration high oxygen Wuji group: gastric gland structure mild disorder, surface mucosa layer glands mild erosion, gastric pits cells still exist, structure arrangement; submucosal layer high edema, loose; interstitial blood vessels high expansion, hyperemia, hemorrhage; a small amount of lymphocytes infiltrate in lamina propria.
[0073] Western medicine group: gastric gland structure slightly disorder, surface mucosa layer glands focal mild erosion, gastric pits cells still exist, structure arrangement normal; submucosal layer slightly edema, loose; interstitial blood vessels slightly expansion, hyperemia, hemorrhage; less lymphocytes infiltrate in lamina propria.
[0074] Compared with the model group, each concentration high oxygen Wuji group and western medicine group can improve the gastric mucosal inflammation in different degrees. Compared with the western medicine group, the high concentration high oxygen Wuji group has more obvious effect on improving the gastric mucosal inflammation.
[0075] Experimental example 4
[0076] I. ELISA method for detecting the content of IL-8 and TNF-α in mouse gastric mucosa
[0077] (1) All reagents and specimens are slowly balanced to room temperature (18-25℃);
[0078] (2) The mouse gastric mucosa was washed with DEPC water, homogenized and pulverized, centrifuged (1000 r / min, 20 min), and the supernatant was taken;
[0079] (3) The content of IL-8 and TNF-α in mouse gastric mucosa was determined according to the kit instructions.
[0080] Referring to Table 1, the results show that, compared with the blank group, the contents of IL-8 and TNF-α in the gastric mucosa of the model group mice increased significantly (P<0.01). Compared with the model group, the contents of IL-8 and TNF-α in the gastric mucosa of the high-oxygen penthex and western medicine groups decreased significantly (P<0.01).
[0081] Table 1 Comparison of IL-8 and TNF-α contents in the gastric mucosa of mice in each group )
[0082]
[0083] Note: compared with the blank group, ## P<0.01. Compared with the model group, ** P<0.01.
[0084] II. Western Blot method for detecting the protein expression levels of S100A8, S100A9, TLR4 and p38 in gastric mucosa
[0085] Protein extraction: rinse the tissue block with pre-cooled PBS buffer for 2-3 times to remove blood, then cut into small pieces and put into a homogenizer. Before ice-bath homogenization of the sample, add protease inhibitors, and then add 10 times the tissue volume of tissue protein extraction reagent. Transfer the homogenate to a centrifuge tube with a pipette and vortex. Centrifuge at 12000 rpm for 15 min at 4°C, and collect the supernatant, which is the total protein solution.
[0086] (1) Denaturation of total protein solution:
[0087] Add 5 times the loading buffer to the total protein solution of each tissue, vortex first, open the cover for 30 s, then cover and heat at 98°C for 10 min, monitor the consistency of the solution all the time, heat until it is water-like, then centrifuge. First transfer the supernatant to a brand new centrifuge tube with a pipette and mix well, then perform another centrifugation operation;
[0088] (2) Gel preparation:
[0089] After the number of protein molecules is determined, prepare concentrated gels and separation gels with concentrations of 5% and 10% respectively, and immediately start the next stage of preparation;
[0090] (3) Gel filling:
[0091] On the already fixed clean glass plate, first add 10% separation gel, and add water to seal to avoid air bubbles. When the gel becomes hard, use filter paper to absorb excess water, then add 5% concentrated gel, and insert the comb at the same time. When the gel becomes hard again, carefully remove the comb;
[0092] (4) Electrophoresis:
[0093] The protein solution of each sample tissue was electrophoresed with bromophenol blue, and the concentration gel and separation gel voltage was 80V and 130V respectively, and stopped when the bromophenol blue reached the bottom of the gel;
[0094] (5) Membrane transfer:
[0095] After the PVDF membrane was soaked in methanol for 1 min, it was placed in a glass dish containing transfer solution. Three layers of filter paper were placed under the PVDF membrane, followed by one layer of sponge pad, separation gel, three layers of filter paper, and one layer of sponge pad. The bubbles were removed and clamped with a clamp. Then, the transfer solution was added, the current was set to 250 mA, and finally, it was ice-bathed for 1.0 h;
[0096] (6) Blocking:
[0097] The PVDF membrane transferred in the previous step was placed in an appropriate amount of 5% skimmed milk powder, and then shaken on a shaker for 1 h;
[0098] (7) Primary antibody incubation:
[0099] The PVDF membrane was diluted with 5% skimmed milk powder at a ratio of 1:2000, and then placed in a hybridization bag for blocking treatment. Then, it was incubated at 4°C for 1 night. It was washed with PBST for 5 times on a shaker, each time for 5 min;
[0100] (8) Secondary antibody incubation:
[0101] The PVDF membrane was diluted with 5% skimmed milk powder at a ratio of 1:15000, and then placed in a hybridization bag. Then, it was incubated at room temperature for 1 h. It was still washed with PBST for 5 times on a shaker, each time for 5 min;
[0102] (9) Luminescence detection:
[0103] The newly prepared luminescent agent (ECL) was added to the protein side of the membrane, and luminescence detection was performed. The exposure was adjusted according to the different light intensities, and then developed and fixed. In order to analyze the results, the film was scanned and archived, and the optical density value of the target band was analyzed using the Alpha Ease FC software processing system. After saving the picture, the gray value of the protein band was analyzed using Image J.
[0104] The results showed that: compared with the blank group, the expression of S100A8, S100A9, TLR4 and p38 proteins in the gastric mucosa of the model group mice was significantly increased (P<0.01). Compared with the model group, the expression of S100A8, S100A9, TLR4 and p38 proteins in the gastric mucosa of the high-oxygen penthexyl group and the western medicine group mice decreased (P<0.01 or P<0.05).
[0105] Table 2 Comparison of S100A8, S100A9, TLR4 and p38 protein expression levels in the gastric mucosa of mice in each group )
[0106]
[0107] Note: compared with the blank group, ## P<0.01. Compared with the model group, ** P<0.01.
[0108] III. RT-qPCR method for determining the mRNA expression levels of S100A8, S100A9, TLR4 and p38 in the gastric mucosa
[0109] Trizol method for extracting RNA:
[0110] (1) Add about 200 mg of fresh frozen gastric mucosa to 1 ml of Trizol reagent, grind it into a suspension form by using a homogenizer or other tools, transfer it to a 1.5 ml centrifuge tube without ribonuclease using a pipette, and finally perform lysis for 10 min.
[0111] (2) After adding 200 μl of chloroform, mix well by inverting several times, and stand at room temperature for 5 min.
[0112] (3) Centrifuge at 12000 rpm for 15 min at 4 °C, and the sample separates into three layers: the bottom layer is the organic phase, the top layer is the colorless aqueous phase, and the middle layer is the white color. RNA is mainly in the aqueous phase, and the middle white color is DNA and protein.
[0113] (4) About 500-550 μL can be taken per milliliter of extraction solution. Transfer the top aqueous phase (about 500 μl) to another new 1.5 ml centrifuge tube, add 500 μl of isopropanol, mix well, and stand at room temperature for 10 min.
[0114] (5) Centrifuge at 12000 rpm for 10 min at 4 °C, and a white precipitate (RNA) can be seen at the bottom of the tube.
[0115] (6) Remove the supernatant and discard, then add 1 ml of 75% ribonuclease-free ethanol, vortex evenly, and centrifuge at 10000 rpm for 5 min at 4 °C.
[0116] (7) Repeat step 6 once.
[0117] (8) Remove the supernatant and discard, and air-dry the white precipitate (RNA) at room temperature for 5-10 min, then dissolve it with 20 μl of deionized water, and gently blow it to dissolve.
[0118] (9) Take 2 μL of the dissolved precipitate (RNA) and measure OD260, OD280, and OD260 / OD280 values using a microspectrophotometer. Calculate the purity and concentration of the RNA. According to the OD260 / OD280 ratio, the quality of the RNA is calculated according to the OD260 / OD280 ratio of 1.8-2.0 to meet the testing requirements.
[0119] (10) Store the total RNA in a refrigerator at -80 °C to ensure backup.
[0120] RT reverse transcription into cDNA
[0121] First step: genomic DNA removal, add 4x gDNA wiper rMix 4 μl + Total RNA 4 μl + RNase-free water = 16 μl in a RNase-free centrifuge tube, mix well with a pipette, and incubate at 42 °C for 2 min.
[0122] Second step: preparation of reverse transcription reaction system, directly add 4 μl of HiScripIIqRT SuperMix II in the centrifuge tube of the first step, repeat 5 times, mix well with a pipette, incubate at 50 °C for 15 min, reverse transcription at 85 °C for 5 sec, and store at -20 °C.
[0123] Real-time fluorescent quantitative PCR detection
[0124] (1) qPCR system: upstream primer (10 μM) 0.4 μl + downstream primer (10 μM) 0.4 μl + 2x Taq ProUniversal SYBR qPCR Master Mix 10 μl + dilute Template cDNA (deionized water 1:3)
[0125] (2) Reaction program (3 holes): pre-denaturation 30 s (95 °C condition) + denaturation 10 s (95 °C condition) + annealing and extension 30 s (60 °C condition), a total of 40 cycles. Read the absorbance value at each extension stage. Melting curve collection: from 60 °C to 95 °C, with an increase of 0.5 °C per second.
[0126] (3) The primer sequence (5'-3') used is as follows: TLR4 upstream primer: TGGGTCAAGGAACAGAAGCA, downstream primer: TCACACTGACCACTGACACA, and the amplified product has a fragment size of 151 bp. S100A8 upstream primer: ATGCCGTCTGAACTGGAGAA, downstream primer: TGCCACACCCACTTTTATCAC, and the amplified product has a fragment size of 243 bp. S100A9 upstream primer: ACCATCATCGACACCTTCCA, downstream primer: CAGCTTCTCATGACAGGCAA, and the amplified product has a fragment size of 243 bp. GAPDH upstream primer: ATGGGTGTGAACCACGAGA, downstream primer: CAGGGATGATGTTCTGGGCA, and the amplified product has a fragment size of 229 bp. P38 upstream primer: GGTGCCCGAACGATACCAGA, downstream primer: CTCGACAGCTTCTTAACTGCCAC, and the amplified product has a fragment size of 114 bp. Actin upstream primer: CTCCTGAGCGCAAGTACTCT, downstream primer: TACTCCTGCTTGCTGATCCAC, and the amplified product has a fragment size of 91 bp.
[0127] Result analysis
[0128] After amplification, an amplification curve is obtained, and the CT value of the target gene is obtained; S100A8, S100A9 and TLR4 are standardized by using GAPDH, and p38 is standardized by using Actin, and finally, the relative expression amount of the target gene is analyzed by using 2- △△ CT method.
[0129] The results show that, as shown in Table 3, compared with the blank group, the mRNA expression levels of S100A8, S100A9, TLR4 and p38 in the gastric mucosa of the model group mice increased obviously (P<0.01). Compared with the model group, the mRNA expression levels of S100A8, S100A9, TLR4 and p38 in the gastric mucosa of the high-oxygen penthexyl group and the western medicine group mice decreased (P<0.01 or P<0.05).
[0130] Table 3 Comparison of mRNA expression levels of S100A8, S100A9, TLR4 and p38 in the gastric mucosa of mice in each group )
[0131]
[0132] Note: Compared with the blank group, ## P<0.01. Compared with the model group, * P<0.05, ** P<0.01.
[0133] From the above research results, we speculate that after the treatment of HP infected mice by the above scheme, the expression of S100A8 / S100A9-TLR4-p38 signal pathway in the gastric mucosa of mice is inhibited, the expression of S100A8, S100A9, TLR4, p38 is down-regulated, the production of inflammatory factors IL-8, TNF-α is reduced, and the inflammatory reaction of gastric mucosa is reduced.
[0134] Experimental Example 5
[0135] Western Blot method was used to detect the expression levels of NF-κBp65 and HSP70 proteins in the gastric mucosa
[0136] (1) The tissue blocks were rinsed with pre-cooled PBS buffer and then prepared into total protein solution;
[0137] (2) The total protein solution of each sample was added to 5 times buffer and boiled in boiling water for 10 min to denature it. Then, the gel was prepared, the gel was filled, the electrophoresis was performed, the membrane was transferred, and the blocking was performed for 1 h;
[0138] (3) The primary antibodies NF-κBp65, HSP70 and β-actin (NF-κBp65 1:10000, HSP70 1:2000) were added, and incubated at 4°C overnight. TBST was used to wash 5 times on a shaker, each for 5 min. The secondary antibody (1:15000) was added and incubated at room temperature for 1 h, and then washed 5 times in TBST, each for 5 min.
[0139] (4) Freshly prepared ECL mixed solution was added dropwise, and luminescence detection was performed. Development, fixation. The results were analyzed, scanned and archived, and the bands obtained were measured for specimen gray value using Image-J software.
[0140] The expression of NF-κBp65 and HSP70 proteins was detected by Western Blot method Figure 3 and Figure 4 Compared with the blank group, the protein contents of NF-κBp65 and HSP70 in the model group were increased (P<0.01); compared with the model group, the protein content of HSP70 in the high concentration and high oxygen pentoprazole group and the western medicine group was significantly increased, while the protein content of NF-κBp65 was significantly decreased (P<0.01); compared with the western medicine group, there was no statistically significant difference in the protein expression of NF-κBp65 and HSP70 in the high concentration and high oxygen pentoprazole group (P>0.05). The detection results of Western Blot method showed that high concentration and high oxygen pentoprazole soup could reduce the expression of NF-κBp65 protein and increase the expression of HSP70 protein.
[0141] Experimental Example 6
[0142] qRT-PCR detection of gastric mucosa NF-κBp65, HSP70 mRNA expression levels
[0143] (1) The total RNA of gastric mucosa was extracted by Trizol method.
[0144] (2) The reverse transcription reaction system was configured with mRNA as a template, which was divided into two steps. The first step: heating at 42℃ for 2 min, and then reacting with the reaction solution. The second step: heating at 50℃ for 15 min, 85℃ for 5 s, and reverse transcription was completed.
[0145] (3) PCR amplification was performed. The reaction conditions were as follows: pre-denaturation at 95℃ for 30 s, 1 cycle; denaturation at 95℃ for 10 s, annealing / extension at 60℃ for 30 s, 40 cycles; 95℃ for 15 s, 60℃ for 60 s, 95℃ for 15 s, 1 cycle. The primers were designed based on the NCBI database and were completed by Beijing Genki Biotechnology Co., Ltd. using Primer 5.0 software. The expression data of NF-κBp65 mRNA and HSP70 mRNA, melting curve and amplification curve were obtained, and statistical analysis was performed.
[0146] Table 4 PCR amplification table
[0147]
[0148] qRT-PCR detection of gastric mucosa NF-κBp65 mRNA, HSP70 mRNA expression in each group of mice refers to Table 4 and Figure 5 Compared with the blank group, the mRNA contents of NF-κBp65 and HSP70 in the model group were increased (P<0.01); compared with the model group, the mRNA contents of HSP70 in the high-concentration high-oxygen penthexen and western medicine groups were significantly increased, while the mRNA expression of NF-κBp65 was significantly decreased (P<0.01); compared with the western medicine group, the mRNA expression of NF-κBp65 decreased and the mRNA expression of HSP70 increased in the high-concentration high-oxygen penthexen group, but the difference was not statistically significant (P>0.05).
[0149] HSP70 is a heat shock protein (HSPs) that regulates various stages of cell growth, development, differentiation, and death. Under normal conditions, HSP70 in cells is expressed at a low level. After the body is stimulated by various stimuli, the expression of HSP70 in cells increases and participates in the physiological and pathological processes of the body. The expression level of HSP70 increases under stress, which can play an anti-inflammatory role by repairing damaged cells.
[0150] In recent years, a number of studies have shown that HP infection is closely related to the expression of HSP70. HSP70 plays a protective role in gastric mucosa by repairing oxidative damage in the gastrointestinal tract. In addition, HSP70 is involved in inflammatory response and plays an anti-inflammatory role by inhibiting the NF-κB signaling pathway.
[0151] Nuclear factor kappa B (NF-κB) is a transcription factor present in various tissues, capable of regulating the expression of a variety of pro-inflammatory mediators, highly conserved, and almost present in all cells. NF-κB is widely involved in inflammatory response and is an important part of inflammatory response.
[0152] Under normal circumstances, NF-κB is combined with inhibitory protein nuclear transcription factor NF-κB inhibitor protein (IκB) in the cytoplasm, and is in an inactive state. When HP infects gastric epithelial cells, lipopolysaccharide (LPS) binds to T lymphocyte-like receptor (TLR), activates the NF-κB signaling pathway, phosphorylates IκB, and then enters the nucleus to promote the production of inflammatory factors such as IL-8, causing inflammatory damage. The mechanism by which HSP70 reduces gastric mucosal inflammation may be related to the competition of NF-κB complex, which hinders the activation of NF-κB and inhibits the production of inflammatory factors. Therefore, high-oxygen water combined with Wuji decoction can increase the expression of HSP70 and inhibit the expression of NF-κB to treat HP infection gastritis.
[0153] Compared with the blank group, the mRNA content and protein content of NF-κBp65 and HSP70 in the model group mice were significantly increased (P<0.01), indicating that HP infection can increase the mRNA and protein expression of NF-κBp65, and at the same time increase the mRNA and protein expression level of HSP70. It is speculated that after the gastric mucosa is infected with HP, the NF-κB signaling pathway is activated, the expression level of NF-κBp6 is increased, the tissue is damaged by inflammation, and the expression level of HSP70 is increased, which can play a protective role against inflammatory response caused by HP.
[0154] Compared with the model group, the mRNA and protein content of HSP70 in the high-concentration high-oxygen Wuji group and the western medicine group were significantly increased (P<0.01), and the mRNA and protein content of NF-κBp65 were significantly decreased (P<0.01), indicating that the high-concentration high-oxygen Wuji group and the western medicine group can increase the expression of HSP70 and reduce the expression of NF-κBp65. We speculate that after the HP infected mice are treated with drugs, the expression of NF-κB in the gastric mucosa is inhibited, and at the same time the expression of HSP70 is continuously increased, and the inflammation of the gastric mucosa is relieved.
[0155] Compared with the western medicine group, there was no statistically significant difference in the mRNA and protein expression of NF-κBp65 and HSP70 in the high-concentration high-oxygen Wuji group (P>0.05).
[0156] The study showed that the high concentration of high oxygen pentyhex group may regulate the HSP70 / NF-κB signal pathway, up-regulate the expression of HSP70, and reduce the expression of NF-κB, thereby reducing the inflammatory response of gastric mucosa to treat HP infection gastritis.
[0157] Experimental Example 7
[0158] 16S rDNA sequencing analysis of intestinal flora changes in mouse feces
[0159] (1) DNA extraction: CTAB method was selected for extraction, and the quality and quantity of DNA extraction were detected.
[0160] (2) PCR amplification: The V3-V4 fragment was amplified, and the primer sequence was 341F (5'-CCTACGGGNGGCWGCAG-3') and 805R (5'-GACTACHVGGGTATCTAATCC-3').
[0161] (3) PCR product quantification: purified by AmPureXT beads, and quantified by Qubit.
[0162] (4) Amplification product recovery and purification: 2% agarose gel electrophoresis was used for detection, and AMPureXT beads kit was used for recovery.
[0163] (5) Sequencing: Agilent 2100 Bioanalyzer and Illumina library quantification kit were used for evaluation. After gradient dilution, mixing, and NaOH denaturation to single strand, sequencing was performed; NovaSeq 6000 sequencer was used for 2x250 bp double-end sequencing.
[0164] (6) Data processing: RawData was obtained, and CleanData was obtained after splicing, quality control, and chimera filtering. Length filtering and denoising were performed by qiime dada 2 denoise-paired. ASV (feature) characteristic sequence and abundance table were obtained.
[0165] (7) Diversity analysis: Alpha diversity analysis mainly evaluates diversity through Chao1, Observed_species, Shannon, and Simpson index. Principal coordinate analysis diagram was drawn for Beta diversity analysis.
[0166] (8) Species annotation: SILVA database was used for species annotation with NT-16S database, and the abundance of each species in each sample was calculated according to the ASV abundance table.
[0167] Results:
[0168] Figure 1. Venn diagram of intestinal flora ASV analysis of each group of mice
[0169] Each ellipse in the Venn diagram represents a group, the non-overlapping part of the ellipse represents the number of ASVs unique to each group, the overlapping area represents the number of ASVs common to two groups, and the number marked in each area represents the number of ASVs in the area. Reference Figure 6 The composition of intestinal flora in different groups was different. A total of 5672 ASVs were obtained in the four groups, and the total number of ASVs in the blank group, model group, high-oxygen Wuji decoction group and western medicine group was 3056, 1633, 2235 and 405, respectively. The number of ASVs common to the four groups was 109. The blank group had the most unique ASVs, 2103, followed by the high-oxygen Wuji decoction group, with 1287 unique ASVs, the model group had 982 unique ASVs, and the western medicine group had the fewest unique ASVs, 170.
[0170] (II) Dilution curve
[0171] Through the dilution curve, the trend of species change can be observed, and the species richness can be understood. When the curve tends to be flat, it means that the sequencing data volume is gradually reasonable. The Chao1 index, Observed_species index, Shannon index and Simpson index dilution curves of the intestinal flora of mice in each group in this experiment tend to be flat, indicating that the sequencing data volume is reasonable, and the sequencing depth of 15 in this experiment has basically covered all species in the sample. Reference Figure 7 .
[0172] (III) Alpha diversity index
[0173] Alpha diversity can estimate the number of species contained in the community through Chao1 index and Observed_species index, the larger the value, the richer the species; Shannon index and Simpson index can measure community diversity, the larger the index, the higher the species diversity.
[0174] According to the results of 16S rDNA sequencing, compared with the blank group, the Chao1, Observed_species, Shannon, Simpson index of the model group decreased (P<0.05, P<0.01); compared with the model group, the Chao1, Observed_species index of the high-oxygen Wuji decoction group had an increasing trend, and the Shannon, Simpson index decreased slightly (P>0.05), and the Chao1, Observed_species, Shannon, Simpson index of the western medicine 16 group decreased (P<0.01); compared with the western medicine group, the Chao1, Observed_species, Shannon index of the high-oxygen Wuji decoction group was larger (P<0.01), and the Simpson index was larger (P>0.05), referring to Figure 8 and Table 5. According to the Chao1 index and Observed_species index of each group, the blank group has the highest species abundance, followed by the high-oxygen Wuji decoction group, the model group, and the western medicine group has the lowest species abundance. According to the Shannon index and Simpson index, the blank group has the highest community diversity, followed by the model group and the high-oxygen Wuji decoction group, and the western medicine group has the lowest community diversity.
[0175] Table 5 Median (interquartile range) of intestinal flora Alpha diversity analysis of each group of mice
[0176]
[0177] Note: compared with the blank group, * P<0.05, ** P<0.01; compared with the model group, ## P<0.01; compared with the western medicine group, △ P<0.01.
[0178] (Four) Beta diversity analysis
[0179] Beta diversity evaluation uses principal coordinate analysis based on Bray-Curtis distance. The closer the distance between sample points, the more similar the species composition structure between samples. Referring to Figure 9 , the blank group and the model group, the western medicine group sample points are completely separated, indicating that the intestinal flora structure composition of mice infected with HP and mice treated with western medicine after HP infection has changed significantly. The high-oxygen Wuji decoction group and the model group tend to separate, and are close to the blank group, indicating that the high-oxygen Wuji decoction intervention restores the intestinal flora structure composition of mice infected with HP.
[0180] (Five) Species composition analysis
[0181] Based on the species annotation results at different classification levels, the species relative abundance column chart was generated to intuitively show the species composition and proportion of each group at different classification levels. The results showed that at the phylum level, the intestinal flora of the four groups of mice was mainly composed of Firmicutes, Bacteroidota, Verrucomicrobiota, Desulfobacterota, Proteobacteria and Actinobacteriota. The dominant phylum of the blank group was Firmicutes and Bacteroidota, accounting for 50.67% and 42.18%, respectively, and the ratio of Firmicutes to Bacteroidota (F / B) was 1.2. In the model group, the proportions of Firmicutes and Bacteroidota were 59.5% and 19.64%, respectively, and the F / B ratio increased to 3.03. In the high-oxygen Wuji deco group, the proportions of Firmicutes and Bacteroidota were 35.58% and 34.07%, respectively, and the F / B ratio decreased to 1.04, which was close to that of the blank group. In the western medicine group, the proportions of Firmicutes and Bacteroidota were 9.73% and 29.47%, respectively, and the F / B ratio decreased to 0.33. Compared with the model group, the abundance of Firmicutes in the western medicine group was significantly reduced (P<0.01), the abundance of Proteobacteria was increased (P<0.05), and the abundance of Actinobacteriota was significantly reduced (P<0.01). Figure 10 and Table 6.
[0182] Table 6 Comparison of median (interquartile range) of intestinal flora at phylum level of mice in each group
[0183]
[0184] Note: Compared with the model group, * P<0.05, ** P<0.01.
[0185] At the genus level, the dominant genera with higher relative abundance in the four groups of mice were Akkermansia, Muribaculaceae_unclassified, Ligilactobacillus, Bacteroides, and LachnospiraceaeNK4A136 group. The dominant genera in the blank group were Muribaculaceae_unclassified, Ligilactobacillus, and LachnospiraceaeNK4A136 group. Compared with the blank group, Akkermansia, Ligilactobacillus, Bacteroides, and LachnospiraceaeNK4A136 group in the model group showed an increasing trend, and Muribaculaceae_unclassified showed a decreasing trend (P>0.05); compared with the model group, Akkermansia, Muribaculaceae_unclassified, and Bacteroides in the high-oxygen Wuji decoction group showed an increasing trend, and Ligilactobacillus and LachnospiraceaeNK4A136 group showed a decreasing trend (P>0.05); Akkermansia and Bacteroides in the western medicine group showed an increasing trend, and Muribaculaceae_unclassified showed a decreasing trend (P>0.05), and the abundance of Ligilactobacillus and LachnospiraceaeNK4A136 group was significantly reduced (P<0.01). Figure 11 and Table 7.
[0186] Table 7 Comparison of median (interquartile range) of intestinal flora at genus level in each group of mice
[0187]
[0188] Note: compared with the model group, ** P<0.01.
[0189] In experimental example 5, the dilution curve of the intestinal flora of each group of mice tended to be flat, indicating that the sequencing depth had basically covered all species in the sample, and the amount of sequencing data was reasonable. The total number of ASVs in the blank group, model group, high-oxygen Wuji decoction group and western medicine group was 3056, 1633, 2235 and 405 respectively, indicating that high-oxygen Wuji decoction promoted the growth of bacterial species in the intestine. The alpha diversity results showed that after the mice were infected with HP, the Chao1, Observed_species, Shannon and Simpson indices of the intestinal flora decreased, indicating that the species richness and diversity of the intestinal flora were destroyed; the Chao1, Observed_species, Shannon and Simpson indices of the western medicine group further decreased, indicating that western medicine intervention would further destroy the species richness and diversity and destroy the balance of the intestinal flora. The Chao1 and Observed_species indices of the high-oxygen Wuji decoction group increased, and the Shannon and Simpson indices slightly decreased, indicating that high-oxygen Wuji decoction had certain advantages in regulating the species richness of the intestinal flora. The beta diversity results showed that the sample points of the blank group and the model group, western medicine group were completely separated, indicating that the structure and composition of the intestinal flora of the mice infected with HP and the mice treated with western medicine intervention changed significantly; the high-oxygen Wuji decoction group and the model group tended to separate, and were close to the blank group, indicating that high-oxygen Wuji decoction intervention restored the structure and composition of the intestinal flora of the mice infected with HP.
[0190] At the phylum level, Firmicutes and Bacteroidetes were the dominant phyla in the blank group. The ratio of Firmicutes to Bacteroidetes is an important indicator for evaluating the intestinal microecological condition. The increase or decrease of the ratio indicates intestinal flora imbalance. The imbalance of flora may increase the risk of other intestinal diseases. The increase of Proteobacteria is also an important marker of intestinal microbial imbalance. Actinobacteria is a beneficial bacterium that plays an important role in human health. In this study, the F / B of the model group increased significantly, the F / B of the western medicine group decreased significantly, and the Proteobacteria increased and the Actinobacteria decreased significantly. The F / B of the high-oxygen Wujie decoction group was close to that of the blank group, which indicated that HP infection could cause intestinal flora imbalance at the phylum level, western medicine intervention could further lead to flora disorder, leading to a decrease in beneficial bacteria and an increase in harmful bacteria, while the high-oxygen Wujie decoction restored the species composition at the phylum level, making the disturbed flora tend to be normal. At the genus level, Akkermansia, Muribaculaceae_unclassified, Ligilactobacillus, Bacteroides, and Lachnospiraceae NK4A136 were the dominant genera. Akkermansia has the function of degrading mucin and mucus layer, and under normal circumstances, it can protect the integrity of intestinal epithelial cells and mucus layer and maintain the function of intestinal barrier. On the contrary, excessive Akkermansia will over-degrade mucin, making some other species lose their survival advantage, leading to a decrease in species diversity. At the same time, due to the excessive degradation of mucin, the mucus layer is damaged, which can cause intestinal barrier damage and induce intestinal inflammation, autoimmune diseases, etc. Appropriate abundance of Bacteroides is beneficial in the intestine, but if it escapes to other parts of the body, it can become a pathogenic bacterium and cause serious infection. Muribaculaceae_unclassified, Ligilactobacillus, and Lachnospiraceae NK4A136 are probiotics in the intestine and play an important role in maintaining intestinal health. In this study, the excessive increase of Akkermansia and the decrease of species diversity in the western medicine group may be related. At the same time, Bacteroides increased significantly, which may lead to infection in other parts of the body when the intestinal barrier is damaged. The decrease of Muribaculaceae_unclassified, Ligilactobacillus, and Lachnospiraceae NK4A136 indicates that western medicine intervention can seriously affect the composition of flora and kill some intestinal probiotics. Compared with the western medicine group, the increase or decrease of the above genera in the model group and the high-oxygen Wujie decoction group was not obvious, indicating that HP infection and high-oxygen Wujie decoction intervention had less effect on the composition of intestinal flora at the genus level than western medicine.
[0191] In summary, the mice in each group had a large difference in the species and quantity of flora, and the difference between the Gaoyuxiejia Decoction group and the blank group was smaller than that between the model group and the Western medicine group, indicating that HP infection can affect the composition of intestinal flora and cause dysbiosis; Western medicine treatment can further affect the composition of intestinal flora, leading to a decrease in beneficial bacteria, an increase in harmful bacteria, and a decrease in flora diversity; Gaoyuxiejia Decoction can improve the composition of intestinal flora in HP-infected mice to some extent, restore the ratio of Firmicutes to Bacteroidetes, improve the species richness of intestinal flora, and restore the structure of intestinal flora to normal.
[0192] Experimental Example 8
[0193] ELISA method for detecting the content of SIgA in the colon tissue of mice
[0194] (1) After equilibration at room temperature for 10 min, remove the required batten, set the standard hole, sample hole, and blank hole.
[0195] (2) Add sample: Add 50 μl of standard, 50 μl of sample, and 50 μL of universal diluent to the above holes, respectively, and then add 50 μL of HRP-antigen working solution to each hole. Incubate at 37°C for 1 h after covering the plate with a sealing film.
[0196] (3) Wash the plate: Add wash solution to each hole, stand for 1 min, then shake off and pat dry on a water-absorbing paper, repeat 5 times.
[0197] (4) Add substrate: Add 90 μL of substrate (TMB) to each hole, cover the plate with a sealing film, and incubate at 37°C in the dark for 15 min.
[0198] (5) Add stop solution: Add 50 μL of stop solution to each hole, and measure the OD value of each hole at 450 nm within 15 min.
[0199] Results:
[0200] Compared with the blank group, the SIgA content in the intestinal tract of the model group mice showed a decreasing trend (P>0.05); compared with the model group, the SIgA content in the Gaoyuxiejia Decoction group showed an increasing trend (P>0.05), and the SIgA content in the Western medicine group showed a decreasing trend (P>0.05); compared with the Western medicine group, the SIgA expression level in the Gaoyuxiejia Decoction group was higher (P>0.05). See Table 8.
[0201] Table 8 Comparison of SIgA expression in the colon tissue of mice in each group
[0202]
[0203] SIgA is the most secreted immunoglobulin in the colon tissue cells, and participates in the formation of the immune barrier. The biological barrier in the immune barrier refers to the intestinal microecology, and the intestinal flora is crucial for maintaining the intestinal homeostasis, is closely related to promoting the expression of tight junction proteins and the secretion of SIgA, and is a key factor for forming and protecting the intestinal barrier and maintaining the health of the body. In the experiment, the increase of the SIgA content indicates that the intervention of the high-oxygen Wuji decoction promotes the expression of SIgA, and can reduce the damage of the immune barrier.
[0204] It should be noted that the present application is not limited to the specific configurations and processes described above and illustrated in the drawings. For the sake of brevity, detailed descriptions of well-known methods are omitted here. In the above embodiments, several specific steps are described and illustrated as examples. However, the method process of the present application is not limited to the specific steps described and illustrated, and those skilled in the art can make various changes, modifications and additions, or change the order between steps, after understanding the spirit of the present application.
[0205] In the present application, the features described and / or exemplified for one embodiment can be used in the same way or in a similar way in one or more other embodiments, and / or in combination with or instead of the features of other embodiments.
[0206] The above is only the preferred embodiment of the present application, and is not used to limit the present application. For those skilled in the art, the embodiments of the present application can have various changes and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application.
Claims
1. Application of high-oxygen water combined with Wuji decoction in the treatment of Helicobacter pylori infection in gastrointestinal diseases.
2. The use of the high-oxygen water combined with Wuji decoction in the treatment of gastrointestinal diseases caused by Helicobacter pylori infection according to claim 1, characterized in that, The application of high-oxygen water combined with Wuji decoction in the preparation of products for inhibiting or killing Helicobacter pylori.
3. The use of the high-oxygen water combined with Wuji decoction in the treatment of gastrointestinal diseases caused by Helicobacter pylori infection according to claim 1, characterized in that, The high-oxygen water combined with Wuji decoction can inhibit the S100A8 / S100A9-TLR4-p38 signaling pathway, down-regulate the expression of S100A8, S100A9, TLR4, and p38, inhibit the production of inflammatory factors IL-8 and TNF-α, and reduce the inflammatory response of gastric mucosa.
4. The use of the high-oxygen water combined with Wuji decoction in the treatment of gastrointestinal diseases caused by Helicobacter pylori infection according to claim 1, characterized in that, The high-oxygen water combined with Wuji decoction can regulate the HSP70 / NF-κB signaling pathway, up-regulate the expression of HSP70, reduce the expression of NF-κB, and reduce the inflammatory response of gastric mucosa.
5. The use of the high-oxygen water combined with Wuji decoction according to claim 1 in the treatment of gastrointestinal diseases caused by Helicobacter pylori infection, characterized in that, The high-oxygen water combined with Wuji decoction can improve the expression level of SIgA, protect the intestinal barrier, restore the ratio of Firmicutes to Bacteroidetes, improve the richness of intestinal flora species, and adjust the structure of intestinal flora.
6. A method of preparing the high oxygen water combined with the pentadecane product of claim 1, characterized by, The method comprises the following steps: S1. Preparation of Wuji freeze-dried powder: the following components and weight parts are weighed: Rhizoma Coptidis 1 part, Fructus Evodiae 1 part, and Radix Paeoniae Alba 1 part, to prepare Wuji decoction, and then the Wuji decoction is prepared into Wuji freeze-dried powder containing 0.9 g / ml of active ingredients; S2. Preparation of high-oxygen water with a dissolved oxygen content of ≥18 ml / L; S3. Mixing the Wuji freeze-dried powder and the high-oxygen water in a ratio of 1:2 to prepare high-oxygen water combined with Wuji decoction.
7. The method of claim 6, wherein the high oxygen water combined with the pentahydroquinone product is prepared by, The Wuji freeze-dried powder is prepared by weighing the following components and weight parts: Rhizoma Coptidis 6 parts, Fructus Evodiae 1 part, and Radix Paeoniae Alba 6 parts.