Application of trim25 gene coded protein in improvement of fish cell transfection efficiency

Abstract

The invention belongs to the technical field of molecular biology and cell engineering, and particularly relates to application of protein coded by a trim25 gene to improvement of fish cell transfection efficiency. The technical problem to be solved by the invention is low fish cell transfection efficiency. The invention aims to solve the technical problem of application of protein coded by a trim25 gene in improvement of fish cell transfection efficiency. The amino acid sequence of the protein is as shown in SEQ ID No. 1. According to the invention, the effect of the protein coded by the trim25 gene in the fish cell transfection efficiency is defined for the first time. The method is easy and convenient to operate, low in cost and good in repeatability, and an efficient tool is provided for fish gene function research, gene editing and the like.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular biology and cell engineering, and particularly relates to application of a protein encoded by a trim25 gene in improving fish cell transfection efficiency. BACKGROUND

[0002] Exogenous gene transfection in fish cells is the basis for carrying out gene function research and gene editing, but currently faces the bottleneck of generally low efficiency. Existing methods mainly fall into three categories: physical methods (microinjection, electroporation) can bypass some barriers, but are complex to operate and sensitive to the hard eggshell and strong membrane barrier of fish, with an efficiency often less than 40%; chemical methods (liposomes, nano-carriers) are mild but have limited delivery effect and are easily disturbed by fish serum components; biological methods (viral vectors, gene guns) have high efficiency but have safety risks and physical damage problems. The core challenge of exogenous gene transfection in fish cells lies in the difficulty of efficient entry of exogenous genes due to the special structure (multilayer membrane, hard eggshell, low-temperature culture environment) of fish. Therefore, in actual application, the selection needs to be balanced between operation difficulty, cell damage and transfection efficiency according to cell type, experimental scale and purpose, and there is no universal efficient solution.

[0003] Existing methods for improving fish cell transfection efficiency mainly focus on optimizing transfection reagents, adjusting cell density, changing electroporation parameters and other physical or chemical means, and there is no report on improving transfection efficiency by knocking down endogenous RNA degradation pathways in cells. SUMMARY

[0004] The technical problem to be solved by the application is low fish cell transfection efficiency.

[0005] The technical problem of the application is the application of a protein encoded by a trim25 gene in improving fish cell transfection efficiency; the amino acid sequence of the protein is shown in SEQ ID No. 1.

[0006] Specifically, the improvement of fish cell transfection efficiency is achieved by knocking down the expression of a trim25 gene in fish cells.

[0007] Further, the specific operation of knocking down the expression of the trim25 gene in fish cells is to design siRNA targeting the trim25 gene and transfect fish cells.

[0008] The siRNA is at least one of SEQ ID No. 5-7.

[0009] In particular, the trim25 gene has a nucleotide sequence as shown in NCBI No. NM_200175.1.

[0010] The fish cell is a zebrafish (Danio rerio) cell.

[0011] Further, the zebrafish (Danio rerio) cell is a zebrafish embryo fibroblast cell PAC2.

[0012] The application further provides a method for improving the transfection efficiency of fish cells, which is realized by knocking down the expression of a trim25 gene in the fish cells.

[0013] Further, the specific operation of knocking down the expression of the trim25 gene in the fish cells is as follows: an siRNA interference fragment targeting the trim25 gene is designed, and the fish cells are transfected.

[0014] The siRNA is at least one of SEQ ID No. 5-7.

[0015] In particular, the trim25 gene has a nucleotide sequence as shown in NCBI No. NM_200175.1.

[0016] The fish cell is a zebrafish (Danio rerio) cell.

[0017] Further, the zebrafish (Danio rerio) cell is a zebrafish embryo fibroblast cell PAC2.

[0018] The application further provides a method for transfecting an exogenous gene into fish cells, which comprises the following steps: knocking down the expression of a trim25 gene in the fish cells to obtain trim25 gene low-expression cells; and transfecting an exogenous nucleic acid into the trim25 gene low-expression cells.

[0019] Further, the specific operation of reducing the expression of the trim25 gene in the fish cells is as follows: an siRNA targeting the trim25 gene is designed, and the fish cells are transfected.

[0020] The siRNA is at least one of SEQ ID No. 5-7.

[0021] In particular, the trim25 gene has a nucleotide sequence as shown in NCBI No. NM_200175.1.

[0022] The fish cell is a zebrafish (Danio rerio) cell.

[0023] Further, the zebrafish (Danio rerio) cell is a zebrafish embryo fibroblast cell PAC2.

[0024] Specifically, the transfection of the exogenous nucleic acid into the trim25 gene low-expression cell is performed by using a liposome nucleic acid transfection method or an mRNA transfection method.

[0025] More specifically, the exogenous nucleic acid is a coding fragment of eGFP.

[0026] Preferably, in the mRNA transfection method, the coding fragment of eGFP is eGFP mRNA, and the structure of the eGFP mRNA is Cap1-m1Ψ-eGFP mRNA. The aforementioned structure includes: a Cap1 cap structure at the 5' end, m1Ψ modification, and a poly(A) tail at the 3' end.

[0027] The application has the following beneficial effects: The application first determines the role of the protein encoded by the trim25 gene in the transfection efficiency of fish cells. According to the experimental results, the application provides the application of the protein encoded by the trim25 gene in improving the transfection efficiency of fish cells. The application is realized by knocking down the expression of the trim25 gene in fish cells; specifically, the RNA interference technology is used to target and inhibit the expression of the trim25 gene, so that the high-efficiency transient transfection of the exogenous nucleic acid in fish cells is realized. The application also takes eGFP as an example to perform the transfection of the exogenous nucleic acid, and the transfection efficiency is significantly improved (the transfection efficiency is improved by up to 81%). The method of the application is simple in operation, low in cost, and good in repeatability, and provides a high-efficiency tool for the gene function research and gene editing of fish. In subsequent use, the Cas9 system can be used to knock out the trim25 gene in the cells, so that the cell line with the knocked-out trim25 is successfully obtained. The transfection of other exogenous nucleic acids is performed on the basis of the aforementioned cell line. BRIEF DESCRIPTION OF DRAWINGS

[0028] Figure 1 FIG. 4 is the results of RNA quality detection and PCR amplification of the trim25 gene of zebrafish PAC2 cells. The β-actin gene is an internal reference, and the size of the trim25 gene is 854 bp.

[0029] Figure 2 FIG. 6 is the results of semi-quantitative PCR and qRT-PCR detection after the trim25 gene is interfered.

[0030] Figure 3 FIG. 7 is a comparison diagram of fluorescence expression after GFP-mRNA is transfected by using an mRNA transfection reagent 48 hours after the trim25 gene is interfered. NC is a negative control group, and the scale line is 100 μm.

[0031] Figure 4 FIG. 8 is a comparison diagram of fluorescence expression after GFP-mRNA is transfected by using a liposome transfection reagent 48 hours after the trim25 gene is interfered. NC is a negative control group, and the scale line is 100 μm.

[0032] Figure 5 After 48h of trim25 gene interference, the fluorescence expression of the GFP-N1 plasmid after transfection using a liposome transfection reagent is compared, NC is a negative control group, and the scale line is 100 μm. DETAILED DESCRIPTION

[0033] Trim25 (Tripartite motif-containing protein 25) is an E3 ubiquitin ligase, which is widely involved in cellular antiviral response, RNA metabolism and protein stability regulation. In recent years, studies have found that TRIM25 can recognize exogenous RNA and mediate its degradation through the ubiquitination pathway, thereby reducing the expression efficiency of exogenous genes. However, the function of Trim25 in fish cells has not been systematically studied, and it is not clear whether it is involved in regulating the stability and transfection efficiency of exogenous nucleic acids.

[0034] The present application first designs siRNA for the trim25 gene, transfects zebrafish embryo fibroblasts, and obtains cells with knockdown of the trim25 gene. Then, taking eGFP as an example, the transfection of exogenous nucleic acid is carried out, and the transfection efficiency is significantly improved (the transfection efficiency is improved by up to 81%). In subsequent use, the trim25 gene in the cell can be knocked out by using the Cas9 system, so that a cell line with trim25 knockout is successfully obtained. On the basis of the foregoing cell line, the transfection of other exogenous nucleic acids is carried out.

[0035] In order to further illustrate the technical means and effects adopted by the present application to achieve the predetermined object of the application, the specific embodiments, structures, features and effects according to the present application will be described in detail below in combination with the drawings and preferred embodiments.

[0036] Example 1 Interference of trim25 gene expression The implementation object of this embodiment is zebrafish embryo fibroblast PAC2 (purchased from Shanghai Jin Yuan Biology, cell source strain: zebrafish Danio rerio (Zebrafish) (Brachydanio rerio), NCBI Taxonomy: 7955) normally expressing the trim25 gene, which is used when the cells are in the third to tenth generation.

[0037] 1) Total RNA extraction and cDNA synthesis Total RNA extraction: The total RNA of PAC2 cells was extracted using a small amount of total RNA extraction kit (Jianshi Biology), and after lysis and washing of the PAC2 cells, the TRIzol lysis solution was used. According to the instructions of the kit, RNA was extracted and purified, and genomic DNA was removed, and the purity A260 / A280=2.01; cDNA synthesis: Using All-In-One 5x RT Master (Abm) reverse transcription, according to the reaction program of 37 °C for 15 min, 60 °C for 10 min, put into PCR instrument for reverse transcription, the obtained reaction solution can be directly used for subsequent PCR reaction. The reaction solution was divided and stored at -20 °C.

[0038] 2) Detection of cDNA template The above cDNA was used as a template to perform PCR amplification with zebrafish β actin specific primers as internal reference primers to detect whether the template could be used in the subsequent experiment. The obtained product was subjected to agarose gel electrophoresis to detect the cDNA template. The obtained fragment size was correct, and the band was single, without mixed band and dispersion, proving that the obtained cDNA could be used in the subsequent experiment.

[0039] 3) trim25 gene detection The full-length of trim25 gene is 1965 bp (NCBI accession number NM_200175.1), and specific primers P1 / P2 were designed using Primer6.0 to detect the expression of trim25 gene in PAC2 cells, and the fragment size was expected to be 854 bp (169~1022 of the full-length sequence of trim25 gene). Primer P1: CGAATGGCGTTCAGCAGTAA (SEQ ID No. 2); primer P2: ACAGCAGAGGAGTGGTAAGC (SEQ ID No. 3).

[0040] SEQ ID No. 1 trim25 gene encoded protein: MAEQMSLLGLEDELTCSICLCLFDNPVSLICGHSFCANCLEETWKDKISSLFCPHCRMAFSSKPELKKNTVLGAVLDAYRVKAGISEPVKNPVEEKKKDPDAIKCDSCMEAKAVKTCLTCMASYCEGHVRPHRENAIFRAHQLCDPLPDLMERLCSDHGKLMEFYCIQHQSCICSTCLQYIHKGCEFITADERRFKQKTDLTDKLNMIEGKMDKNEQVITQMKEQQNKLKDLAATRKRILEAEYSQIREMIDRDEKEAMLAIDKEQERGQSKLVSLMKKFNENIEKMERTKCEINSLLDQSQSLTFLKASIDLPSVINFEPYNPRMNLDSKEVIAYHSSAVALKEWITKLMEQSTENRISVLKPEFEKSVLGTGYQSPGILGGTPAFLPNPRDMSYMRPPCSSKPKVLPSKKKNPDRRDTKEKPNRSKNPTQGINPVFSKSMDNLNELRPKTVDIIDINQPASSSAVQNVKRSDLLKYGTILHFDVRTAHKRISLSENNTKATVSDDPANYPEIPHRFSVCSQVLCTKGFSQGRHYWEIKMSSNNFCGLGLAYGKIDRKGPSSRLGRNAESWCVEWFNVKLSAWHNSFETVLENPNPSRVGILLDCDQGSATFYNVQDRAYPFHTFVFPFTEAVYPAFWIFSNGSSVSLCKLNN.

[0041] PCR amplification was performed using the above cDNA as template. After the reaction, a small amount of PCR product was subjected to agarose gel electrophoresis. The size of the obtained fragment was consistent with the expected value. The sequencing was performed by a company. The sequencing result was consistent with the sequence of the trim25 gene fragment, and the sequencing result is shown in SEQ ID No. 4.

[0042] SEQ ID No. 4: TGTGGTAGACTGTCCTCGGCGCGGTGCTGGATGCCTATAGAGTAAAAGCGGGCATTTCGGAACCTGTCAAGAATCCAGTTGAAGAGAAAAAGAAGGATCCAGATGCGATTAAATGTGACAGCTGTATGGAAGCCAAAGCGGTCAAAACTTGTCTGACGTGTATGGCGTCCTATTGTGAAGATCATGTGAGGCCTCACCGAGAGAATGCCATTTTCCGGGCGCATCAACTTTGTGATCCGCTGCCAGATCTAATGGAGCGTCTCTGTTCCGATCATGGCAAACTGATGGAGTTCTACTGCATTCAGCACCAGAGCTGCATCTGCAGCACCTGTCTTCAGTACATTCACAAGGGCTGTGAGTTCATCACCACAGATGAGCGGCGCTTCAAACAAAAGACTGATCTGACTGACAAGCTAAACATGATTGAAGGCAAAATGGACAAGAATGAACAGGTTATCACACAGATGAAGGAGCAGCAAAATAAATTAAAGGATCTAGCTGCCACCCGAAAGCGCATTCTTGAGGCAGAATATAGCCAGATCAGAGAAATGATCGACAGAGATGAAAAAGAGGCCATGCTGGCAATTGATAAGGAACAAGAGAGAGGTCAGAGCAAACTTGTCTCCTTGATGAAGAAGTTTAATGAGAATATTGAGAAGATGGAAAGGACCAAGTGTGAGATCAACAGTCTGCTGGACCAGTCGCAATCACTCACATTTTTAAAGGCCTCCATAGATTTGCCCTCAGTGATAAATTTTGAGCCCTATAACCCACGCATGAATTTGGACAGTAAAGAGGTGATCGCTTACCACCCTTCTCGGGCTGGTA.

[0043] 4) siRNA design and synthesis According to the sequence of zebrafish trim25 gene (NM_200175.1), three 21-nt siRNAs were designed (Table 1) with dTdT overhang at 3' end, synthesized by Shengong Bioengineering (Shanghai) Co., Ltd., HPLC purity ≥95%, RNase-free lyophilized powder, stored at -80 °C.

[0044] Table 1 trim25 gene interference fragments .

[0045] 5) PAC2 cell recovery, culture, and passage The experimental cells are PAC2 zebrafish embryonic fibroblast cell lines, which are cultured in Leibovitz's L-15 medium + 10% FBS + 1% double antibody at 28°C, without CO2, and with a humidity of 70-80%. The PAC2 cells are purchased from Shanghai Cell Bank (Jinyuan Biotechnology). The cell freezing tube is quickly shaken in a water bath at 28°C until it is completely melted, then transferred to a culture dish containing culture medium and cultured for 3-4 hours. The cell growth state is observed. The cells are cultured and passaged to the third generation, and then plated for subsequent experiments after the fourth generation.

[0046] 6) siRNA transfection First, 1.25 μL of Hieff Trans® LipoBooster 3000 Transfection Reagent (Yeasen) is added to 25 μL of Opti-MEM medium and mixed. Next, 2.5 μL of siRNA (Shengong Bio, 20 μM) is pre-mixed with 25 μL of Opti-MEM medium and added to the LipoBooster 3000 pre-mixed solution and incubated for 10-15 min. A negative control (NC) with no homology to the target gene sequence is set up, which has no interference effect on trim25. After incubation, the mixture is added to a 24-well plate with fresh L15 complete medium for transfection. After 24 h of incubation at 28°C, the medium is changed and the cells are cultured for another 24-48 h. The total RNA is extracted and the procedure in step 1 is followed.

[0047] 7) Real-time PCR technology for detecting trim25 gene expression after interference All qRT-PCR experiments in this application use β actin as an internal reference, and the primer pair is P3 / P4. According to the gene sequence, qRT-PCR experimental primers P5 / P6 are designed on Primer 6 software. The primer pair P5 / P6 is used for trim25 gene detection, and the fragment size is 134 bp.

[0048] According to the TB Green ® Premix Ex Taq TM II (Takara) kit to prepare the mixed system, and three parallel samples are set up for each experiment.

[0049] Table 2 Semi-quantitative expression of zebrafish trim25 gene and qRT-PCR primers .

[0050] Data analysis: The calculation method of the relative expression of genes is 2 -ΔΔCt . The results were analyzed by one-way ANOVA using GraphPad Prism 9.0.0 software to determine the differences in gene expression. The results are expressed as mean ± SD, and p<0.05 is considered to be significantly different. The significance level is set to * p<0.05, ** p<0.01, *** p<0.001 and **** p<0.0001, and "ns" indicates no significant difference.

[0051] By Figure 1 and Figure 2 It can be seen that zebrafish PAC2 cells express trim25 gene, and after siRNA interference for 48~72 h, it is found by semi-quantitative and qRT-PCR detection that the inhibition rate of target gene is 20~40%, which significantly reduces the expression of trim25.

[0052] Example 2 Exogenous nucleic acid transfection PAC2 cell recovery, subculture and culture The experimental reference example 1, 96-well plate is set with 3 parallel samples in each group, and the reagents and amounts of each group are the optimal amounts after exploration. siRNA transfection of fish cells to inhibit the expression of trim25 gene refers to the step 6) of reference example 1, 5 μL of Opti-MEM medium is added with lipBooster 3000 in an amount of 0.25 μL, and 5 μL of Opti-MEM medium is added with siRNA in an amount of 0.5 μL siRNA (20 μM).

[0053] After 48 h of interference, eGFP was transfected using Hieff Trans® Liposomal 2000 Transfection Reagent liposome nucleic acid transfection reagent and Hieff Trans® mRNA Transfection Reagent mRNA transfection reagent, respectively.

[0054] a) Lip2000 transfection: 0.5 μL Lipofectamine 2000 was added to 25 μL Opti-MEM medium and incubated for 5 min; 0.5 μg Cap1-m1Ψ-eGFP mRNA (Cap1-m1Ψ-eGFP mRNA was purchased from Jinshui Bio, Cap1 structure capping, N1-m1Ψ modification, concentration 1 mg / mL, Buffer 1 mM Sodium citrate, pH 6.5, mRNA full length 1007 nt) or peGFP-N1 plasmid (purchased from Youbao Bio) was added to 25 μL Opti-MEM medium and incubated for 5 min; the liquids of the previous two steps were mixed and incubated for 20 min. After incubation, transfection was performed in a 96-well plate (96-well plates containing PAC2 cells that had been inhibited trim25 gene after transfection of siRNA for 48 h), and the liquid was changed after 24 h. eGFP expression was observed 36-48 h after transfection. PAC2 cells were transfected with non-targeting siRNA, and a negative control (NC) was set up with no homology of the target gene sequence, which had no interference effect on trim25.

[0055] b) mRNA transfection reagent transfection: 0.25 μL mRNA transfection reagent was added to 5 μL Opti-MEM medium and incubated for 5 min; 0.5 μg Cap1-m1Ψ-eGFP mRNA was added to 5 μL Opti-MEM medium and incubated for 5 min; the liquids of the previous two steps were mixed and incubated for 20 min. After incubation, transfection was performed in a 96-well plate, and the liquid was changed after 24 h. eGFP expression was observed 36-48 h after transfection.

[0056] Detection and statistics: Exogenous gene expression was detected by fluorescence microscopy 24-48 h after transfection, and the transfection efficiency was calculated as the number of fluorescent cells / total cell number. Image J software was used for counting and statistics, and three sets of repeats were set. The results were analyzed by one-way ANOVA using GraphPad Prism 9.0.0 software to determine the differences. The results are expressed as mean ± SD, and p<0.05 is considered to be significantly different. The significance level is set as * p<0.05, ** p<0.01, *** p<0.001, and **** p<0.0001, and "ns" indicates no significant difference.

[0057] Table 3 Transfection efficiency of exogenous gene (eGFP) .

[0058] As shown in Table 3, the positive cell rate was increased by 2.5-3.5 times after transfection of Cap1-m1Ψ-eGFP mRNA by mRNA transfection reagent; the positive cell rate was increased by 3.8-5 times after transfection of RNA by liposome nucleic acid transfection reagent, and the positive cell rate was increased by 1.8-2.4 times after transfection of eGFP-N1. The addition of two kinds of transfection reagents had low cytotoxicity, and was determined to be qualified.

[0059] By Figure 3 , Figure 4 and Figure 5 It can be seen that the positive rate of plasmid DNA transfection is increased by 2.4 times after trim25 knockdown, and the positive cell of exogenous mRNA is increased by 5 times at most, and the highest transient expression of 81% is realized in PAC2 cells for the first time.

[0060] The above is only the preferred embodiment of the present application, and does not limit the present application in any form. Although the present application has been disclosed as above with the preferred embodiment, it is not intended to limit the present application. Any person skilled in the art can make some changes or modifications to the above disclosed technical content to obtain equivalent embodiments with equivalent changes, without departing from the technical solution of the present application. Any modification, equivalent change and modification of the above embodiments according to the technical essence of the present application are still within the scope of the technical solution of the present application.

Claims

1. Application of a protein encoded by a trim25 gene in improving transfection efficiency of fish cells; characterized in that: The amino acid sequence of the protein is shown as SEQ ID No.

1.

2. Use according to claim 1, characterized in that: The fish cell is a zebrafish (Danio rerio) cell.

3. Use according to claim 1, characterized in that: The zebrafish (Danio rerio) cell is a zebrafish embryo fibroblast cell PAC2.

4. Use according to claim 3, characterized in that: The fish cell is a zebrafish (Danio rerio) cell.

5. A method of improving transfection efficiency of fish cells, characterized by: The fish cell is a zebrafish (Danio rerio) cell.

6. The method of claim 5, wherein: The specific operation for knocking down the expression of the trim25 gene in the fish cell is as follows: designing an siRNA interference fragment targeting the trim25 gene, and transfecting the fish cell.

7. The method of claim 6, wherein: The siRNA is at least one of SEQ ID No. 5-7.

8. The method of claim 5, wherein: The trim25 gene has a nucleotide sequence shown as NCBI No. NM_200175.

1.

9. A method for transfecting a foreign gene into a fish cell, characterized by: The method comprises the following steps: knocking down the expression of the trim25 gene in the fish cell to obtain a trim25 gene low-expression cell; and transfecting an exogenous nucleic acid into the trim25 gene low-expression cell.

10. The method of claim 9, wherein: The exogenous nucleic acid is transfected into the trim25 gene low-expression cell by using a liposome nucleic acid transfection method or an mRNA transfection method.

Images