Application of resibufogenin in preparation of medicine for resisting porcine epidemic diarrhea virus

Abstract

The invention provides application of resibufogenin in preparation of a medicine for resisting porcine epidemic diarrhea virus, and belongs to the technical field of chemical medicines. Experimental results show that resibufogenin has remarkable inhibiting and blocking effects on a-1 ribosomal Frameshift process of a porcine epidemic diarrhea virus (PEDV), can effectively inhibit replication and proliferation of the PEDV, and has an inhibiting effect on a plurality of common strains of the PEDV; the resibufogenin can be used for preparing a medicine for resisting PEDV and a medicine for preventing and treating porcine epidemic diarrhea caused by PEDV, and the medicine is a wide-spectrum antiviral medicine, is insensitive to variation of PEDV and has a wide application prospect.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of chemical medicine, and particularly relates to application of resibufogenin in preparation of an anti-swine epidemic diarrhea virus drug. BACKGROUND

[0002] Swine epidemic diarrhea virus (PEDV) is a highly infectious coronavirus belonging to the alpha genus of the Coronaviridae family, which mainly infects pigs, especially newborn piglets. The mortality rate of newborn piglets after infection is extremely high, which often brings huge economic losses to the breeding industry. The genome of PEDV is a single-stranded positive-sense RNA of about 28 kb, which encodes various structural proteins and non-structural proteins. In recent years, PEDV has continuously emerged in variant strains, and the pathogenicity and transmission ability of some strains have significantly increased, which further increases the difficulty of prevention and control. At present, the research on PEDV mainly focuses on viral receptor recognition, immune escape mechanism and vaccine development. Although some candidate vaccines have entered the experimental stage, the high mutation rate of the virus is still the main challenge for prevention and control. Therefore, it is urgent to develop an anti-viral drug that is not sensitive to virus variation. SUMMARY

[0003] In view of the above problems in the prior art, the application aims to provide application of resibufogenin in preparation of an anti-swine epidemic diarrhea virus drug.

[0004] The technical scheme adopted by the application is as follows:

[0005] Application of resibufogenin in preparation of an anti-swine epidemic diarrhea virus drug.

[0006] Resibufogenin, also known as bufalin, is an extract of toad venom, which has the effect of inhibiting tumor cell proliferation by inducing accumulation of reactive oxygen species (ROS) and apoptosis pathway.

[0007] The molecular formula of resibufogenin is: 24 H 32 O4;

[0008] The structural formula of resibufogenin is:

[0009] .

[0010] In an embodiment of the application, the drug is a drug for preventing and / or treating swine epidemic diarrhea disease caused by PEDV infection.

[0011] In an embodiment of the application, the drug is a drug for inhibiting replication of PEDV.

[0012] In an embodiment of the present application, the drug is a drug for inhibiting the proliferation of porcine epidemic diarrhea virus.

[0013] In an embodiment of the present application, the porcine epidemic diarrhea virus comprises one or more genotypes of G1a, G1b, G2a, G2b, G2c.

[0014] In an embodiment of the present application, the drug comprises an ester bufadienolide and a pharmaceutically acceptable excipient.

[0015] In an embodiment of the present application, the ester bufadienolide inhibits the replication, proliferation of porcine epidemic diarrhea virus or prevents porcine epidemic diarrhea disease by inhibiting the -1 ribosomal frameshifting process of the porcine epidemic diarrhea virus.

[0016] In an embodiment of the present application, the drug is an oral preparation or an injection.

[0017] Compared with the prior art, the present application has the following beneficial effects:

[0018] There is a ribosomal frameshifting element in the middle of the open reading frame 1 (ORF1) of the PEDV genome, and the virus precisely regulates the expression of the genes in the rear part of the ORF1 through the element, and these genes contain the key component RdRP (RNA-dependent RNA polymerase) of the virus replication complex. Inhibiting ribosomal frameshifting can effectively prevent the amplification of PEDV, so the ribosomal frameshifting element is an ideal target for small molecule drugs, and the ribosomal frameshifting element has the characteristic of low mutation rate, so the inhibitor targeting the element is not sensitive to mutation.

[0019] The present application finds a new use of ester bufadienolide in inhibiting PEDV. Experiments prove that ester bufadienolide has extremely significant inhibitory and blocking effect on the -1 ribosomal frameshifting process of PEDV, can effectively inhibit the replication of PEDV, and further inhibit the proliferation of PEDV; and it has inhibitory effect on various genotypes of PEDV, that is, the process of ester bufadienolide inhibiting the proliferation of PEDV is not sensitive to the mutation of PEDV. Therefore, ester bufadienolide can be used for treating and preventing porcine epidemic diarrhea disease caused by PEDV infection, for preparing an anti-PEDV drug, and for preparing a drug for treating and preventing porcine epidemic diarrhea disease caused by PEDV infection, which is a broad-spectrum antiviral drug, not sensitive to the variation of PEDV, and has good application prospect.

[0020] PEDV is mainly divided into two genotypes: G1 (classical strain) and G2 (variant strain). Among them, G1 type is further divided into G1a and G1b two subgroups, and G2 type is divided into G2a, G2b and G2c three subgroups. The ester bufoniside discovered in the application has extremely significant inhibitory effect on five subgroups of PEDV strains (G1a, G1b, G2a, G2b and G2c). BRIEF DESCRIPTION OF DRAWINGS

[0021] In order to more clearly illustrate the technical solutions of the embodiments of the present application or the prior art, the drawings needed to be used in the embodiment or prior art description will be briefly introduced below.

[0022] Figure 1 The design principle schematic diagram (a), experimental process schematic diagram (b) and experimental results (c) of ester bufoniside inhibiting PEDV ribosome frameshifting process in luciferase reporter system.

[0023] Figure 2 The design principle schematic diagram (a), experimental process schematic diagram (b) and experimental results (c) of ester bufoniside inhibiting PEDV ribosome frameshifting process in fluorescent protein reporter system.

[0024] Figure 3 The experimental results of different concentrations of ester bufoniside on the toxicity of Vero cells and the antiviral activity of PEDV in cells.

[0025] Figure 4 The experimental results of ester bufoniside on the inhibition effect of Vero cell CPE (cytopathic effect) caused by PEDV G2c strain.

[0026] Figure 5 The experimental results of RT-PCR detection of ester bufoniside on PEDV (G1a, G1b, G2a, G2b, G2c strains) antiviral experiment.

[0027] Figure 6 The experimental results of ester bufoniside on the antiviral experiment of PEDV in live pigs. DETAILED DESCRIPTION

[0028] Hereinafter, only some exemplary embodiments are simply described. As those skilled in the art can recognize, the described embodiments can be modified in various different ways without departing from the spirit or scope of the present application. Therefore, the drawings and the description are considered to be exemplary in nature rather than limiting.

[0029] Embodiment 1

[0030] To evaluate the inhibitory effect of resibufogenin on the -1 Ribosomal Frameshifting process of PEDV (luciferase reporter system).

[0031] 1. Experimental method

[0032] The inhibitory effect of resibufogenin on the -1 Ribosomal Frameshifting process of PEDV was studied using in vitro cultured cells. First, a dual luciferase reporter gene lentivirus vector containing the sliding sequence of the PEDV viral genome was constructed, and the effect of the drug was detected in the pig kidney cell line PK15. The initial screening concentration of the drug was 10 μM.

[0033] 1.1. Luciferase reporter gene vector construction

[0034] (1) Synthesize the PEDV virus -1 Ribosomal Frameshift sliding region gene sequence (synthesize 5 strains of frameshift elements: G1a, G1b, G2a, G2b, G2c, respectively). Double enzyme digestion was performed on the lentivirus backbone vector, and the enzyme digestion site was selected as EcoRI + BamHI. The enzyme digestion conditions were 37°C for 15 minutes. After enzyme digestion, the enzyme digestion product was recovered by nucleic acid electrophoresis. For the synthesized PEDV virus -1 Ribosomal Frameshift sliding region gene sequence, first denature at 95°C for 10 minutes, then anneal at 72°C for 30 seconds. Then mix the annealing product with the enzyme digestion product at a ratio of 3:1, and add 10 microliters of T4 ligase to the above mixture and incubate in a 16°C constant temperature metal bath for 16 hours. Transform competent cells with plasmid: Take competent cells from -80°C freezer, thaw on ice, and add 10 microliters of plasmid (plasmid is a lentivirus vector containing PEDV virus -1 Ribosomal Frameshift sliding region gene sequence) to 100 microliters of competent cells. Mix the plasmid and mix on ice for 30 minutes. Then place the mixture of competent cells and plasmid in a 42°C water bath for 90 seconds. After heat shock, cool the mixture of competent cells and plasmid on ice for 10 seconds. Transfer the cooled mixture to a solid LB plate and evenly spread the liquid on the surface of the solid LB medium with a glass rod. Then invert the solid LB medium and incubate in a 37°C incubator for 16 hours. After incubation, pick a single colony with a pipette tip and inoculate liquid LB medium. Incubate at 37°C for 8 hours, then send to a commercial company for sequencing. The single colony with correct sequencing results was expanded and plasmid extraction was performed.

[0035] (2) Construct Renilla luciferase to the upstream of -1 Ribosomal Frameshift region and construct Firefly luciferase to the downstream of -1 Ribosomal Frameshift region by homologous recombination.

[0036] The specific method is as follows: the Renilla luciferase and Firefly luciferase gene sequences are amplified by PCR method, and homologous arms are added to the upstream and downstream of the sequences. Perform PCR on the vector obtained in step (1) to obtain a linearized vector. Nucleic acid electrophoresis and gel recovery are performed to obtain Renilla luciferase and Firefly luciferase gel recovery products and linearized vector gel recovery products. Homologous recombination: mix the Renilla luciferase and Firefly luciferase recovery products with the linearized vector recovery product at a mass ratio of 3:1, and add 2 microliters of homologous recombination enzyme, and react at 37°C for 15 minutes.

[0037] (3) Transform the competent cells with the plasmid, select single clones and sequence, and amplify and extract the plasmid from the virus backbone vector with correct sequencing. The transformation of competent cells and the extraction step are synchronized with step (1).

[0038] 1.2. Establishment of luciferase reporter gene screening cell system

[0039] (1) Mix the virus backbone vector containing double luciferase and -1 Ribosomal Frameshift region, PMD2.G, and pspax2 packaging vector at a volume ratio of 4:2:1 with PEI (polyethyleneimine), add 70 microliters of PEI per 35 microliters of DNA, and transfect 293T cells.

[0040] (2) Collect the 293T cell culture supernatant after transfection of the virus plasmid for 48h and 72h, centrifuge at 12000g for 10min, remove the cell impurities, and collect the lentivirus particles by cesium chloride gradient centrifugation.

[0041] (3) Add the lentivirus particles to PK15 cells, and after 7 days of infection, select positive cells by Puro. Digest the cells with trypsin to prepare a single cell suspension, and sort the single clones by flow cytometry.

[0042] (4) Genotype the cultured single clone cells, and expand the positive clones to obtain PK15 cells containing -1 Ribosomal Frameshift region (CMV-Renilla-framshift-Firefly).

[0043] 1.3. Drug screening based on luciferase reporter gene

[0044] (1) Five types of PK15 cells containing -1 Ribosomal Frameshift region were mixed and cultured in a 96-well plate at a ratio of 1:1:1:1:1. After 24 hours, different test compounds (control group: DMSO; experimental group: bufotoxin) were added to the plate, and the drug concentration was 10 μM.

[0045] (2) After culturing for 8 hours, the cells were lysed, and firefly luciferase substrate was added to the lysate. After 0.5 hours, the luminescence value was detected by an enzyme-linked immunosorbent assay (ELISA) reader.

[0046] (3) Add the Renaissance luciferase substrate and detect the luminescence value using an enzyme-linked immunosorbent assay (ELISA) reader.

[0047] (4) The ratio of firefly luciferase to Renilla luciferase is used as a reference for the -1 Ribosomal Frameshift efficiency. A larger ratio indicates a higher -1 Ribosomal Frameshift efficiency, and a lower ratio indicates a lower -1 Ribosomal Frameshift efficiency. In other words, a lower ratio indicates a higher efficiency of the drug in inhibiting the -1 Ribosomal Frameshift process, and a better ability to inhibit the -1 Ribosomal Frameshift process.

[0048] 2. Experimental Results

[0049] Experimental results are as follows Figure 1 As shown, Figure 1 This document presents a schematic diagram of the design principle, experimental procedure, and experimental results for the inhibition of PEDV ribosomal frameshifting by bufotoxin ligands in a luciferase reporter system. Specifically, Figure 1 In the 'a' section, the reporter gene design scheme is as follows: when ribosome frameshift occurs normally, both the reporter genes Renilla and Firefly are expressed. However, when ribosome frameshift is blocked, the reporter gene Renilla is expressed, while Firefly is not expressed. Figure 1 The workflow of the multivariate mixed screening reporter system is as follows: First, the reporter vector is stably integrated into the host cell (porcine kidney cell line PK15) via a lentiviral vector. The mixed system of 5 positive monoclonal cells is then treated with compounds (control group: DMSO; experimental group: bufotoxin ligand). The effect of the compounds on the PEDV ribosome frameshift process is determined by a dual-luciferase reporter gene assay kit and an enzyme-linked immunosorbent assay (ELISA) reader. Figure 1 In the image, 'c' represents the results of the luciferase reporter gene screening experiment. (From...) Figure 1As can be seen from Table 1, 10 μΜ of ester bufonis can significantly inhibit the -1 Ribosomal Frameshifting process of PEDV (G1a, G1b, G2a, G2b, G2c strains) (* indicates P<0.05).

[0050] Example 2

[0051] Evaluation of the inhibitory effect of ester bufonis on the -1 Ribosomal Frameshifting process of PEDV (fluorescent protein reporter system).

[0052] 1. Experimental method

[0053] 1.1. Construction of fluorescent protein reporter gene vector

[0054] (1) Synthesis of PEDV virus-1 Ribosomal Frameshift sliding region gene sequence (synthesis of 5 strains of frameshift elements: G1a, G1b, G2a, G2b, G2c respectively). Double enzyme digestion was performed on the lentivirus backbone vector, and the enzyme digestion site was selected as EcoRI+BamHI. The enzyme digestion conditions were 37°C for 15 minutes. After enzyme digestion, the enzyme digestion product was recovered by nucleic acid electrophoresis. For the synthesized PEDV virus-1 Ribosomal Frameshift sliding region gene sequence, first denature at 95°C for 10 minutes, then anneal at 72°C for 30 seconds, then mix the annealing product with the enzyme digestion product at a ratio of 3:1, add 10 microliters of T4 ligase to the above mixture, and incubate in a 16°C constant temperature metal bath for 16 hours. Transform competent cells with plasmid: Take competent cells from -80°C freezer, thaw on ice, add 10 microliters of plasmid (plasmid is a lentivirus vector carrying PEDV virus-1 Ribosomal Frameshift sliding region gene sequence) to 100 microliters of competent cells, mix well, and place on ice for 30 minutes. Place the mixture of competent cells and plasmid in a 42°C water bath for 90 seconds. After heat shock, cool the mixture of competent cells and plasmid on ice for 10 seconds. Transfer the cooled mixture to a solid LB plate, evenly spread the liquid on the surface of the solid LB medium with a glass rod, then invert the solid LB medium and incubate in a 37°C incubator for 16 hours. After incubation, pick a single colony with a pipette tip and inoculate liquid LB medium. Incubate at 37°C for 8 hours, then send to a commercial company for sequencing. The correct single colony is expanded and plasmid extraction is performed.

[0055] (2) Construct ubiquitin-green fluorescent protein (Ub-GFP) to the upstream of -1 Ribosomal Frameshift region and red fluorescent protein (RFP) to the downstream of -1 Frameshift region by homologous recombination.

[0056] The specific method is as follows: the Ub-GFP and RFP gene sequences are amplified by PCR method, and homologous arms are added to the upstream and downstream of the sequences. The vector obtained in step (1) is subjected to PCR to obtain a linearized vector. Nucleic acid electrophoresis and gel recovery are performed to obtain Ub-GFP and RFP gel recovery products and linearized vector gel recovery products. Homologous recombination: mix the Ub-GFP and RFP gel recovery products with the linearized vector gel recovery products at a mass ratio of 3:1, and add 2 microliters of homologous recombination enzyme, and react at 37°C for 15 minutes.

[0057] (3) Transform the competent cells with the plasmid, select single clones and sequence, and amplify and extract the plasmid of the virus backbone vector with correct sequencing. The transformation of competent cells and the extraction step are synchronized with step (1).

[0058] 1.2. Establishment of fluorescent protein reporter gene screening cell system

[0059] (1) Mix the virus backbone vector containing double fluorescent proteins and -1 Ribosomal Frameshift region, PMD2.G, and pspax2 packaging vector at a volume ratio of 4:2:1 with PEI, add 70 microliters of PEI per 35 microliters of DNA, and transfect 293T cells.

[0060] (2) Collect the 293T cell culture supernatant after transfection of the virus plasmid for 48h and 72h, centrifuge at 12000g for 10min, remove the cell impurities, and collect the lentivirus particles by cesium chloride gradient centrifugation.

[0061] (3) Add the lentivirus particles to PK15 cells, and after 7 days of infection, select positive cells by Puro. Digest the cells to prepare a single cell suspension, and sort the single clones by flow cytometry.

[0062] (4) Genotype the cultured single clone cells, and expand the positive clones to obtain PK15 cells containing -1 Ribosomal Frameshift region (CMV-Ub-GFP-framshift-RFP).

[0063] 1.3. Drug screening based on fluorescent protein reporter gene

[0064] (1) Five PK15 fluorescent protein reporter gene cells containing -1 Ribosomal Frameshift region were mixed at a ratio of 1:1:1:1:1 and cultured into 96-well plates. After 24 hours of cell plating, different test compounds (control group: DMSO; experimental group: ester bufadienolide) were added, and the drug concentration was 10 μM to exclude spontaneous fluorescence compounds.

[0065] (2) After 8 hours of culture, MG132 was added, and after 4 hours of culture, the fluorescence signal change was observed under a high-content fluorescence microscope.

[0066] (3) The ratio of RFP to GFP was used as a reference for -1 Ribosomal Frameshift efficiency. The higher the ratio, the higher the -1 Ribosomal Frameshift efficiency. The lower the ratio, the lower the -1 Ribosomal Frameshift efficiency, i.e. the lower the ratio, the higher the efficiency of the drug in inhibiting the -1 Ribosomal Frameshift process, and the better the inhibition of the -1 Ribosomal Frameshift process.

[0067] 2. Experimental results

[0068] The experimental results are shown in Figure 2 , which are the design principle diagram, experimental process diagram and experimental results of ester bufadienolide inhibiting the PEDV ribosomal frameshift (-1 Ribosomal Frameshifting) process in the fluorescent protein reporter system. Specifically, Figure 2 , a is the fluorescent protein reporter system design scheme. When the ribosomal frameshift occurs, both reporter genes GFP and RFP are expressed. When the ribosomal frameshift is prevented, the reporter gene GFP is expressed, and the RFP is not expressed. Figure 2 , b is the fluorescent protein reporter system workflow. First, the reporter vector is stably integrated into the host cell (PK15 cell) through the lentiviral vector. The positive monoclonal cells are treated with compounds (control group: DMSO; experimental group: ester bufadienolide). The fluorescence image is obtained by high-content fluorescence microscopy, and the fluorescence signal analysis is used to judge the inhibition effect of the compound on the PEDV ribosomal frameshift process. Figure 2 , c is the experimental results of the fluorescent protein reporter system. As shown in Figure 2 , c, 10 μM of ester bufadienolide has a significant inhibitory effect on the -1 Ribosomal Frameshifting process of PEDV (G1a, G1b, G2a, G2b, G2c strains) (P<0.05). Figure 2

[0069] Example 3​

[0070] Evaluation of the in vitro antiviral activity and cytotoxicity of ester bufonis

[0071] 1. Experimental method

[0072] The experiment was carried out under P2 laboratory conditions, and PEDV virus (G2c strain) was cultured in Vero (African green monkey kidney) cells, and trypsin was added to promote virus adsorption. After 2 hours of infection, the normal culture medium was replaced, and the compound (ester bufonis) was added at a concentration of 0.01, 0.0625, 0.125, 0.25, 0.5, 1, 2, 5, 10, 20, 40, 80 μM, and the lesions were observed after 48 hours. The level of virus replication was detected by fluorescent quantitative PCR. The relationship between drug concentration and virus inhibition rate was calculated, and the virus inhibition rate EC 50 was obtained by fitting the curve. The cells were treated with 0.01, 0.0625, 0.125, 0.25, 0.5, 1, 2, 5, 10, 20, 40, 80 μM drugs alone, and the cell activity was determined by CCK8 experiment, and the cytotoxicity rate CC 50 was obtained by fitting the curve. 50 The calculation of the selectivity index SI is CC 50 .

[0073] 2. Experimental results

[0074] The experimental results are shown in Figure 3 , the toxicity index CC 50 of ester bufonis in Vero cells is 3.71 μM, i.e. the half cytotoxicity concentration (CC 50 ) of ester bufonis to Vero cells is 3.71 μM; ester bufonis has an inhibitory effect on the -1 Ribosomal Frameshifting process of PEDV, and the half effective concentration (EC 50 ) is 0.23 μM; the selectivity index SI is 16.13, and the SI value greater than 5.00 indicates that the drug is effective and has high safety, and the larger the value, the wider the safety range of the drug.

[0075] Example 4

[0076] Evaluation of the antiviral effect of ester bufonis in cultured cells in vitro.

[0077] 1. Experimental method

[0078] The experiment was carried out under P2 laboratory conditions, and PEDV virus (G2c strain) was cultured in Vero (African green monkey kidney) cells, and trypsin was added to promote virus adsorption. After 2 hours of infection, the normal culture medium was replaced, and the compound (DMSO or ester bufonis) was added at a concentration of 1 μM, and photographs were taken under a bright field microscope after 48 hours.

[0079] 2. Experimental results

[0080] The experimental results are shown in Table 1. Figure 4 As shown in Table 1, the Vero cells without PEDV infection grew well without cytopathic effect (CPE) caused by virus infection. After PEDV infection, the solvent treatment group (DMSO) showed a large amount of CPE, and the cell state was very poor, while the CPE of the ester bufonisnin treatment group was significantly reduced, and the cell state was close to that of the group without PEDV infection. It is shown that ester bufonisnin has a significant inhibitory effect on the Vero cell CPE caused by PEDV G2c strain.

[0081] Example 5

[0082] The antiviral effect of ester bufonisnin on different strains (G1a, G1b, G2a, G2b, G2c) of PEDV was evaluated.

[0083] 1. Experimental method

[0084] The experiment was carried out under P2 laboratory conditions, and PEDV virus (G1a, G1b, G2a, G2b, G2c) was cultured in Vero (African green monkey kidney) cells, and trypsin was added to promote virus adsorption. After 2 hours of infection, normal culture medium was replaced, and compound (control group: DMSO; experimental group: ester bufonisnin) was added at a concentration of 1 μM, and the virus replication level was detected by fluorescence quantitative PCR after 48 hours.

[0085] The qPCR primers are as follows:

[0086] PEDV M-F GGTTGCTACTGGCGTACAGGTA,

[0087] PEDV M-R GAAGCATTGACTGAACGACCAACA;

[0088] GAPDH-F GAAGGTGAAGGTCGGAGTCA,

[0089] GAPDH-R CATGTAAACCATGTAGTTGAGGTC.

[0090] 2. Experimental results

[0091] The experimental results are shown in Table 2. Figure 5 Figure 5 The results of the RT-PCR detection of the antiviral effect of ester bufonisnin on G1a, G1b, G2a, G2b, and G2c strains of PEDV are shown in Table 2. Figure 5 ​As can be seen, resibufogenin has extremely significant antiviral effect on G1a, G1b, G2a, G2b and G2c strains of PEDV (*** represents P<0.001), indicating that resibufogenin has broad-spectrum antiviral effect on PEDV.

[0092] Example 6

[0093] The antiviral effect of resibufogenin on PEDV in live pigs was evaluated.

[0094] 1. Experimental method

[0095] Resibufogenin (drug) was dissolved with DMSO, 21-day-old PEDV antibody-negative weaned piglets (10 in each group) were selected and divided into an experimental group (infection + drug treatment), a positive control group (infection + DMSO) and a negative control group (without infection), and after 7 days of pre-feeding, 10.0 TCID50 (half of the tissue culture infective dose) of PEDV-G2c strain was orally inoculated; the drug was administered by intramuscular injection at a dose of 10 mg / kg of body weight; once a day, the diarrhea score, body temperature and feed intake were recorded, the empty stomach tissue was collected 7 days after infection to detect the viral load, and biosafety measures were implemented throughout the experiment (glutaraldehyde disinfection, protective clothing operation).

[0096] 2. Experimental results

[0097] The experimental results are shown in Figure 6 , Figure 6 The viral load of empty stomach tissue of the experimental group and the positive control group is shown in Figure 6 As can be seen, resibufogenin has extremely significant antiviral effect on PEDV (*** represents P<0.001).

Claims

1. Use of ester sapogenin in the preparation of a medicine for resisting porcine epidemic diarrhea virus.

2. The use of esteric bufadienolides according to claim 1 for the preparation of a medicament against porcine epidemic diarrhea virus, characterized in that, The medicine is a medicine for preventing and / or treating porcine epidemic diarrhea disease caused by porcine epidemic diarrhea virus infection.

3. The use of estercerberoside according to claim 1 for the preparation of a medicament against porcine epidemic diarrhea virus, characterized by, The medicine is a medicine for inhibiting the replication of porcine epidemic diarrhea virus.

4. The use of estercerberoside according to claim 1 for the preparation of a medicament against porcine epidemic diarrhea virus, characterized by, The medicine is a medicine for inhibiting the proliferation of porcine epidemic diarrhea virus.

5. The use of estercerberoside according to claim 1 for the preparation of a medicament against porcine epidemic diarrhea virus, characterized by, The porcine epidemic diarrhea virus includes one or more genotypes of G1a, G1b, G2a, G2b, G2c strains.

6. The use of estercerberoside according to claim 1 for the preparation of a medicament against porcine epidemic diarrhea virus, characterized by, The medicine includes ester sapogenin and pharmaceutically acceptable excipients.

7. Use of esteric bufadienolides according to any one of claims 1 to 6 for the preparation of a medicament against porcine epidemic diarrhea virus, characterized in that, The ester sapogenin inhibits the replication, proliferation or prevention of porcine epidemic diarrhea virus by inhibiting the -1 ribosome frameshift process of the porcine epidemic diarrhea virus.

8. Use of esteric bufadienolides according to any of claims 1, 2 or 6 for the preparation of a medicament against porcine epidemic diarrhea virus, characterized in that, The medicine is an oral preparation, an injection.

Images