Method for improving prokaryotic expression quantity of CRISPR-dCas9 protein

Abstract

The invention relates to a method for improving the prokaryotic expression quantity of CRISPR-dCas9 (clustered regularly interspaced short palindromic repeats) protein. Specifically, the invention relates to a method for improving the expression level of dCas9 protein in a prokaryotic cell, and a leucine zipper gene sequence and a dCas9 gene sequence are connected and introduced into the prokaryotic cell. According to the method, the high-purity and high-concentration dCas9 protein can be obtained, the expression quantity of the dCas9 protein is remarkably higher than that of a common method using maltose binding protein (MBP) as a fusion molecular chaperone, the obtained dCas9-lzip fusion protein still has the capability of being normally combined with DNA in a targeted manner under the guidance of sgRNA, and the function of dCas9 is not influenced by connection of a lzip sequence.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of protein expression and purification, and particularly relates to a method for improving the expression level of dCas9 protein in prokaryotic cells. BACKGROUND

[0002] The CRISPR / Cas9 system (Clustered Regularly Inter-Spaced Palindromic Repeats) is widely used in gene editing experiments, transcription regulation, guided nuclease, epigenetic modification, targeted sequencing and other fields. The realization of the functions of the system mainly relies on Cas9 protein and sgRAN complementary to the target DNA. Cas9 protein can bind and cut the target DNA under the guidance of sgRNA.

[0003] Cas9 protein includes two nuclease domains: HNH nuclease domain is responsible for cutting the DNA strand complementary to the sgRNA sequence; RuvC nuclease domain is responsible for cutting the other DNA strand. Mutating the histidine at position 840 in the HNH domain to alanine can convert Cas9 into a nickase, i.e. only cutting one strand of double-stranded DNA to form a nick. The mutant Cas9 loses the ability to break double-stranded DNA, but still retains the ability to bind DNA under the guidance of sgRNA. This mutant Cas9 is called dead Cas9 (dCas9). dCas9 has been widely used in gene transcription regulation, epigenome editing, DNA target enrichment, and has shown broad application prospects in whole genome screening, cell reprogramming, targeted therapy, etc.

[0004] GCN4 is a transcription factor composed of more than 300 amino acids in Saccharomyces cerevisiae, responsible for regulating the biosynthesis of amino acids, and is a very typical DNA-binding protein containing a leucine zipper (lzip) domain. It can spontaneously form dimers or trimers, and the lzip domain is a helical structure composed of 7 residue repeat sequences (a-b-c-d-e-f-g)n, with hydrophobic residues at positions a and d on the same side. This structure can bind two proteins together through hydrophobic force. By changing the amino acid types at positions a and d, the protein can be controlled to form polymers of different polymerization degrees.

[0005] The dCas9 protein obtained by the traditional CRISPR / dCas9 protein expression technology has low expression amount, low purity and low concentration. The dCas9 protein on the market is expensive. Further increasing the yield of dCas9 protein and reducing the production cost of dCas9 are conducive to the wide application of the dCas9 system. SUMMARY

[0006] The technical problems solved by the present application are:

[0007] The present application provides a method for improving the expression level of CRISPR-dCas9 protein in prokaryotic cells. The method aims to solve the problems of low expression level, low purity and low concentration of dCas9 protein obtained by traditional CRISPR / dCas9 protein expression technology. Through long-term experimental research, the present inventors found that connecting a leucine zipper lzip sequence to a dCas9 gene can improve the expression of dCas9 protein in prokaryotic cells. Specifically, the method comprises the following steps: constructing a dCas9-lzip fusion protein expression vector, expressing dCas9 protein, purifying dCas9 protein, and verifying the in vitro DNA targeting binding activity.

[0008] The specific implementation technical solutions of the present application are as follows:

[0009] 1. A method for improving the expression level of dCas9 protein in prokaryotic cells, wherein a leucine zipper gene sequence is connected to a dCas9 gene sequence and introduced into prokaryotic cells.

[0010] 2. The method according to item 1, wherein the prokaryotic cells include Escherichia coli, Bacillus subtilis, Staphylococcus, and nitrifying bacteria.

[0011] 3. The method according to item 1, wherein the leucine zipper gene sequence is derived from the tail end leucine zipper coding sequence of GCN4 protein.

[0012] 4. The method according to item 3, wherein the leucine zipper gene sequence is the coding sequence SEQ ID NO: 3 of Dimer lzip protein or the coding sequence SEQ ID NO: 4 of Trimer lzip protein.

[0013] 5. The method according to item 1, which comprises the following steps: introducing a dCas9 gene and a leucine zipper gene sequence into an expression vector to obtain a recombinant plasmid containing a dCas9 gene and a leucine zipper gene sequence; and transforming the recombinant plasmid into prokaryotic cells to express dCas9 protein.

[0014] 6. The method according to item 5, wherein the expression vector is a PET28a plasmid.

[0015] 7. The method according to item 5, which further comprises the steps of extracting and purifying dCas9 protein.

[0016] 8. Use of a vector containing a dCas9 gene and a leucine zipper gene sequence in the preparation of dCas9 protein.

[0017] 9. The use according to item 8, wherein the leucine zipper gene sequence is derived from the tail leucine zipper coding sequence of the GCN4 protein.

[0018] 10. The use according to item 9, wherein the leucine zipper gene sequence is the coding sequence SEQ ID NO: 3 of the Dimerlzip protein or the coding sequence SEQ ID NO: 4 of the Trimerlzip protein.

[0019] Specifically, the present application provides a method for improving the prokaryotic expression amount of CRISPR-dCas9 protein, comprising the following steps:

[0020] Step 1: Construction of dCas9 expression vector: recombine dCas9 and lzip genes into PET28a(+) vector plasmid containing 6xHis tag to obtain PET28a(+)-6xHis-dCas9-lzip-6xHis recombinant plasmid (wherein the leucine zipper sequence can be connected at the N-terminus or C-terminus of the dCas9 gene, both of which can achieve the effect of the present application (i.e., improving the expression amount of dCas9 protein). If considering the subsequent application of gene editing technology in mammalian cells or animal models such as mice, a nuclear localization sequence is usually needed to be introduced at the C-terminus, and in order to avoid affecting the nuclear localization, it is more appropriate to add the leucine zipper sequence at the N-terminus of dCas9);

[0021] Step 2: Expression of fusion protein: transform the vector PET28a(+)-6xHis-dCas9-lzip-6xHis constructed in the first step into E. coli, and after solid medium culture, obtain a recombinant monoclonal strain. Activate the above strain in liquid medium, and induce expression by isopropyl-β-D-thiogalactoside (IPTG) to obtain bacteria containing expressed dCas9-lzip fusion protein.

[0022] Step 3: Extraction and purification of dCas9-lzip protein: break the bacteria obtained in step 2, centrifuge to separate bacterial fragments and supernatant, collect the supernatant containing dCas9-lzip protein, and transfer the supernatant to a column containing Ni 2+ Gel beads, centrifuge to separate Ni 2+ Gel beads and supernatant, collect Ni 2+ Gel beads to the chromatography column, use eluent containing high concentration of imidazole to elute dCas9-lzip protein. After dialysis, ultrafiltration and concentration, obtain dCas9-lzip protein.

[0023] Step 4: In vitro DNA targeting binding activity verification: the dCas9-lzip protein obtained in step 3 is assembled with sgRNA, and incubated with target DNA to determine the ability of the dCas9-lzip protein to target and bind DNA.

[0024] Further, the lzip sequence in the first step specifically includes the following two sequences, Dimer sequence (SEQ ID NO: 3, atgaagcagctggaagacaaagtcgaagaactgctctccaagaa ctaccacttggagaatgaagtcgcccgcctgaagaagctggtcggagaacgc) and Trimer sequence (SEQ ID NO: 4, atgaagcagattgaagacaaaattgaagaaattctgtccaagatttaccacatcgagaatgaaatcgcccgcattaagaagctgatcggagaacgc). Wherein, the Dimer sequence is used to form a dimer of the protein connected thereto, and the Trimer sequence is used to form a trimer of the protein connected thereto.

[0025] Further, the partial sequence of the PET28a(+)-6xHis-dCas9-lzip-6xHis recombinant plasmid in the first step is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0026] Further, the transformation method in the second step is to add the recombinant plasmid in the first step to 100 μl of DH5α competent bacteria, and then place it on ice for 30 min. Then heat shock at 42°C water bath for 60 s, then quickly insert it back into ice, and stand for 10 min to obtain a first mixture. Add 600 μl of LB liquid medium to the first mixture, and incubate at 37°C, 220 rpm for 45 min. Spread on solid medium containing kanamycin and incubate overnight to obtain a recombinant monoclonal strain.

[0027] Further, the culture and induction expression method in the second step is that the recombinant monoclonal strain in the second step is picked on LB liquid medium containing kanamycin, and incubated at 37°C, 220 rpm for 16 h for activation. Take the activated bacterial solution and inoculate it into LB liquid medium containing kanamycin at a ratio of 1:10, and incubate at 37°C, 220 rpm for 2.5 h to OD600=0.6-0.8. Add IPTG with a final concentration of 50 μM for induction, and incubate at 30°C, 220 rpm for 6 h to obtain bacterial bodies expressing dCas9-lzip fusion protein.

[0028] Further, the method for breaking the bacteria in the third step is to centrifuge the bacteria at 4℃ and 10000 rpm for 10 min. Then, the bacteria are broken in a low-temperature ultrahigh-pressure cell breaker for three times at 1200 bar, or the bacteria are broken by ultrasonic method, specifically, the bacteria are broken for 3 s and then stopped for 10 s, the power is 70%, and the bacteria are broken on ice for 20 min.

[0029] Further, the Ni 2+ The method for extracting and purifying the dCas9-lzip protein by gel beads is to resuspend the Ni 2+ Gel beads are added into the supernatant containing the dCas9-lzip protein obtained in the third step, and the mixture is cultured in a rotating mixer for 2 h. The Ni 2+ Gel beads are added into the supernatant containing the dCas9-lzip protein obtained in the third step, and the mixture is cultured in a rotating mixer for 2 h. The Ni 2+ Gel beads are added into the supernatant containing the dCas9-lzip protein obtained in the third step, and the mixture is cultured in a rotating mixer for 2 h. The Ni

[0030] Further, the method for dialysis in the third step is to transfer the dCas9-lzip protein solution eluted by the Elution buffer in the third step into a dialysis box, immerse the dialysis box in a beaker containing Dialysis buffer, and magnetically stir the mixture at 4℃ for 6 h. The dialysis is repeated for 1-2 times.

[0031] Further, the method for ultrafiltration and concentration in the third step is to transfer the dCas9-lzip protein after dialysis obtained in the third step into an ultrafiltration and concentration tube, and centrifuge the mixture at 3500 g for 5-10 min.

[0032] Further, the method for verifying the in-vitro DNA targeting and binding activity of the dCas9-lzip in the fourth step is to incubate the dCas9-lzip protein and sgRNA in NEBuffer2 solution at 37℃ for 15 min to obtain sgRNA-dCas9 complex. Then, the sgRNA-dCas9 complex solution is taken, and target DNA with fluorescent label is added, the target DNA is complementary to the sgRNA sequence, and the mixture is incubated at 37℃ for 30 min. Then, 10 μl of the reaction solution is subjected to TAE-PAGE electrophoresis. The mixture is observed in a full-automatic chemiluminescence image analysis system.

[0033] Further, the buffer used in the third step has the following specific formula:

[0034] Lysis buffer (pH 8.2): 20 mM Tris-HCL, 300 mM NaCl, 20 mM Imidazole, 0.1% Tween20 (w / v)

[0035] Wash buffer (pH 8.2): 20 mM Tris-HCL, 300 mM NaCl, 50 mM Imidazole, 0.1% Tween20 (w / v)

[0036] Elution buffer (pH 8.2): 20 mM Tris-HCL, 300 mM NaCl, 100 mM Imidazole, 0.1% Tween20 (w / v)

[0037] Dialysis buffer (pH 8.8): 20 mM Tris-HCL, 300 mM NaCl, 0.5 mM EDTA, 1 mM TCEP, 0.1% Tween20 (w / v)

[0038] Further, the sgRNA used in the fourth step is obtained by in vitro transcription, and the amount of each component in the reaction system is sgRNA:dCas9-lzip:DNA = 16:1:1. The buffer used is a commercially available Cas9 kit buffer.

[0039] In specific embodiments of the present application, the gene sequence of the leucine zipper is linked to the gene sequence of dCas9 and introduced into a prokaryotic cell, which can increase the expression amount of dCas9 in the prokaryotic cell. Specifically, the leucine zipper structure promotes the formation of a multimeric structure, thereby increasing the stability of the dCas9 protein, or promotes the formation of inclusion bodies, and the modified protein correctly folded in the inclusion bodies still has protein activity and is more stable and less likely to be degraded due to protection by the inclusion bodies, or the multimeric structure formed makes the local concentration of histidine higher, which is more easily combined with ni2+ gel beads, thereby increasing the expression amount of the dCas9 protein.

[0040] In specific embodiments of the present application, the prokaryotic cell can be any prokaryotic cell suitable for protein expression, as long as it can introduce a plasmid and successfully express a protein, for example, it can be Escherichia coli (such as BL21, BL21(DE3), BL21 Star(DE3), BL21-AI), Bacillus subtilis, Staphylococcus, nitrifying bacteria, etc.; in the examples of the present application, only Escherichia coli is exemplarily selected, but those skilled in the art can understand that the method of the present application is suitable for any prokaryotic organism used for protein expression in the prior art.

[0041] The term

[0042] In this context, the lzip sequence (also known as leucine zipper sequence) refers to a structural motif or motif present in DNA binding proteins and other proteins. It has the characteristic of a two-helical alpha-helix with a side concentrated with many hydrophobic amino acids, which contains multiple leucines arranged on the hydrophobic surface of the helix and forms a straight line. When the hydrophobic surfaces of two amphipathic alpha-helices from the same or different polypeptide chains interact, a coiled-coil dimer structure, i.e. "leucine zipper", is formed. Leucine zipper is essential for dimerization of two DNA binding regions, which contain many basic amino acids such as arginine and lysine. The structural feature of leucine zipper is composed of 7-residue repeat sequence (a-b-c-d-e-f-g)n, with hydrophobic residues at the same side of a and d positions. By changing the amino acid types at a and d positions, the formation of polymers of different aggregation degrees between leucine zippers can be controlled.

[0043] In this context, the leucine zipper can be derived from any protein with leucine zipper in the prior art, such as ATF5 protein and GCN4 protein. The leucine zipper can be a wild-type leucine zipper from the protein with leucine zipper, or it can be optimized or mutated, for example, by changing the types of hydrophobic amino acids at a and d positions to obtain leucine zipper sequences capable of forming polymers of different aggregation degrees, as described in the prior art documents.

[0044] Yeast transcriptional activator GCN4 regulates the biosynthesis of amino acids in yeast cells, and is a very typical DNA binding protein containing basic region-leucine zipper (bZIP) domain. It can spontaneously form dimers or trimers, and its bZIP domain is located at the C-terminal about 60 amino acid residues. The two structural units of GCN4, zipper region and basic region, have clear division of labor, mutual dependence and independence, and play their respective functions.

[0045] Advantages

[0046] The application fuses and expresses dCas9 protein by using lzip sequence, improves the absolute expression amount and relative expression amount of dCas9 protein in E. coli, and obtains high-purity and high-concentration dCas9 protein by the method of Ni2+ gel bead purification, fraction elution and ultrafiltration concentration. The expression amount of the lzip fusion dCas9 protein of the method is significantly higher than that of the method of using maltose binding protein (MBP) as a fusion molecular chaperone to improve the expression amount of dCas9 protein. And the in vitro DNA targeting binding activity verification experiment proves that the obtained dCas9-lzip fusion protein still has the ability of normal targeting binding DNA under the guidance of sgRNA, and the connection of lzip sequence has no effect on the function of dCas9. The application is suitable for industrial production and laboratory dCas9 protein production. BRIEF DESCRIPTION OF DRAWINGS

[0047] Figure 1 It is a schematic diagram of PET28a(+)-6xHis-dCas9-lzip-6xHis recombinant plasmid structure;

[0048] Figure 2 It is TAE-PAGE electrophoresis analysis of dCas9 protein and dCas9-lzip protein expression amount. Wherein, equal volume of dCas9 protein solution before dialysis and dCas9-lzip protein solution (dCas9-Dimer and dCas9-Trimer) are taken for SDS-PAGE electrophoresis with gel concentration of 9%, and the band area of dCas9-lzip protein is significantly higher than that of dCas9 protein, and the expression amount of dCas9 protein after lzip modification is obviously improved.

[0049] Figure 3 It is 1 μg total protein quantitative TAE-PAGE electrophoresis gel, and BSA standard sample is used for quantification. Wherein, 1 μg total amount of dCas9 protein solution, dCas9-Dimer and dCas9-Trimer protein solution and BSA standard sample are taken for SDS-PAGE electrophoresis, and compared with BSA, it can be obtained that dCas9 protein is about 0.01-0.02 ug, accounting for 1%-2% of the total protein amount after Ni2+ gel bead purification; dCas9-lzip protein is about 0.6 ug, accounting for 60% of the total protein amount after Ni2+ magnetic bead screening. The results show that lzip modification can significantly improve the relative expression amount of dCas9 protein in E. coli, and significantly improve the expression amount of other impurities, and improve the purity of the protein.

[0050] Figure 4The TAE-PAGE electrophoresis gel map of dCas9-lzip and dCas9 protein is shown (left), and the corresponding dCas9-lzip protein immunoblotting map (right), the antibody used for protein immunoblotting is anti-His tag antibody. Among them, the concentrated dCas9 protein solution, dCas9-lzip protein solution, BL21 (untransformed) protein solution, BL21 (without IPTG induction) protein solution of the BL21 transformed with pET28a-dCas9 plasmid are subjected to TAE-PAGE gel electrophoresis, the dCas9 protein band is faintly visible, and the dCas9-lzip band is clear and large in area. The untransformed plasmid BL21 E. coli and the uninduced BL21 E. coli transformed with plasmid have no dCas9 protein band, and cannot express dCas9 protein. The protein immunoblotting experiment result further proves that the Cas9-lzip fusion protein is successfully expressed and purified.

[0051] Figure 5 The SDS-PAGE electrophoresis map of equal volume of dialyzed dCas9 protein solution, MBP-dCas9 fusion protein solution, and dCas9-Dimer obtained by the same expression and purification method. The fusion expression of dCas9 protein and maltose binding protein (MBP) is a common method to improve protein expression. The dCas9-lzip protein band area is significantly higher than that of dCas9 protein and MBP-dCas9 fusion protein, and the expression amount of dCas9 protein modified by lzip is obviously improved.

[0052] Figure 6 The gray scale analysis bar chart of Figure 5 The gray scale analysis of Figure 5 is made using imagej, with integrated gray scale (Integrated dendity) as the vertical coordinate and protein type as the horizontal coordinate. The expression amount of dCas9-Dimer fusion protein is about 1.43 times that of MBP-dCas9 fusion protein and 2.88 times that of dCas9 protein.

[0053] Figure 7 The TBE-PAGE electrophoresis gel map of dCas9-Dimer in vitro DNA targeting binding activity verification is shown. Among them, Figure 7 The first lane has two obvious bands, one is the TDNA and dCas9-Dimer protein binding band, and the other is the TDNA band. The second and third lanes are negative controls without adding dCas9-Dimer protein or sgRNA. The results show that dCas9-Dimer protein still has the ability to target and bind DNA under the guidance of sgRNA, and Dimer modification has no effect on the function of dCas9 specific binding to target DNA.

[0054] Figure 8The TBE-PAGE gel map is used to verify the in vitro DNA targeting binding activity of dCas9-lzip. Among them, Figure 8 The first, second, third and fourth lanes are added with dCas9-Dimer protein or dCas9-Trimer protein, and the fifth lane is a negative control group without adding protein. The results show that the dCas9-Trimer protein still has the ability to target and bind DNA under the guidance of sgRNA, and the Trimer modification has no effect on the function of dCas9. In summary, the lzip modification has no effect on the function of dCas9 specific binding to target DNA. DETAILED DESCRIPTION

[0055] In order to make the purpose, technical scheme and advantages of the present application more clear, the following will be further described in detail in combination with specific embodiments and with reference to the drawings.

[0056] The methods used in the following examples are conventional methods unless otherwise specified, and the reagents used are commercially available reagents unless otherwise specified.

[0057] The E. coli BL21, E. coli DH5a, main reagents and part of the materials without special instructions used in the experiment are conventional commercially available products, for example, the endonuclease used is purchased from New England Biolabs (NEB); Ni2+ gel beads (Ni Sepharose 6 Fast Flow) are purchased from Cytiva; dialysis box (SLIDE-A-LYZER TM G3 dialysis box, 20k) is purchased from Thermo Fisher Scientific. The experimental operation without special instruction is usually carried out according to the manufacturer's instruction or the conventional experimental condition. The primers are synthesized by Shenguo Bioengineering (Shanghai) Co., Ltd., and the DNA sequencing is completed by Guangzhou Aik Biotechnology Co., Ltd.

[0058] Example 1 Construction of PET28a(+)-6xHis-dCas9-lzip-6xHis recombinant plasmid

[0059] The PET28a(+) vector plasmid (purchased from Moli Bio) with lzip sequence (Dimer sequence and Trimer sequence) is cut by ECORI and NdeI endonuclease, 37℃ water bath for 3h, to obtain linearized vector fragment.

[0060] Table 1 Enzyme cutting system of vector plasmid

[0061]

[0062] Two pairs of primers: pET28a-Ndel-dCas9Homo-F and pET28a-ECOR1- dCas9Homo-R were designed to amplify the linear fragment of dCas9 gene with pET28a-dCas9 as template (which was obtained by introducing dCas9 gene into pET28a vector). The linear fragment of dCas9 gene with homologous arms was obtained.

[0063] Table 2 primer sequences

[0064]

[0065] Table 3 PCR reaction system

[0066] Components 2*buffer Q5 enzyme Forward primer Reverse primer Template plasmid Double distilled water Total volume Volume / μl 25 1 2 2 2 18 50

[0067] Table 4 PCR reaction program

[0068]

[0069] The linearized vector fragment and the linear fragment of dCas9 gene after enzyme digestion were purified according to the instructions of the purification kit. The purified PET28a(+) linear fragment with lzip sequence and the linear fragment of dCas9 gene were recombined at 37℃ for 30 min according to the instructions of recombination enzyme Exnase II.

[0070] The above recombination product was added to DH5a competent bacteria, and placed in ice for 30 min, then placed in a 42℃ water bath for 60 s, then quickly inserted back into ice, and placed for 10 min. 600 μl of LB liquid medium was added to DH5a, and cultured at 37℃, 220 rpm for 45 min. 200 μl of bacterial liquid after culture was spread on kan+LB solid medium, and incubated at 37℃ overnight.

[0071] After the single colony on the plate was picked and identified correctly by sequencing, it was expanded and the plasmid was extracted. The PET28a(+)-6×His-dCas9-lzip-6×His recombinant plasmid was obtained.

[0072] Example 2 Expression and purification of dCas9-lzip protein

[0073] 1. Expression of dCas9-lzip protein

[0074] The correct PET28a(+)-6*His-dCas9-lzip-6*His recombinant plasmid identified by sequencing was transformed into E. coli BL21, and the transformation method was the same as in Example 1. A single colony was picked and inoculated in 10 ml kan+LB liquid medium, and cultured at 37°C, 200 rpm overnight. 10 ml of the overnight cultured bacteria were inoculated in 100 ml kan+LB liquid medium, and cultured at 37°C, 200 rpm until OD600=0.6-0.8. IPTG was added to a total concentration of 50 μM, and cultured at 25°C, 200 rpm for 6 h.

[0075] The bacteria after culture were collected by centrifugation at 10000 rpm for 10 min, and the bacteria expressing dCas9-lzip protein were obtained. 10 ml of Lysis buffer was added to resuspend the bacteria. In a low-temperature ultrahigh-pressure cell disruptor, the bacteria were disrupted three times at 1200 bar pressure. The disrupted and clarified bacterial solution was centrifuged at 13000 g, 4°C for 20 min in an ultrahigh-speed refrigerated centrifuge, and the supernatant was collected and the precipitate was discarded. The supernatant containing dCas9-lzip protein was obtained.

[0076] 2. dCas9-lzip protein purification

[0077] 200 μl of Ni 2+ The gel bead and water mixture was centrifuged at 500 g, and the Ni 2+ The gel bead precipitate was mixed with the supernatant, and the supernatant was discarded. 100 μl of lysis buffer was added to resuspend the Ni 2+ The gel bead was replaced with a background solution, and the background solution replacement operation was repeated twice. 200 μl of Ni 2+ The mixture of gel beads and lysis buffer was added to the collected supernatant containing dCas9-lzip protein, and was cultured in a rotary mixer for 2 h to allow the 6*His-tagged dCas9 protein to bind to the Ni 2+ The gel beads were fully contacted and stably bound. After the culture, the mixture was centrifuged and the supernatant was discarded. The Ni 2+ The gel beads were transferred to a chromatography column, and 2 ml of lysis buffer was added twice for washing. After all the filtrate was removed, 2 ml of Wash buffer was added for washing. Finally, 25 μl and 5 times 50 μl of Elution buffer were added to elute the dCas9 protein into 6 1.5 ml centrifuge tubes. The absorbance of the collected protein at 280 nm was measured using a spectrophotometer to characterize the protein concentration of each tube. The first eluate and the eluate with the lowest protein concentration were discarded, and the other eluates were mixed to obtain Ni 2+ dCas9-lzip protein purified by gel beads.

[0078] 3. Dialysis and concentration of dCas9-lzip protein

[0079] The dCas9-lzip protein solution obtained in the previous step was transferred to a dialysis box, and the dialysis box was immersed in a beaker containing 800 ml of Dialysis buffer. The dialysis was performed at 4°C with magnetic stirring for 3 h, and then the Dialysis buffer was replaced and the dialysis was performed at 4°C with magnetic stirring for 16 h.

[0080] The dialyzed protein was transferred to a concentration tube and centrifuged at 3500g for 5-10 min.

[0081] 4. Comparison of expression levels of dCas9 protein and dCas9-lzip protein

[0082] The pET28a-dCas9 plasmid and the PET28a(+)-6xHis-dCas9-lzip-6xHis recombinant plasmid were transformed into E. coli BL21 for induction expression, and the operation was the same as that in Example 1 and Example 2. Equal volumes of dCas9 protein solution and dCas9-lzip protein solution (dCas9-Dimer and dCas9-Trimer, respectively) before dialysis were subjected to SDS-PAGE electrophoresis with a gel concentration of 9%, and the electrophoresis conditions were 80v for 20 min and then 200v for 30 min. The results are shown in Figure 2 As shown in the figure, the dCas9-lzip protein band area was significantly higher than that of dCas9 protein, and the expression level of dCas9 protein modified by lzip was significantly improved.

[0083] The concentrated dCas9 protein solution and dCas9-lzip protein solution were taken, and the total protein concentration was determined by spectrophotometer. The total amount of 1 μg of dCas9 protein solution, dCas9-lzip protein solution and BSA standard sample were subjected to SDS-PAGE electrophoresis with a gel concentration of 9%, and the electrophoresis conditions were 80v for 20 min and then 200v for 30 min. The results are shown in Figure 3 As shown in the figure, compared with BSA, dCas9 protein was about 0.01-0.02ug, accounting for 1%-2% of the total protein amount after Ni2+gel bead purification; dCas9-lzip protein was about 0.6ug, accounting for 60% of the total protein amount after Ni2+magnetic bead screening. The results showed that lzip modification can significantly improve the relative expression level of dCas9 protein in E. coli, significantly improve the expression level of other impurities, and improve the purity of the protein.

[0084] The pET28a-dCas9 plasmid and the PET28a(+)-6xHis-dCas9-lzip-6xHis recombinant plasmid were transformed into E. coli BL21 for expression induction, and the BL21 E. coli without transformation of the plasmid was also subjected to expression induction, and the specific operation was the same as that in Example 1 and Example 2. The E. coli BL21 into which the pET28a-dCas9 plasmid was transformed was treated in the same manner, but no IPTG induction was added. The total protein concentration of the concentrated dCas9 protein solution, the dCas9-lzip protein solution, the BL21 (untransformed) protein solution, and the BL21 (without IPTG induction) protein solution into which the pET28a-dCas9 plasmid was transformed was determined by spectrophotometry. The marker was loaded in the center of the PAGE gel, and 1 μg and 0.1 μg of the total protein solution sample were loaded on both sides of the marker, and the SDS-PAGE electrophoresis was performed at a gel concentration of 9%, and the electrophoresis conditions were 80 v for 20 min and 200 v for 30 min. The electrophoresis gel was divided into two along the marker direction, one side with 1 μg of protein was subjected to staining treatment, and the other side with 0.1 μg of protein was subjected to Western blotting experiment, and the antibodies used were anti-His tag antibody (purchased from ABclonal, AE003) and corresponding HRP-conjugated Affinipure Goat Anti-Mouse IgG (H+L) antibody (purchased from Wuhan Sanyou Biotechnology Co., Ltd., SA00001-1), and the results are shown in Figure 4 As shown, the dCas9 protein band was faintly visible, and the dCas9-lzip band was clear and large in area. The BL21 E. coli without transformation of the plasmid and the BL21 E. coli into which the plasmid was transformed without induction had no dCas9 protein band, and the dCas9 protein could not be expressed. The Western blotting experiment result further proved that the dCas9-lzip fusion protein was successfully expressed and purified.

[0085] Further, the applicant also connected the gene sequence of the maltose binding protein MBP commonly used in the prior art to improve the expression amount of the protein with the dCas9 gene sequence according to the above method, and the protein expression and purification were carried out, and the results are shown in Figure 5 and Figure 6 It is shown that compared with the MBP modification, the expression amount of the dCas9 protein after the lzip modification is significantly improved, which has unexpected technical effects.

[0086] According to the system in Table 5, the sgRNA was assembled with the dCas9-lzip protein at 37°C for 15 min to obtain the sgRNA-dCas9 complex.

[0087] Table 5 Activity verification system

[0088] Components Volume (μL) Final concentration Double distilled water 13 10x NEBuffer2 2 1x 8μM sgRNA 1 400nM 1μM dCas9 2 100nM

[0089] Take sgRNA-dCas9 complex solution, add 2 μl of double-stranded DNA with fluorescent group (as target DNA, TDNA, which can be complementary to sgRNA and be captured by sgRNA-dCas9 complex) with a concentration of 1 μM, incubate at 37℃ for 30 min reaction. The TDNA has fluorescent groups CY3 and CY5 at both ends. After the reaction, take 10 ul of the product for TAE-PAGE electrophoresis with 5% gel for 30 min, voltage 120V. Observe the film by full-automatic chemiluminescence image analysis system (iBright FL1500), mode selection fluorescent blots, excitation light selection IRDye680 and alexa fluor 546, and the results are shown in Figure 7 and Figure 8 . Figure 7 The first lane has two obvious bands, one is the TDNA combined with dCas9-Dimer protein band, and the other is the TDNA band. The second and third lanes are negative controls without adding dCas9-Dimer protein or sgRNA. The results show that dCas9-Dimer protein still has the ability to target and bind DNA under the guidance of sgRNA, and the Dimer modification has no effect on the function of dCas9 specific binding to target DNA. Figure 8 The first, second, third and fourth lanes add dCas9-Dimer protein or dCas9-Trimer protein, and the fifth lane is a negative control group without adding protein. The results show that dCas9-Trimer protein still has the ability to target and bind DNA under the guidance of sgRNA, and the Trimer modification has no effect on the function of dCas9. In summary, the lzip modification has no effect on the function of dCas9 specific binding to target DNA.

[0090] The above specific embodiments further illustrate the purpose, technical solutions and beneficial effects of the present application. It should be understood that the above description is only a specific embodiment of the present application and is not intended to limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application.

[0091] SEQUENCE LISTING

[0092] SEQ ID NO:1:

[0093] TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTT

[0094] TAACTTTAAGAAGGAGATATACCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCC

[0095] TGGTGCCGCGCGGCAGCCATATGATGGACAAGAAGTACAGCATCGGCCTGGACATCGGTACC

[0096] AACAGCGTGGGCTGGGCCGTGATCACCGACGAGTACAAGGTGCCCAGCAAGAAGTTCAAGG

[0097] TGCTGGGCAACACCGACCGCCACAGCATCAAGAAGAACCTGATCGGCGCCCTGCTGTTCGAC

[0098] AGCGGCGAGACCGCCGAGGCCACCCGCCTGAAGCGCACCGCCCGCCGCCGCTACACCCGCC

[0099] GCAAGAACCGCATCTGCTACCTGCAGGAGATCTTCAGCAACGAGATGGCCAAGGTGGACGAC

[0100] AGCTTCTTCCACCGCCTGGAGGAGAGCTTCCTGGTGGAGGAGGACAAGAAGCACGAGCGCC

[0101] ACCCCATCTTCGGCAACATCGTGGACGAGGTGGCCTACCACGAGAAGTACCCCACCATCTAC

[0102] CACCTGCGCAAGAAGCTGGTGGACAGCACCGACAAGGCCGACCTGCGCCTGATCTACCTGG

[0103] CCCTGGCCCACATGATCAAGTTCCGCGGCCACTTCCTGATCGAGGGCGACCTGAACCCCGAC

[0104] AACAGCGACGTGGACAAGCTGTTCATCCAGCTGGTGCAGACCTACAACCAGCTGTTCGAGGA

[0105] GAACCCCATCAACGCCAGCGGCGTGGACGCCAAGGCCATCCTGAGCGCCCGCCTGAGCAAG

[0106] AGCCGCCGCCTGGAGAACCTGATCGCCCAGCTGCCCGGCGAGAAGAAGAACGGCCTGTTCG

[0107] GCAACCTGATCGCCCTGAGCCTGGGCCTGACCCCCAACTTCAAGAGCAACTTCGACCTGGCC

[0108] GAGGACGCCAAGCTGCAGCTGAGCAAGGACACCTACGACGACGACCTGGACAACCTGCTGG

[0109] CCCAGATCGGCGACCAGTACGCCGACCTGTTCCTGGCCGCCAAGAACCTGAGCGACGCCATC

[0110] CTGCTGAGCGACATCCTGCGCGTGAACACCGAGATCACCAAGGCCCCCCTGAGCGCCAGCAT

[0111] GATCAAGCGCTACGACGAGCACCACCAGGACCTGACCCTGCTGAAGGCCCTGGTGCGCCAG

[0112] CAGCTGCCCGAGAAGTACAAGGAGATCTTCTTCGACCAGAGCAAGAACGGCTACGCCGGCTA

[0113] CATCGACGGCGGCGCCAGCCAGGAGGAGTTCTACAAGTTCATCAAGCCCATCCTGGAGAAGA

[0114] TGGACGGCACCGAGGAGCTGCTGGTGAAGCTGAACCGCGAGGACCTGCTGCGCAAGCAGCG

[0115] CACCTTCGACAACGGCAGCATCCCCCACCAGATCCACCTGGGCGAGCTGCACGCCATCCTGC

[0116] GCCGCCAGGAGGACTTCTACCCCTTCCTGAAGGACAACCGCGAGAAGATCGAGAAGATCCTG

[0117] ACCTTCCGCATCCCCTACTACGTGGGCCCCCTGGCCCGCGGCAACAGCCGCTTCGCCTGGATG

[0118] ACCCGCAAGAGCGAGGAGACCATCACCCCCTGGAACTTCGAGGAGGTGGTGGACAAGGGCG

[0119] CCAGCGCCCAGAGCTTCATCGAGCGCATGACCAACTTCGACAAGAACCTGCCCAACGAGAA

[0120] GGTGCTGCCCAAGCACAGCCTGCTGTACGAGTACTTCACCGTGTACAACGAGCTGACCAAGG

[0121] TGAAGTACGTGACCGAGGGCATGCGCAAGCCCGCCTTCCTGAGCGGCGAGCAGAAGAAGGC

[0122] CATCGTGGACCTGCTGTTCAAGACCAACCGCAAGGTGACCGTGAAGCAGCTGAAGGAGGAC

[0123] TACTTCAAGAAGATCGAGTGCTTCGACAGCGTGGAGATCAGCGGCGTGGAGGACCGCTTCAA

[0124] CGCCAGCCTGGGCACCTACCACGACCTGCTGAAGATCATCAAGGACAAGGACTTCCTGGACA

[0125] ACGAGGAGAACGAGGACATCCTGGAGGACATCGTGCTGACCCTGACCCTGTTCGAGGACCG

[0126] CGAGATGATCGAGGAGCGCCTGAAGACCTACGCCCACCTGTTCGACGACAAGGTGATGAAGC

[0127] AGCTGAAGCGCCGCCGCTACACCGGCTGGGGCCGCCTGAGCCGCAAGCTTATCAACGGCATC

[0128] CGCGACAAGCAGAGCGGCAAGACCATCCTGGACTTCCTGAAGAGCGACGGCTTCGCCAACC

[0129] GCAACTTCATGCAGCTGATCCACGACGACAGCCTGACCTTCAAGGAGGACATCCAGAAGGCC

[0130] CAGGTGAGCGGCCAGGGCGACAGCCTGCACGAGCACATCGCCAACCTGGCCGGCAGCCCCG

[0131] CCATCAAGAAGGGCATCCTGCAGACCGTGAAGGTGGTGGACGAGCTGGTGAAGGTGATGGG

[0132] CCGCCACAAGCCCGAGAACATCGTGATCGAGATGGCCCGCGAGAACCAGACCACCCAGAAG

[0133] GGCCAGAAGAACAGCCGCGAGCGCATGAAGCGCATCGAGGAGGGCATCAAGGAGCTGGGCA

[0134] GCCAGATCCTGAAGGAGCACCCCGTGGAGAACACCCAGCTGCAGAACGAGAAGCTGTACCT

[0135] GTACTACCTGCAGAACGGCCGCGACATGTACGTGGACCAGGAGCTGGACATCAACCGCCTGA

[0136] GCGACTACGACGTGGACCACATCGTGCCCCAGAGCTTCCTGAAGGACGACAGCATCGACAAC

[0137] AAGGTGCTGACCCGCAGCGACAAGAACCGCGGCAAGAGCGACAACGTGCCCAGCGAGGAG

[0138] GTGGTGAAGAAGATGAAGAACTACTGGCGCCAGCTGCTGAACGCCAAGCTGATCACCCAGC

[0139] GCAAGTTCGACAACCTGACCAAGGCCGAGCGCGGCGGCCTGAGCGAGCTGGACAAGGCCGG

[0140] CTTCATCAAGCGCCAGCTGGTGGAGACCCGCCAGATCACCAAGCACGTGGCCCAGATCCTGG

[0141] ACAGCCGCATGAACACCAAGTACGACGAGAACGACAAGCTGATCCGCGAGGTGAAGGTGAT

[0142] CACCCTGAAGAGCAAGCTGGTGAGCGACTTCCGCAAGGACTTCCAGTTCTACAAGGTGCGC

[0143] GAGATCAACAACTACCACCACGCCCACGACGCCTACCTGAACGCCGTGGTGGGCACCGCCCT

[0144] GATCAAGAAGTACCCCAAGCTGGAGAGCGAGTTCGTGTACGGCGACTACAAGGTGTACGACG

[0145] TGCGCAAGATGATCGCCAAGAGCGAGCAGGAGATCGGCAAGGCCACCGCCAAGTACTTCTTC

[0146] TACAGCAACATCATGAACTTCTTCAAGACCGAGATCACCCTGGCCAACGGCGAGATCCGCAA

[0147] GCGCCCCCTGATCGAGACCAACGGCGAGACCGGCGAGATCGTGTGGGACAAGGGCCGCGAC

[0148] TTCGCCACCGTGCGCAAGGTGCTGAGCATGCCCCAGGTGAACATCGTGAAGAAGACCGAGG

[0149] TGCAGACCGGCGGCTTCAGCAAGGAGAGCATCCTGCCCAAGCGCAACAGCGACAAGCTGAT

[0150] CGCCCGCAAGAAGGACTGGGACCCCAAGAAGTACGGCGGCTTCGACAGCCCCACCGTGGCC

[0151] TACAGCGTGCTGGTGGTGGCCAAGGTGGAGAAGGGCAAGAGCAAGAAGCTGAAGAGCGTG

[0152] AAGGAGCTGCTGGGCATCACCATCATGGAGCGCAGCAGCTTCGAGAAGAACCCCATCGACTT

[0153] CCTGGAGGCCAAGGGCTACAAGGAGGTGAAGAAGGACCTGATCATCAAGCTGCCCAAGTAC

[0154] AGCCTGTTCGAGCTGGAGAACGGCCGCAAGCGCATGCTGGCCAGCGCCGGCGAGCTGCAGA

[0155] AGGGCAACGAGCTGGCCCTGCCCAGCAAGTACGTGAACTTCCTGTACCTGGCCAGCCACTAC

[0156] GAGAAGCTGAAGGGCAGCCCCGAGGACAACGAGCAGAAGCAGCTGTTCGTGGAGCAGCAC

[0157] AAGCACTACCTGGACGAGATCATCGAGCAGATCAGCGAGTTCAGCAAGCGCGTGATCCTGGC

[0158] CGACGCCAACCTGGACAAGGTGCTGAGCGCCTACAACAAGCACCGCGACAAGCCCATCCGC

[0159] GAGCAGGCCGAGAACATCATCCACCTGTTCACCCTGACCAACCTGGGCGCCCCCGCCGCCTT

[0160] CAAGTACTTCGACACCACCATCGACCGCAAGCGCTACACCAGCACCAAGGAGGTGCTGGAC

[0161] GCCACCCTGATCCACCAGAGCATCACCGGTCTGTACGAGACCCGCATCGACCTGAGCCAGCT

[0162] GGGCGGCGACGAATTCGGAGGAAGCGGAGGAGCACCAAGGATGAAGCAGCTGGAAGACAA

[0163] AGTCGAAGAACTGCTCTCCAAGAACTACCACTTGGAGAATGAAGTCGCCCGCCTGAAGAAG

[0164] CTGGTCGGAGAACGCTAACTCGAGCACCACCACCACCACCACTGA

[0165] SEQ ID NO:2:

[0166] TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTT

[0167] TAACTTTAAGAAGGAGATATACCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCC

[0168] TGGTGCCGCGCGGCAGCCATATGATGGACAAGAAGTACAGCATCGGCCTGGACATCGGTACC

[0169] AACAGCGTGGGCTGGGCCGTGATCACCGACGAGTACAAGGTGCCCAGCAAGAAGTTCAAGG

[0170] TGCTGGGCAACACCGACCGCCACAGCATCAAGAAGAACCTGATCGGCGCCCTGCTGTTCGAC

[0171] AGCGGCGAGACCGCCGAGGCCACCCGCCTGAAGCGCACCGCCCGCCGCCGCTACACCCGCC

[0172] GCAAGAACCGCATCTGCTACCTGCAGGAGATCTTCAGCAACGAGATGGCCAAGGTGGACGAC

[0173] AGCTTCTTCCACCGCCTGGAGGAGAGCTTCCTGGTGGAGGAGGACAAGAAGCACGAGCGCC

[0174] ACCCCATCTTCGGCAACATCGTGGACGAGGTGGCCTACCACGAGAAGTACCCCACCATCTAC

[0175] CACCTGCGCAAGAAGCTGGTGGACAGCACCGACAAGGCCGACCTGCGCCTGATCTACCTGG

[0176] CCCTGGCCCACATGATCAAGTTCCGCGGCCACTTCCTGATCGAGGGCGACCTGAACCCCGAC

[0177] AACAGCGACGTGGACAAGCTGTTCATCCAGCTGGTGCAGACCTACAACCAGCTGTTCGAGGA

[0178] GAACCCCATCAACGCCAGCGGCGTGGACGCCAAGGCCATCCTGAGCGCCCGCCTGAGCAAG

[0179] AGCCGCCGCCTGGAGAACCTGATCGCCCAGCTGCCCGGCGAGAAGAAGAACGGCCTGTTCG

[0180] GCAACCTGATCGCCCTGAGCCTGGGCCTGACCCCCAACTTCAAGAGCAACTTCGACCTGGCC

[0181] GAGGACGCCAAGCTGCAGCTGAGCAAGGACACCTACGACGACGACCTGGACAACCTGCTGG

[0182] CCCAGATCGGCGACCAGTACGCCGACCTGTTCCTGGCCGCCAAGAACCTGAGCGACGCCATC

[0183] CTGCTGAGCGACATCCTGCGCGTGAACACCGAGATCACCAAGGCCCCCCTGAGCGCCAGCAT

[0184] GATCAAGCGCTACGACGAGCACCACCAGGACCTGACCCTGCTGAAGGCCCTGGTGCGCCAG

[0185] CAGCTGCCCGAGAAGTACAAGGAGATCTTCTTCGACCAGAGCAAGAACGGCTACGCCGGCTA

[0186] CATCGACGGCGGCGCCAGCCAGGAGGAGTTCTACAAGTTCATCAAGCCCATCCTGGAGAAGA

[0187] TGGACGGCACCGAGGAGCTGCTGGTGAAGCTGAACCGCGAGGACCTGCTGCGCAAGCAGCG

[0188] CACCTTCGACAACGGCAGCATCCCCCACCAGATCCACCTGGGCGAGCTGCACGCCATCCTGC

[0189] GCCGCCAGGAGGACTTCTACCCCTTCCTGAAGGACAACCGCGAGAAGATCGAGAAGATCCTG

[0190] ACCTTCCGCATCCCCTACTACGTGGGCCCCCTGGCCCGCGGCAACAGCCGCTTCGCCTGGATG

[0191] ACCCGCAAGAGCGAGGAGACCATCACCCCCTGGAACTTCGAGGAGGTGGTGGACAAGGGCG

[0192] CCAGCGCCCAGAGCTTCATCGAGCGCATGACCAACTTCGACAAGAACCTGCCCAACGAGAA

[0193] GGTGCTGCCCAAGCACAGCCTGCTGTACGAGTACTTCACCGTGTACAACGAGCTGACCAAGG

[0194] TGAAGTACGTGACCGAGGGCATGCGCAAGCCCGCCTTCCTGAGCGGCGAGCAGAAGAAGGC

[0195] CATCGTGGACCTGCTGTTCAAGACCAACCGCAAGGTGACCGTGAAGCAGCTGAAGGAGGAC

[0196] TACTTCAAGAAGATCGAGTGCTTCGACAGCGTGGAGATCAGCGGCGTGGAGGACCGCTTCAA

[0197] CGCCAGCCTGGGCACCTACCACGACCTGCTGAAGATCATCAAGGACAAGGACTTCCTGGACA

[0198] ACGAGGAGAACGAGGACATCCTGGAGGACATCGTGCTGACCCTGACCCTGTTCGAGGACCG

[0199] CGAGATGATCGAGGAGCGCCTGAAGACCTACGCCCACCTGTTCGACGACAAGGTGATGAAGC

[0200] AGCTGAAGCGCCGCCGCTACACCGGCTGGGGCCGCCTGAGCCGCAAGCTTATCAACGGCATC

[0201] CGCGACAAGCAGAGCGGCAAGACCATCCTGGACTTCCTGAAGAGCGACGGCTTCGCCAACC

[0202] GCAACTTCATGCAGCTGATCCACGACGACAGCCTGACCTTCAAGGAGGACATCCAGAAGGCC

[0203] CAGGTGAGCGGCCAGGGCGACAGCCTGCACGAGCACATCGCCAACCTGGCCGGCAGCCCCG

[0204] CCATCAAGAAGGGCATCCTGCAGACCGTGAAGGTGGTGGACGAGCTGGTGAAGGTGATGGG

[0205] CCGCCACAAGCCCGAGAACATCGTGATCGAGATGGCCCGCGAGAACCAGACCACCCAGAAG

[0206] GGCCAGAAGAACAGCCGCGAGCGCATGAAGCGCATCGAGGAGGGCATCAAGGAGCTGGGCA

[0207] GCCAGATCCTGAAGGAGCACCCCGTGGAGAACACCCAGCTGCAGAACGAGAAGCTGTACCT

[0208] GTACTACCTGCAGAACGGCCGCGACATGTACGTGGACCAGGAGCTGGACATCAACCGCCTGA

[0209] GCGACTACGACGTGGACCACATCGTGCCCCAGAGCTTCCTGAAGGACGACAGCATCGACAAC

[0210] AAGGTGCTGACCCGCAGCGACAAGAACCGCGGCAAGAGCGACAACGTGCCCAGCGAGGAG

[0211] GTGGTGAAGAAGATGAAGAACTACTGGCGCCAGCTGCTGAACGCCAAGCTGATCACCCAGC

[0212] GCAAGTTCGACAACCTGACCAAGGCCGAGCGCGGCGGCCTGAGCGAGCTGGACAAGGCCGG

[0213] CTTCATCAAGCGCCAGCTGGTGGAGACCCGCCAGATCACCAAGCACGTGGCCCAGATCCTGG

[0214] ACAGCCGCATGAACACCAAGTACGACGAGAACGACAAGCTGATCCGCGAGGTGAAGGTGAT

[0215] CACCCTGAAGAGCAAGCTGGTGAGCGACTTCCGCAAGGACTTCCAGTTCTACAAGGTGCGC

[0216] GAGATCAACAACTACCACCACGCCCACGACGCCTACCTGAACGCCGTGGTGGGCACCGCCCT

[0217] GATCAAGAAGTACCCCAAGCTGGAGAGCGAGTTCGTGTACGGCGACTACAAGGTGTACGACG

[0218] TGCGCAAGATGATCGCCAAGAGCGAGCAGGAGATCGGCAAGGCCACCGCCAAGTACTTCTTC

[0219] TACAGCAACATCATGAACTTCTTCAAGACCGAGATCACCCTGGCCAACGGCGAGATCCGCAA

[0220] GCGCCCCCTGATCGAGACCAACGGCGAGACCGGCGAGATCGTGTGGGACAAGGGCCGCGAC

[0221] TTCGCCACCGTGCGCAAGGTGCTGAGCATGCCCCAGGTGAACATCGTGAAGAAGACCGAGG

[0222] TGCAGACCGGCGGCTTCAGCAAGGAGAGCATCCTGCCCAAGCGCAACAGCGACAAGCTGAT

[0223] CGCCCGCAAGAAGGACTGGGACCCCAAGAAGTACGGCGGCTTCGACAGCCCCACCGTGGCC

[0224] TACAGCGTGCTGGTGGTGGCCAAGGTGGAGAAGGGCAAGAGCAAGAAGCTGAAGAGCGTG

[0225] AAGGAGCTGCTGGGCATCACCATCATGGAGCGCAGCAGCTTCGAGAAGAACCCCATCGACTT

[0226] CCTGGAGGCCAAGGGCTACAAGGAGGTGAAGAAGGACCTGATCATCAAGCTGCCCAAGTAC

[0227] AGCCTGTTCGAGCTGGAGAACGGCCGCAAGCGCATGCTGGCCAGCGCCGGCGAGCTGCAGA

[0228] AGGGCAACGAGCTGGCCCTGCCCAGCAAGTACGTGAACTTCCTGTACCTGGCCAGCCACTAC

[0229] GAGAAGCTGAAGGGCAGCCCCGAGGACAACGAGCAGAAGCAGCTGTTCGTGGAGCAGCAC

[0230] AAGCACTACCTGGACGAGATCATCGAGCAGATCAGCGAGTTCAGCAAGCGCGTGATCCTGGC

[0231] CGACGCCAACCTGGACAAGGTGCTGAGCGCCTACAACAAGCACCGCGACAAGCCCATCCGC

[0232] GAGCAGGCCGAGAACATCATCCACCTGTTCACCCTGACCAACCTGGGCGCCCCCGCCGCCTT

[0233] CAAGTACTTCGACACCACCATCGACCGCAAGCGCTACACCAGCACCAAGGAGGTGCTGGAC

[0234] GCCACCCTGATCCACCAGAGCATCACCGGTCTGTACGAGACCCGCATCGACCTGAGCCAGCT

[0235] GGGCGGCGACGAATTCGGAGGAAGCGGAGGAGCACCAAGGATGAAGCAGATTGAAGACAA

[0236] AATTGAAGAAATTCTGTCCAAGATTTACCACATCGAGAATGAAATCGCCCGCATTAAGAAGCT

[0237] GATCGGAGAACGCTAACTCGAGCACCACCACCACCACCACTGA

[0238] SEQ ID NO:3:

[0239] atgaagcagctggaagacaaagtcgaagaactgctctccaagaactaccacttggagaatgaagtcgcccgcctgaagaagctggtcggagaacgc SEQ ID NO:4:

[0240] atgaagcagattgaagacaaaattgaagaaattctgtccaagatttaccacatcgagaatgaaatcgcccgcattaagaagctgatcggagaacgc

Claims

1. A method of increasing the expression level of a dCas9 protein in a prokaryotic cell, wherein, The leucine zipper gene sequence is connected with the dCas9 gene sequence and introduced into a prokaryotic cell.

2. The method of claim 1, wherein, The prokaryotic cell includes Escherichia coli, Bacillus subtilis, Staphylococcus, and nitrifying bacteria.

3. The method of claim 1, wherein, The leucine zipper gene sequence is derived from the tail end leucine zipper coding sequence of the GCN4 protein.

4. The method of claim 3, wherein, The leucine zipper gene sequence is the coding sequence SEQ ID NO: 3 of the Dimer lzip protein or the coding sequence SEQ ID NO: 4 of the Trimer lzip protein.

5. The method of claim 1, comprising introducing the dCas9 gene and the leucine zipper gene sequence into an expression vector to obtain a recombinant plasmid containing the dCas9 gene and the leucine zipper gene sequence; transforming the recombinant plasmid into a prokaryotic cell to express the dCas9 protein.

6. The method of claim 5, wherein, The expression vector is a PET28a plasmid.

7. The method of claim 5, further comprising the steps of extraction and purification of the dCas9 protein.

8. Use of a vector containing a dCas9 gene and a leucine zipper gene sequence in the preparation of a dCas9 protein.

9. Use according to claim 8, wherein, The leucine zipper gene sequence is derived from the tail end leucine zipper coding sequence of the GCN4 protein.

10. Use according to claim 9, wherein, The leucine zipper gene sequence is the coding sequence SEQ ID NO: 3 of the Dimer lzip protein or the coding sequence SEQ ID NO: 4 of the Trimer lzip protein.

Images