Gene marker group, primer, kit and application of gene marker group, primer and kit in detection of echinococcosis
By combining genomic biomarkers and multiplex detection primers, the accuracy and cost issues of echinococcosis detection have been resolved, enabling low-cost, rapid, and accurate echinococcosis detection and typing, which is suitable for industrial applications.
Patent Information
- Application Number
- CN202410990195.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-23
- Publication Date
- 2026-01-23
AI Technical Summary
Existing methods for detecting echinococcosis suffer from inaccurate diagnosis, high costs, and low detection rates, especially in early infections and low initial sample volumes.
By employing a genomic biomarker and multiplex detection primers, short nucleic acid fragments were designed based on the high-copy region of the Echinococcus tapeworm mitochondrial genome. Multiplex PCR amplification and high-throughput sequencing were performed, and nested PCR technology was used to increase detection specificity and accuracy while reducing the risk of nonspecific amplification.
It enables low-cost, rapid, and accurate detection and typing of echinococcosis, improves detection sensitivity and specificity, and reduces sequencing costs and time, making it suitable for industrial applications.
Smart Images

Figure CN121380353A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biotechnology, and in particular, the present application relates to a gene marker group, primers, kits and their application in detection of echinococcosis. BACKGROUND
[0002] According to the WHO report, cystic echinococcosis (E. granulosus, Eg) is widely distributed in all continents (except Antarctica), and alveolar echinococcosis (E. multilocularis, Em) is only found in the Northern Hemisphere. In the epidemic area, the human incidence of cystic echinococcosis can exceed 50 cases per 100,000 people per year, and the prevalence rate can reach 5-10% in some areas of Argentina, Peru, eastern Africa, Central Asia and China. In livestock, the prevalence of cystic echinococcosis in slaughterhouses in high-prevalence areas of South America is 20-95% of slaughtered livestock. It is estimated that there are about one million people infected with cystic echinococcosis worldwide, and in addition, about 20,000 new alveolar echinococcosis patients are added every year.
[0003] As a high-incidence country of echinococcosis, our country is mainly cystic echinococcosis, and currently 21 provinces (cities, districts) have reported primary human and livestock echinococcosis and cystic echinococcosis infection in domestic and pastoral dogs. The epidemic area is mainly distributed in the pastoral and farming-pastoral areas of the west, north and northwest, and is most serious in Tibet, Qinghai, Sichuan, Xinjiang, Gansu, Ningxia, Inner Mongolia and Yunnan provinces (autonomous regions). In addition, alveolar echinococcosis mainly prevails in some areas of Tibet, Qinghai, Sichuan, Ningxia, Gansu, Xinjiang, and the incidence of alveolar echinococcosis in some areas is higher than that of cystic echinococcosis. These echinococcosis high-prevalence areas are relatively economically backward, and combined with poor transportation and weak primary medical system, the social and economic burden of echinococcosis is heavy, which is an important factor for the local people to become poor due to illness. WHO proposed that "early detection of E. granulosus and E. multilocularis infection is still needed to help select clinical treatment options, especially in low-resource settings." Therefore, it is urgent to develop new technologies and methods for early and accurate screening of echinococcosis.
[0004] Currently, the diagnosis of echinococcosis mainly relies on imaging. However, imaging can only be used for differential diagnosis after the infected eggs have developed into large space-occupying lesions in the liver. Therefore, some researchers are pinning their hopes on liquid biopsy techniques, especially cell-free nucleic acid (CFNA) technology, which is widely used in oncology and prenatal diagnosis. Although a 2016 review concluded that CFNA technology is not suitable for the diagnosis of echinococcosis, high-depth sequencing of CFNA in the plasma of echinococcosis patients revealed that, with sufficient sequencing volume, CFNA of Echinococcus granulosus could be detected in the plasma of all patients, and the concentration and fragment length of CFNA in the same patient differed before and after treatment. This demonstrates the value of high-throughput sequencing in the auxiliary diagnosis and efficacy monitoring of echinococcosis. However, due to the low concentration of Echinococcus granulosus cfDNA in plasma, direct high-throughput sequencing requires at least 40GB of data, resulting in high costs. Although early studies attempted to use the relatively inexpensive PCR method to assist in the diagnosis of echinococcosis, the results were unsatisfactory, with a detection sensitivity of approximately 20%. The only urine sample study achieved a sensitivity of 75%, but the sample size was small (12 patients), and no replication experiments have been observed, limiting its reliability. The low detection efficiency of early PCR methods may be due to several reasons, such as a limited number of target sites and the design of long target fragments.
[0005] Therefore, the detection methods for echinococcosis still need improvement. Summary of the Invention
[0006] This application is made by the inventor based on the discovery of the following problems and facts:
[0007] Currently, the detection of echinococcosis faces many challenges, and existing detection methods have a series of shortcomings:
[0008] 1) Although imaging technology is one of the commonly used diagnostic methods, differential diagnosis is still difficult for small cysts of early infection less than 2 cm, which affects the accuracy and timeliness of diagnosis;
[0009] 2) Immunological diagnostic methods mainly rely on antibody detection. However, their sensitivity and specificity are unstable and easily affected by other pathogens. Furthermore, antibodies may still be present after surgical treatment, which affects the accuracy and reliability of the diagnostic results.
[0010] 3) Some studies have proposed detection schemes based on qPCR and conventional high-throughput sequencing, but due to the limited number of targets or the influence of background noise in the host genome, their detection rates are generally low and fail to meet the requirements for efficient and accurate detection of echinococcosis.
[0011] 4) Currently, clinically used serological test kits for echinococcosis typically use echinococcosis cyst fluid as the antigen, but there are significant differences between different batches, and the process of extracting and preparing the antigen is time-consuming and laborious.
[0012] This application aims to address at least one of the technical problems existing in the prior art. To this end, this application provides a stable, accurate, and low-cost method for detecting echinococcosis.
[0013] Another objective of this application is to provide a reliable method for typing and detecting Echinococcus tapeworm.
[0014] Specifically, this application provides the following technical solution:
[0015] In one aspect of this application, a set of gene biomarkers is proposed. According to embodiments of this application, the set of gene biomarkers includes: (c1) AB786664.1_252~295, (c2) AB786664.1_286~326, (c3) AB786664.1_439~473, (c4) AB786664.1_620~657, (c5) AB786664.1_743~775, (c6) AB786664.1_883~926, (c7) AB786664.1_1008~1047, (c8) AB786664.1_1028~1078, (c9) AB786664.1_1167~1199, (c10) AB786 664.1_1288~1320, (c11)AB786664.1_1306~1351, (c12)AB786664.1_147 0~1504, (c13)AB786664.1_1560~1598, (c14)AB786664.1_1686~1725, (c 15)AB786664.1_1956~1999, (c16)AB786664.1_2318~2359, (c17)AB7866 64.1_2410~2450, (c18)AB786664.1_2564~2601, (c19)AB786664.1_2590 ~2632, (c20)AB786664.1_2721~2753, (c21)AB786664.1_2931~2973, (c2 2)AB786664.1_2970~3005, (c23)AB786664.1_3173~3216, (c24)AB78666 4.1_3384~3421, (c25)AB786664.1_3420~3457, (c26)AB786664.1_3545~ 3580, (c27)AB786664.1_3577~3611, (c28)AB786664.1_3696~3732, (c29 )AB786664.1_3847~3885, (c30)AB786664.1_3871~3916, (c31)AB786664 .1_3994~4037, (c32)AB786664.1_4032~4068, (c33)AB786664.1_4277~4 309, (c34)AB786664.1_4396~4430, (c35)AB786664.1_4576~4611, (c36) AB786664.1_4909~4942, (c37)AB786664.1_5058~5093, (c38)AB786664.1_5092~5131,(c39)AB786664.1_5190~5229,(c40)AB786664.1_5222~5267,(c41)AB786664.1_5316~5358,(c42)AB786664.1_5350~5389,(c43)AB786664.1_5563~5597,(c44)AB786664.1_5686~5719,(c45)AB786664.1_5718~5756,(c46)AB786664.1_5894~5934,(c47)AB786664.1_6043~6085,(c48)AB786664.1_6084~6116,(c49)AB786664.1_6260~6297,(c50)AB786664.1_6594~6628,(c51)AB786664.1_6622~6659,(c52)AB786664.1_6718~6750,(c53)AB786664.1_6748~6781,(c54)AB786664.1_6870~6902,(c55)AB786664.1_6960~6993,(c56)AB786664.1_7172~7217,(c57)AB786664.1_7329~7368,(c58)AB786664.1_7487~7527,(c59)AB786664.1_7646~7678,(c60)AB786664.1_7727~7771,(c61)AB786664.1_7765~7807,(c62)AB786664.1_8046~8083,(c63)AB786664.1_8082~8114,(c64)AB786664.1_8197~8242,(c65)AB786664.1_8360~8392,(c66)AB786664.1_8383~8423,(c67)AB786664.1_8511~8540,(c68)AB786664.1_8687~8729,(c69)AB786664.1_8971~9007,(c70)AB786664.1_9064~9097,(c71)AB786664.1_9096~9128,(c72)AB786664.1_9361~9398,(c73)AB786664.1_9386~9429,(c74)AB786664.1_9514~9551,(c75)AB786664.1_9669~9709,(c76)AB786664.1_9789~9830,(c77)AB786664.1_9820~9861,(c78)AB786664.1_9946~9982,(c79)AB786664.1_10065~10108,(c80)AB786664.1_10262~10301,(c81)AB786664.1_10295~10332,(c82)AB786664.1_10390~10423,(c83)AB786664.1_10418~10456,(c84)AB786664.1_10560~10604,(c85)AB786664.1_10857~10894,(c86)AB786664.1_10886~10925,(c87)AB786664.1_11157~11189,(c88)AB786664.1_11308~11340,(c89)AB786664.1_11398~11429,(c90)AB786664.1_11480~11520,(c91)AB786664.1_11566~11610,(c92)AB786664.1_11725~11755,(c93)AB786664.1_11895~11932,(c94)AB786664.1_11919~11963,(c95)AB786664.1_12073~12113,(c96)AB786664.1_12201~12234,(c97)AB786664.1_12323~12354,(c98)AB786664.1_12413~12457,(c99)AB786664.1_12529~12576,(c100)AB786664.1_12575~12607,(c101)AB786664.1_12683~12728,(c102)AB786664.1_12723~12759,(c103)AB786664.1_12845~12884,(c104)AB786664.1_12875~12915,(c105)AB786664.1_12973~13006,(c106)AB786664.1_13302~13336,(c107)AB786664.1_13453~13487,(c108)AB786664.1_13485~13519,(c109)AB018440.2_381~421,(c110)AB018440.2_540~573,(c111)AB018440.2_720~754,(c112)AB018440.2_846~878,(c113)AB018440.2_989~1029,(c114)AB018440.2_1111~1150,(c115)AB018440.2_1133~1181,(c116)AB018440.2_1270~1302,(c117)AB018440.2_1391~1423,(c118)AB018440.2_1412~1453,(c119)AB018440.2_1573~1607,(c120)AB018440.2_1663~1700,(c121)AB018440.2_1795~1820,(c122)AB018440.2_2059~2095,(c123)AB018440.2_2415~2456,(c124)AB018440.2_2507~2547,(c125)AB018440.2_2661~2698,(c126)AB018440.2_2687~2729,(c127)AB018440.2_2818~2850,(c128)AB018440.2_3028~3070,(c129)AB018440.2_3069~3105,(c130)AB018440.2_3277~3316,(c131)AB018440.2_3484~3521,(c132)AB018440.2_3519~3557,(c133)AB018440.2_3645~3680,(c134)AB018440.2_3681~3708,(c135)AB018440.2_3797~3827,(c136)AB018440.2_3947~3985,(c137)AB018440.2_3971~4014,(c138)AB018440.2_4094~4134,(c139)AB018440.2_4374~4406,(c140)AB018440.2_4493~4525,(c141)AB018440.2_4673~4706,(c142)AB018440.2_5006~5039,(c143)AB018440.2_5155~5188,(c144)AB018440.2_5189~5232,(c145)AB018440.2_5287~5326,(c146)AB018440.2_5319~5364,(c147)AB018440.2_5418~5454,(c148)AB018440.2_5451~5484,(c149)AB018440.2_5663~5694,(c150)AB018440.2_5817~5854,(c151)AB018440.2_5995~6034,(c152)AB018440.2_6144~6186,(c153)AB018440.2_6185~6217,(c154)AB018440.2_6362~6396,(c155)AB018440.2_6694~6729,(c156)AB018440.2_6723~6760,(c157)AB018440.2_6819~6844,(c158)AB018440.2_6849~6882,(c159)AB018440.2_6973~7000,(c160)AB018440.2_7061~7094,(c161)AB018440.2_7274~7316,(c162)AB018440.2_7586~7624,(c163)AB018440.2_7743~7767,(c164)AB018440.2_7826~7866,(c165)AB018440.2_7862~7904,(c166)AB018440.2_8143~8180,(c167)AB018440.2_8179~8210,(c168)AB018440.2_8294~8336,(c169)AB018440.2_8460~8490,(c170)AB018440.2_8483~8520,(c171)AB018440.2_8792~8829,(c172)AB018440.2_9084~9118,(c173)AB018440.2_9207~9239,(c174)AB018440.2_9472~9509,(c175)AB018440.2_9495~9539,(c176)AB018440.2_9626~9661,(c177)AB018440.2_9780~9820,(c178)AB018440.2_9900~9941,(c179)AB018440.2_9931~9972,(c180)AB018440.2_10057~10093,(c181)AB018440.2_10180~10217,(c182)AB018440.2_10373~10407,(c183)AB018440.2_10406~10443,(c184)AB018440.2_10501~10534,(c185)AB018440.2_10529~10560,(c186)AB018440.2_10671~10714,(c187)AB018440.2_10971~11007,(c188)AB018440.2_11000~11036,(c189)AB018440.2_11275~11307,(c190)AB018440.2_11426~11458,(c191)AB018440.2_11685~11730,(c192)AB018440.2_11845~11876,(c193)AB018440.2_12019~12056,(c194)AB018440.2_12043~12087,(c195)AB018440.2_12197~12237,(c196)AB018440.2_12325~12358,(c197)AB018440.2_12449~12479,(c198)AB018440.2_12538~12582,(c199)AB018440.2_12654~12700,(c200)AB018440.2_12700~12733,(c201)AB018440.2_12808~12848,(c202)AB018440.2_12848~12878,(c203)AB018440.2_12970~13009,(c204)AB018440.2_12997~13040,(c205)AB018440.2_13098~13131,(c206)AB018440.2_13429~13463,(c207)AB018440.2_13580~13614,(c208)AB018440.2_13614~13646,(c209)AB786664.1_2049~2087,(c210)AB786664.1_1938~2296,(c211)pathogen_EMU_contig_0773_5425~5637,(c212)CM038617.1_337864~337985,(c213)JAIKUZ010000010.1_1996161~1996192,(c214)JAIKUZ010000014.1_4770453~4770643,(c215)CM038612.1_664221~664239, (c216)pathogen_EMU_contig_0157_10569~10592, (c217)pathogen_E MU_contig_0157_12687~12703,(c218)JAIKUZ010000023.1_36048~36081,(c219)pathoge n_EmW_scaffold_01_2995559~2995581,(c220)CM038614.1_200244~200269,(c221)path ogen_EMU_contig_0221_11060~11080, (c222)pathogen_EMU_contig_0157_8849~8886, (c 223)CM038616.1_15667405~15667437, (c224)CM038615.1_13640134~13640155, (c225)p athogen_EMU_contig_0221_2020~2036,(c226)CM038617.1_5902005~5902044,(c227)CM0 At least one of the following gene biomarkers: 38615.1_17402454~17402479, (c228)JAIKUZ010000010.1_1993076~1993160, (c229)CM038618.1_1993198~1993328, and (c230)pathogen_EmW_scaffold_04_1366252~1366286. The aforementioned set of gene biomarkers can be used to design multiplex primers for the detection of *Echinococcus granulosus*.
[0016] In some examples of this application, the above-mentioned set of genetic markers may also include at least one of the following technical features:
[0017] In some examples of this application, high-copy regions of the mitochondrial genome of Echinococcus tapeworm can also be screened to obtain other genetic markers.
[0018] In some examples of this application, the aforementioned gene biomarker set is selected from the mitochondrial genome region of Echinococcus tapeworm. Considering that the copy number of the mitochondrial genome is much higher than that of the nuclear genome, and thus has a higher nucleic acid template copy number, the inventors chose to design short nucleic acid fragment primers based on the mitochondrial genome region of Echinococcus tapeworm, which is beneficial for PCR amplification and detection, especially for the detection of low starting amount samples.
[0019] In a second aspect of this application, a primer is provided. According to embodiments of this application, the primer is used to amplify at least a portion of the nucleic acid sequence of any genetic marker of the first aspect. In some examples of this application, the aforementioned primer can be used for accurate, rapid, and low-cost detection of Echinococcus tapeworm.
[0020] In some examples of this application, primers designed for similar nucleic acid sequences of different types of Echinococcus tapeworms select nucleic acid regions with high similarity, such as not less than 95%, 96%, 97%, 98%, or 99%.
[0021] In some examples of this application, the length of the aforementioned Echinococcus tapeworm mitochondrial genome sequence is selected from 100bp to 150bp, and optionally 100bp, 101bp, 102bp, 103bp, 104bp, 105bp, 106bp, 107bp, 108bp, 109bp, 110bp, 111bp, 112bp, 113bp, 114bp, 115bp, 116bp, 117bp, 118bp, 119bp, 120bp, and 121bp. p, 122bp, 123bp, 124bp, 125bp, 126bp, 127bp, 128bp, 129bp, 130bp, 131bp, 132bp, 133bp, 134bp, 135bp, 136bp, 137bp, 138bp, 139bp, 140bp, 141bp, 142bp, 143bp, 144bp, 145bp, 146bp, 147bp, 148bp, 149bp, or 150bp. The aforementioned similar regions were obtained through sliding window analysis of the aforementioned mitochondrial genome sequences. In some examples of this application, the sliding window step size was selected as 100bp.
[0022] In some examples of this application, the aforementioned primers include external primers and / or internal primers. The external primers are used for the first round of PCR amplification, and the internal primers are used for the second round of PCR amplification; the template for the second round of PCR amplification is selected from the product of the first round of PCR amplification.
[0023] In some examples of this application, the aforementioned primers were designed based on short fragments of free nucleic acid from Echinococcus granulosus. The main purpose of selecting short fragments of free nucleic acid as primers is to improve the specificity and sensitivity of detection, reduce the risk of nonspecific amplification, and thus achieve accurate and reliable detection of Echinococcus granulosus nucleic acid.
[0024] The aforementioned internal primers, combined with other primer sequences, are used to achieve library sequencing and other detection functions. In some examples of this application, the aforementioned external primers are 15bp to 35bp in length, optionally 16bp, 17bp, 18bp, 19bp, 20bp, 21bp, 22bp, 23bp, 24bp, 25bp, 26bp, 27bp, 28bp, 29bp, 30bp, 31bp, 32bp, 33bp, 34bp, or 35bp.
[0025] In some examples of this application, the aforementioned internal primers are 36bp to 56bp in length, and optionally 36bp, 37bp, 38bp, 39bp, 40bp, 41bp, 42bp, 43bp, 44bp, 45bp, 46bp, 47bp, 48bp, 49bp, 50bp, 51bp, 52bp, 53bp, 54bp, 55bp, or 56bp.
[0026] In some examples of this application, the binding region of the aforementioned internal primer is within the nucleic acid fragment amplified by the aforementioned external primer.
[0027] In some examples of this application, the length of the designed target region sequence or the sequence formed by the target region sequence and the internal primer sequence is selected from 50bp to 90bp, and optionally 50bp, 51bp, 52bp, 53bp, 54bp, 55bp, 56bp, 57bp, 58bp, 59bp, 60bp, 61bp, 62bp, 63bp, 64bp, 65bp, 66bp, 67bp, 68bp, 69bp, 70bp, 71bp, 72bp, 73bp, 74bp, 75bp, 76bp, 77bp, 78bp, 79bp, 80bp, 81bp, 82bp, 83bp, 84bp, 85bp, 86bp, 87bp, 88bp, 89bp, or 90bp.
[0028] In some examples of this application, the aforementioned internal upstream primer contains a 5' phosphorylation modification to adapt to BGI's proprietary DNBSEQ platform. Different modifications / unmodifications can also be applied depending on other sequencing platforms.
[0029] In some examples of this application, the aforementioned internal primers include at least one of UMI sequences, fixed recognition sequences, complementary circular sequences, and nucleotide chain sequencing primer binding sequences.
[0030] In some examples of this application, the binding region of the inner primer is within the nucleic acid fragment amplified by the outer primer.
[0031] In some examples of this application, some (target) primers have nucleotide sequences as shown in SEQ ID NO:1-2. It is understood that, based on the target of the first aspect, those skilled in the art are free to design primers targeting that target, and due to space limitations, not all sequences are listed herein.
[0032] GTTGATTGTTGCGTGTGATGT (PCR primer pool 1, forward primer for amplification region; SEQ ID NO:1).
[0033] ACCTGTCTTGTTAATAAAAACAACCA (PCR primer pool 1, amplification region reverse primer; SEQ ID NO:2).
[0034] In a third aspect of this application, the use of the primers of the second aspect in the preparation of a kit for the diagnosis of echinococcosis is proposed. In some examples of this application, kits prepared based on the aforementioned primers enable rapid, accurate, and portable diagnosis of echinococcosis.
[0035] In a fourth aspect of this application, the primers of the second aspect are proposed for use in the preparation of a kit for identifying echinococcosis subtypes. In some examples of this application, kits prepared based on the aforementioned primers can accurately distinguish echinococcosis subtypes, and the operation is simple, convenient, quick, and cost-effective, making them suitable for industrial applications.
[0036] In some examples of this application, the above-described uses may also include at least one of the following technical features:
[0037] In some examples of this application, the aforementioned classification includes Eg type and Em type.
[0038] In a fifth aspect of this application, a reagent kit is provided. According to an embodiment of this application, the reagent kit includes primers from the second aspect. The aforementioned reagent kit can be used for rapid, accurate, and portable diagnosis of echinococcosis and for differentiating echinococcosis subtypes.
[0039] In some examples of this application, the above-described reagent kit may also include at least one of the following technical features:
[0040] In some examples of this application, the aforementioned kit further includes at least one of the following: external reference primers, internal reference primers, nucleic acid extraction reagents, library preparation reagents, and high-throughput sequencing reagents. Based on the aforementioned reagent components, multiplex PCR and high-throughput sequencing nucleic acid detection of the test samples can be achieved, offering advantages such as ease of operation, low cost, and high timeliness.
[0041] In some examples of this application, the aforementioned test sample is selected from bodily fluid samples or pretreated samples.
[0042] In some examples of this application, the external reference primer is selected from Lambda DNA primers.
[0043] In some examples of this application, the internal reference primers are selected from human housekeeping gene primers and / or mitochondrial primers.
[0044] In some examples of this application, the library construction reagents include PCR amplification reagents.
[0045] In some examples of this application, the PCR amplification reagent includes at least one of PCR amplification enzyme, PCR cleaning enzyme, PCR additive, and double-tagged primers. The PCR cleaning enzyme is used to remove specific nucleotides and eliminate PCR amplification product contamination that may have been introduced from the previous experiment; the PCR additive is a special nucleotide incorporated into ordinary nucleotides that can be specifically recognized and removed by the PCR cleaning enzyme; the double-tagged primers are used to specifically identify a single sample and the sequencing nucleotide sequence generated from that single sample.
[0046] In some examples of this application, the aforementioned PCR amplification enzymes include enzymes with the function of adapting to multiplex primer amplification; and enzymes with the ability to recognize specific types, labels, or modified nucleotides. The amplification enzymes may or may not have hot-start properties. It is understood that the aforementioned amplification enzymes may also include at least one of enzyme buffers or universal PCR reaction buffers.
[0047] In some specific examples of this application, the aforementioned PCR amplification enzymes include: Jupiter rTaq Multiplex 2XMaster Mix and BGI LS-EZ-K-00003O.
[0048] In a sixth aspect of this application, a method for preparing a sequencing library is proposed. According to embodiments of this application, the method includes: performing a first amplification treatment on a nucleic acid template using a kit from the fifth aspect; and performing a second amplification treatment on the product of the first amplification treatment based on tag primers to obtain the aforementioned sequencing library. In some examples of this application, the aforementioned sequencing library preparation method utilizes nested PCR technology to increase the specificity and accuracy of detection, ensuring optimal library construction and detection results.
[0049] In some examples of this application, the above-described sequencing library preparation method may further include at least one of the following technical features:
[0050] In some examples of this application, the aforementioned first amplification process includes: amplifying a nucleic acid template using external primers to obtain a first amplification product.
[0051] In some examples of this application, the aforementioned first amplification process is performed in a first amplification process system in which the concentration of the PCR amplification enzyme is 4 U / μL-6 U / μL, optionally 4 U / μL, 5 U / μL, or 6 U / μL. In a preferred example of this application, the concentration of the PCR amplification enzyme is 5 U / μL.
[0052] In some examples of this application, the concentration of PCR cleaning enzyme in the aforementioned first amplification treatment system is 0.8 U / μL-1.2 U / μL, optionally 0.8 U / μL, 0.9 U / μL, 1.0 U / μL, 1.1 U / μL, or 1.2 U / μL. In a preferred example of this application, the concentration of PCR cleaning enzyme is 1 U / μL.
[0053] In some examples of this application, the concentration of the external primers in the aforementioned first amplification processing system is 0.15–0.2 μM. In some examples of this application, multiple primers are pre-mixed to facilitate amplification using a single-tube method.
[0054] In some examples of this application, the aforementioned first amplification process is as follows:
[0055] 37℃, 3min~8min, 1 cycle;
[0056] 95℃, 8 min~12 min, 1 cycle;
[0057] 95℃, 10s~20s, 64℃, 1min, 60℃, 1min, 72℃, 20s~1min, cycle number 10~15.
[0058] In some preferred embodiments of this application, the aforementioned first amplification process is as follows:
[0059] 37℃, 5 min, 1 cycle;
[0060] 95℃, 10min, 1 cycle;
[0061] 95℃, 15s, 64℃, 1min, 60℃, 1min, 72℃, 30s, cycle number 13.
[0062] In some examples of this application, the aforementioned second amplification process includes: performing a third amplification process on the product of the aforementioned first amplification process using internal primers; and performing a fourth amplification process on the product of the third amplification process using tag primers to obtain the aforementioned sequencing library.
[0063] In some examples of this application, the aforementioned third amplification process is performed in a third amplification process system, in which the concentration of the PCR amplification enzyme is 4 U / μL-6 U / μL, optionally 4 U / μL, 5 U / μL, or 6 U / μL. In a preferred example of this application, the concentration of the PCR amplification enzyme is 5 U / μL;
[0064] In some examples of this application, in the aforementioned third amplification treatment system, the concentration of the aforementioned PCR cleaning enzyme is 0.8 U / μL-1.2 U / μL, optionally 0.8 U / μL, 0.9 U / μL, 1.0 U / μL, 1.1 U / μL, or 1.2 U / μL. In a preferred example of this application, the concentration of the PCR cleaning enzyme is 1 U / μL.
[0065] In some examples of this application, in the aforementioned third amplification processing system, the concentration of the primers for amplifying the intermediate nucleic acid sequence of the aforementioned gene marker is 0.08 μM-0.15 μM, optionally 0.08 μM, 0.09 μM, 0.1 μM, 0.11 μM, or 0.12 μM. In a preferred example of this application, the concentration of the primers for amplifying the intermediate nucleic acid sequence of the aforementioned gene marker is 0.1 μM.
[0066] In some examples of this application, the aforementioned fourth amplification process is performed in a fourth amplification process system, in which the concentration of the aforementioned tag primer is 3-7 μM, optionally 3 μM, 4 μM, 5 μM, 6 μM or 7 μM. In a preferred example of this application, the concentration of the aforementioned tag primer is 5 μM.
[0067] In some examples of this application, the aforementioned second amplification process is as follows:
[0068] 37℃, 3min~8min, 1 cycle;
[0069] 95℃, 8 min~12 min, 1 cycle;
[0070] 95℃, 10s~20s, 64℃, 1min, 60℃, 1min, 72℃, 20s~1min, number of cycles 20~25.
[0071] In some preferred embodiments of this application, the aforementioned second amplification process is as follows:
[0072] 37℃, 5 min, 1 cycle;
[0073] 95℃, 10min, 1 cycle;
[0074] 95℃, 15s, 64℃, 1min, 60℃, 1min, 72℃, 30s, cycle number 22.
[0075] In a seventh aspect, this application proposes a sequencing data analysis method. According to an embodiment of this application, the method includes: obtaining a sequencing library using the method described in the sixth aspect; performing sequencing processing on the sequencing library to obtain sequencing data; and analyzing the sequencing data based on the difference between the proportion of reads from the test sample and the proportion of reads from the negative control in the sequencing data. According to an embodiment of this application, the aforementioned analysis method can effectively achieve the identification and typing of echinococcosis in the test sample.
[0076] In some examples of this application, the above-described analytical method may also include at least one of the following technical features:
[0077] In some examples of this application, the aforementioned analytical processing includes: in the aforementioned sequencing data, if the proportion of *Echinococcus granulosus* reads in the test sample is not less than 4-10 times that of the aforementioned negative control *Echinococcus granulosus* reads, then the test sample is a positive sample. In some specific examples of this application, in the aforementioned sequencing data, if the proportion of *Echinococcus granulosus* reads in the test sample is not less than 10 times that of the aforementioned negative control *Echinococcus granulosus* reads, then the test sample is a positive sample.
[0078] For example, in the sequencing data after quality control, if the proportion of Echinococcus granulosus reads in the sequencing reads of the test sample is ≥ 10 times the proportion of Echinococcus granulosus reads in the sequencing reads of the negative control group of the same batch, then the test sample is a positive sample, and the others are considered as not detected (negative results).
[0079] In some examples of this application, after learning that the sample to be tested is a positive sample, the aforementioned analysis further includes: obtaining reference sequences of Echinococcus var. Em and Eg; comparing the sequencing reads of the positive sample with the reference sequences of the Em and Eg types respectively to determine the proportion of the Em and Eg types in the positive sample; and determining the Echinococcus var. type of the positive sample based on the aforementioned proportion differences.
[0080] In some examples of this application, the determination of the Echinococcus type of the positive sample based on the aforementioned proportional difference includes: if the proportion of the aforementioned Em type sequencing reads in the positive sample is not less than 95%, then the positive sample is of type Em; if the proportion of the aforementioned Eg type sequencing reads in the positive sample is not less than 95%, then the positive sample is of type Eg.
[0081] In a specific example of this application, when the genome copy number of a *Echinococcus granulosus* nucleic acid sample is as low as 0.05, two million raw sequencing reads for a single sample can reach the positive detection limit, and the entire process from sample processing to output of test results can be completed within 24 hours.
[0082] Furthermore, this method is also applicable to the detection of other types of samples, is compatible with high-throughput sequencing detection of various instrument types, has low data throughput requirements, low site requirements, high detection sensitivity, and can be quickly deployed according to the combination of software / instrument. The experimental procedure is simple, the time cycle is short, and the reagent cost is low.
[0083] Beneficial effects
[0084] On the one hand, the technical solution of this application adopts a multiplex target (genetic marker) nucleic acid detection method, which can solve the problems of low detection rate and difficulty in distinguishing the types of Echinococcus tapeworms infecting patients in one go. Compared with single-target detection, multiplex target detection can improve the sensitivity and specificity of detection, and can distinguish different types of Echinococcus tapeworms, which helps to diagnose echinococcosis more accurately.
[0085] On the other hand, compared to direct sequencing methods, the technical solution in this application employs Echinococcus tapeworm target capture and amplification technology, which can effectively increase data utilization and avoid interference from host sequencing data, greatly reducing sequencing costs. This not only improves sequencing efficiency but also increases the accuracy and reliability of the data.
[0086] More importantly, this technical solution is simple and convenient to operate, effectively reducing manpower, material resources, and time costs, and has wide applicability. This makes it easier to promote and apply this technical solution in clinical practice, providing a more effective and convenient solution for the detection of echinococcosis.
[0087] Additional aspects and advantages of this application will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of this application. Attached Figure Description
[0088] The above and / or additional aspects and advantages of this application will become apparent and readily understood from the description of the embodiments taken in conjunction with the following drawings, in which:
[0089] Figure 1 This is a schematic diagram of the detection principle provided in the embodiments of this application;
[0090] Figure 2 The detection results of Echinococcus granulosus Eg-type sequencing reads provided in the embodiments of this application;
[0091] Figure 3 The detection results of Echinococcus tapeworm Em-type sequencing reads provided in the embodiments of this application;
[0092] Figure 4 This is a schematic diagram of the library preparation and detection process provided in the embodiments of this application. Detailed Implementation
[0093] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain this application, and should not be construed as limiting this application.
[0094] In this document, unless otherwise specified, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of indicated technical features. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. Furthermore, in the description of this invention, unless otherwise stated, "a plurality of" means two or more.
[0095] Unless otherwise specified herein, the terms "comprising" or "including" are open-ended expressions, meaning they include the contents specified in this invention but do not exclude other aspects.
[0096] Unless otherwise specified herein, the terms “optionally,” “optionally,” or “optionally” generally refer to an event or condition that may or may not occur as described below, and the description includes both cases in which the event or condition occurs and cases in which the event or condition does not occur.
[0097] Unless otherwise specified, high-throughput sequencing in this document refers to a parallel sequencing technology, including short-read and long-read high-throughput sequencing technologies. Sequencing platforms used for high-throughput sequencing include, but are not limited to, Illumina, MGI, Nanopore, and PacBio. In some examples of this application, DNBSEQ sequencing technology is used, including but not limited to, DNBSEQ-E25, DNBSEQ-G99, MGISEQ-2000, and DNBSEQ-T7 sequencing platforms.
[0098] Unless otherwise specified, the gene biomarker sequences in this article are obtained based on the reference sequences.
[0099] In this document, unless otherwise specified, a reference sequence is a determined sequence, which can be a pre-assembled DNA and / or RNA sequence determined by oneself, or a publicly available DNA and / or RNA sequence determined by others. It can be any reference template from the biological category to which the sample source individual / target individual belongs, for example, all or at least a portion of a publicly available genome assembly sequence from the same biological category. In some examples of this application, the reference sequences for Em and Eg types of Echinococcus tapeworms are from the NCBI database, including:
[0100] 1. Echinococcus multilocularis mitochondrial DNA, complete genome (GenBank: AB018440.2), https: / / www.ncbi.nlm.nih.gov / nuccore / AB018440;
[0101] 2. Echinococcus multilocularis (Submitted GenBank assembly GCA_000469725.3), https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCA_000469725.3 / ;
[0102] 3. Echinococcus granulosus mitochondrial DNA, complete genome, samplecode: 52LI07 (GenBank: AB786664.1), https: / / www.ncbi.nlm.nih.gov / nuccore / AB786664;
[0103] 4. Echinococcus granulosus (Submitted GenBank assembly GCA_021556725.1), https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCA_021556725.1 / .
[0104] The following will explain the solution of this application with reference to embodiments. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of this application. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.
[0105] Example 1: Enrichment, library preparation, and sequencing analysis of Echinococcus tapeworm nucleic acids
[0106] refer to Figure 1 The specific detection steps in this embodiment are as follows:
[0107] 1. Extraction and serial dilution template preparation of Echinococcus tapeworm culture
[0108] One *Echinococcus granulosus* worm and one *Echinococcus multilocularis* culture were used. The DNA samples were extracted and refluxed using the DNeasy Blood & Tissue Kit (QIAGEN, 69504) strictly following the instructions in the manual. 100 μL of elution buffer was used to rehydrate the extracted DNA samples, which were then aliquoted and frozen for later use.
[0109] Nucleic acid samples extracted from the two types of Echinococcus tapeworms were serially diluted, and the experiments were repeated three times. The specific procedures are as follows:
[0110] 1) Take out the DNA nucleic acid samples extracted from Eg (Table 2) and Em (Table 3);
[0111] 2) The samples were diluted 10-fold from 0.1 ng to seven different concentrations using nuclease-free water (untreated with DEPC, Invitrogen, AM9930): 0.1 ng, 0.01 ng, 0.001 ng, 0.0001 ng, 0.00001 ng, 0.000001 ng, and 0.0000001 ng. The genome copy number of the diluted samples was calculated based on the relationship between DNA quality, genome length, molar mass, and molar number. Additionally, TE buffer (Invitrogen, 12090015) was added as a blank control sample, representing a negative sample free of Echinococcus tapeworm nucleic acid.
[0112] 3) Prepare the corresponding human DNA standard and lambda phage external reference standard, and pre-mix the two references with PCR Primer Pool 1 to prepare a working solution for later use. The amount of lambda DNA added is 1000 copies per reaction, and the amount of human DNA standard added is 1 ng per reaction.
[0113] Table 2 Eg Samples
[0114] Sample ID - Replicate 1 Sample ID - Replicate 2 Sample ID - Replicate 3 Eg nucleic acid total (ng) Eg genome copy number Eg_1_1 Eg_2_1 Eg_3_1 0.1 500 Eg_1_2 Eg_2_2 Eg_3_2 0.01 50 Eg_1_3 Eg_2_3 Eg_3_3 0.001 5 Eg_1_4 Eg_2_4 Eg_3_4 0.0001 0.5 Eg_1_5 Eg_2_5 Eg_3_5 0.00001 0.05 Eg_1_6 Eg_2_6 Eg_3_6 0.000001 0.005 Eg_1_7 Eg_2_7 Eg_3_7 1E-07 0.0005 Eg_TE_1 Eg_TE_2 Eg_TE_3 0 0
[0115] Table 3 Em Sample
[0116] Sample ID - Replicate 1 Sample ID - Replicate 2 Sample ID - Replicate 3 Em nucleic acid total (ng) Em genome copy number Em_1_1 Em_2_1 Em_3_1 0.1 800 Em_1_2 Em_2_2 Em_3_2 0.01 80 Em_1_3 Em_2_3 Em_3_3 0.001 8 Em_1_4 Em_2_4 Em_3_4 0.0001 0.8 Em_1_5 Em_2_5 Em_3_5 0.00001 0.08 Em_1_6 Em_2_6 Em_3_6 0.000001 0.008 Em_1_7 Em_2_7 Em_3_7 1E-07 0.0008 Em_TE_1 Em_TE_2 Em_TE_3 0 0
[0117] 2. Library preparation ( Figure 2 )
[0118] 2.1 First round of PCR amplification
[0119] 1) The first round of amplification of serially diluted Echinococcus granulosus nucleic acid template was performed using the ATOPlex DNA multiplex PCR amplification module (MGI, 940-000124-002) and Echinococcus granulosus PCR Primer Pool 1 (external primers). The amplification reaction system was prepared in PCR reaction tubes according to Table 4. The reaction system was vortexed to mix the reaction system, and the reaction solution was collected to the bottom of the tube by brief centrifugation. The first round of PCR reaction system should be prepared on ice.
[0120] Table 4. First-round PCR amplification reaction system
[0121] Component Volume PCR Enzyme Mix 25 μL PCR Clean Enzyme 0.5 μL PCR Primer Pool 1 4 μL Sample 1 μL NF Water 19.5 μL Total Volume 50 μL
[0122] Note: Before using PCR Primer Pool 1, be sure to mix thoroughly by vortexing 5-6 times for 3-5 seconds each time.
[0123] 2) Place the reaction tubes on the PCR instrument and amplify according to the procedure in Table 5.
[0124] Table 5. First-round PCR amplification reaction procedure
[0125]
[0126]
[0127] 3) Purify PCR products using the MGI Easy DNA Purification Magnetic Bead Kit (MGI, 1000005278);
[0128] 4) After the reaction is complete, briefly centrifuge to collect the reaction solution to the bottom of the tube;
[0129] 5) Remove the DNAClean Beads 30 minutes in advance and place them at room temperature. Shake well before use.
[0130] 6) Use a pipette to add 60 μL of DNAClean Beads to the PCR product and gently pipette at least 10 times until all the magnetic beads are suspended. On the last time, make sure that all the liquid in the pipette tip and the magnetic beads are pipetted into the PCR tube.
[0131] 7) Incubate at room temperature for 5 minutes;
[0132] 8) Centrifuge the PCR tube briefly, place it on a magnetic rack, and let it stand for 2-5 minutes until the liquid is clear. Carefully aspirate the supernatant with a pipette and discard it.
[0133] 9) Repeat step 8) to remove as much liquid as possible from the tube. If a small amount of liquid remains on the tube wall, the centrifuge tube can be centrifuged briefly. After separation on a magnetic rack, use a small-capacity pipette to remove the liquid from the bottom of the tube.
[0134] 10) Keep the centrifuge tubes on the magnetic rack, open the centrifuge tube caps, and allow them to dry at room temperature until the surface of the magnetic beads is no longer reflective and cracked;
[0135] 11) Remove the centrifuge tube from the magnetic rack and add 14 μL of TE Buffer for DNA elution. Ensure that the added TE Buffer fully wets the magnetic beads to prevent the magnetic beads from drying out too much and causing loss of PCR products.
[0136] 12) Incubate at room temperature for 5 minutes;
[0137] 13) The second round of PCR reaction was carried out with magnetic beads, and the product did not need to be magnetically adsorbed or the supernatant was transferred.
[0138] 2.2 Second round of PCR amplification
[0139] 1) The first round of PCR products were amplified using the ATOPlex DNA multiplex PCR amplification module (MGI, 940-000124-002), the ATOPlex dual-tag primer module (01-96, MGI, 1000021626), and the Echinococcus tapeworm primer pool PCR Primer Pool 2 (internal primers);
[0140] 2) Prepare the PCR amplification reaction solution according to Table 6, mix thoroughly, and place on ice for later use;
[0141] Table 6 Second-round PCR amplification system
[0142] Component Volume PCR Enzyme Mix 25 μL PCR Clean Enzyme 0.5 μL PCR Additive 1 μL Tag Primer 8 μL PCR Primer Pool 2 2 μL Total Volume 36.5 μL
[0143] Note: Before using PCR Primer Pool 2, be sure to mix thoroughly by vortexing 5-6 times for 3-5 seconds each time.
[0144] 3) Use a pipette to add 36.5 μL of the prepared second-round PCR reaction solution to the PCR tube, vortex 3 times for 3 seconds each time, and then centrifuge briefly to collect the reaction solution to the bottom of the tube.
[0145] 4) Place the reaction tubes on the PCR instrument and amplify according to the procedure in Table 7.
[0146] Table 7. Second-round PCR amplification reaction procedure
[0147]
[0148] 5) Purify PCR products using the MGI Easy DNA Purification Magnetic Bead Kit (MGI, 1000005279);
[0149] 6) After the reaction is complete, the reaction solution is collected to the bottom of the tube by instant centrifugation. It is then purified using 60 μL of DNAClean Beads, and DNA is eluted using 25 μL of Elution Buffer. Finally, 23 μL of supernatant is transferred to a new 1.5 mL centrifuge tube.
[0150] 2.3 PCR product quantification and quality control
[0151] The concentration of PCR products was quantified using the Qubit dsDNA HS Quantitative Kit (Invitrogen, Q32851) (Table 8).
[0152] Table 8 Concentration of products from the second round of PCR amplification
[0153]
[0154]
[0155] 3. High-throughput sequencing
[0156] Sequencing was performed using the DNBSEQ-G99RS high-throughput sequencing kit (MGI, G99 SM FCL PE150, 940-000410-00), strictly following the kit instructions. On the DNBSEQ-G99 gene sequencer, the PE100+10+10 (Paired end 100+10+10) sequencing mode was used to obtain base sequence information, with approximately one million raw reads required for each sample.
[0157] 4. Interpretation of sequencing results
[0158] Sequencing data processing included data quality control, sequence alignment, sequence filtering, and Echinococcus tapeworm sequence analysis. The reference genomes used were from NCBI (National Center for Biotechnology Information). The NCBI species classification number (Taxonomy ID) for Eg is 6210, and the representative genome sequence for this species is GCA_000524195.1 (GenBank); the NCBI species classification number for Em is 6211, and the representative genome sequence for this species is GCA_000469725.3 (GenBank). The mitochondrial reference genome sequences were also from NCBI. The mitochondrial reference genome sequence for Eg is AB786664.1 (GenBank), and the mitochondrial reference genome sequence for Em is AB018440.2 (GenBank).
[0159] Infection can be determined using the following methods:
[0160] In each batch of testing, a corresponding negative control (TE) was designed. Nucleic acid detection based on high-throughput sequencing technology is extremely sensitive, but cross-contamination between samples is unavoidable during DNA extraction, library construction, and sequencing. In this embodiment, the percentage of Echinococcus granulosus reads in all samples was calculated, i.e., Echinococcus granulosus reads / (Echinococcus granulosus reads + lambda phage reads). First, the percentage of Echinococcus granulosus reads detected in the negative control should be less than 0.2% to ensure no serious cross-contamination events occurred during the experiment. Based on this, if the percentage of Echinococcus granulosus reads in the test sample is ≥ 10 times that of the Echinococcus granulosus reads in the same batch of negative controls, it is considered a positive result (infection); otherwise, it is a negative result (not detected). Among the number of Echinococcus granulosus reads in positive samples, the percentage of Echinococcus granulosus Em and Eg classes is distinguished; if the percentage of one class is higher than 95%, it is determined to be that type of infection.
[0161] Test results as follows Figure 2 Table 9 Figure 3 As shown in Table 10, the embodiments based on the technical solution of this application can accurately detect samples with 1 fg of Echinococcus tapeworm nucleic acid load and accurately classify them into Em or Eg. Based on the genome sizes of the two Echinococcus tapeworms, Em is approximately 0.008 copies and Eg is approximately 0.005 copies, both of which can be accurately detected and classified. Furthermore, the detection scheme based on this application takes less time. Figure 4 ).
[0162] Table 9. Results of Echinococcus granulosus (Eg) Infection Type Determination
[0163]
[0164] Table 10 Results of Echinococcus granulosus (Em) Infection Type Determination
[0165] Sample ID Copy Number Worm reads concentration Infection determination Em reads concentration Infection type Em_1_1 800 99.44 Infected 99.81 Em Em_2_1 800 99.98 Infected 99.79 Em Em_3_1 800 99.98 Infected 99.77 Em Em_1_2 80 89.45 Infected 99.71 Em Em_2_2 80 99.92 Infected 99.79 Em Em_3_2 80 99.88 Infected 99.81 Em Em_1_3 8 89.01 Infected 99.75 Em Em_2_3 8 98.92 Infected 99.79 Em Em_3_3 8 98.73 Infected 99.78 Em Em_1_4 0.8 46.27 Infected 99.88 Em Em_2_4 0.8 92.26 Infected 99.78 Em Em_3_4 0.8 90.51 Infected 99.81 Em Em_1_5 0.08 5.15 Infected 98.41 Em Em_2_5 0.08 58.18 Infected 99.42 Em Em_3_5 0.08 46.11 Infected 99.66 Em Em_1_6 0.008 0.14 Not detected Not detected Not detected Em_2_6 0.008 4.11 Infected 98.63 Em Em_3_6 0.008 13.41 Infected 99.15 Em Em_1_7 0.0008 0.09 Not detected Not detected Not detected Em_2_7 0.0008 0.04 Not detected Not detected Not detected Em_3_7 0.0008 0.11 Not detected Not detected Not detected Em_TE_1 0 0.14 Not detected Not detected Not detected Em_TE_2 0 0.05 Not detected Not detected Not detected Em_TE_3 Not detected Not detected Not detected Not detected Em TE 3 0 0.06 Not detected Not detected Not detected Not detected
[0166] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.
[0167] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.
Claims
1. A genome of genetic markers, characterized in that, include: (c1)AB786664.1_252~295, (c2)AB786664.1_286~326, (c3)AB786664.1_439~473, (c4)AB786664.1_620~657, (c5)AB786664.1_743~775, (c6)AB786664.1_883~926, (c7)AB786664.1_1008~1047, (c8)AB786664.1_1028~1078, (c9)AB786664.1_1167~1199, (c10)AB786664.1_1288~1320, (c11)A B786664.1_1306~1351,(c12)AB786664.1_1470~1504,(c13)AB786664.1 _1560~1598,(c14)AB786664.1_1686~1725,(c15)AB786664.1_1956~199 9,(c16)AB786664.1_2318~2359,(c17)AB786664.1_2410~2450,(c18)AB 786664.1_2564~2601,(c19)AB786664.1_2590~2632,(c20)AB786664.1_2 721~2753,(c21)AB786664.1_2931~2973,(c22)AB786664.1_2970~3005, (c23)AB786664.1_3173~3216,(c24)AB786664.1_3384~3421,(c25)AB78 6664.1_3420~3457,(c26)AB786664.1_3545~3580,(c27)AB786664.1_35 77~3611,(c28)AB786664.1_3696~3732,(c29)AB786664.1_3847~3885,(c 30)AB786664.1_3871~3916,(c31)AB786664.1_3994~4037,(c32)AB7866 64.1_4032~4068,(c33)AB786664.1_4277~4309,(c34)AB786664.1_4396~ 4430,(c35)AB786664.1_4576~4611,(c36)AB786664.1_4909~4942,(c37 )AB786664.1_5058~5093,(c38)AB786664.1_5092~5131,(c39)AB786664.1_5190~5229,(c40)AB786664.1_5222~5267,(c41)AB786664.1_5316~5358,(c42)AB786664.1_5350~5389,(c43)AB786664.1_5563~5597,(c44)AB786664.1_5686~5719,(c45)AB786664.1_5718~5756,(c46)AB786664.1_5894~5934,(c47)AB786664.1_6043~6085,(c48)AB786664.1_6084~6116,(c49)AB786664.1_6260~6297,(c50)AB786664.1_6594~6628,(c51)AB786664.1_6622~6659,(c52)AB786664.1_6718~6750,(c53)AB786664.1_6748~6781,(c54)AB786664.1_6870~6902,(c55)AB786664.1_6960~6993,(c56)AB786664.1_7172~7217,(c57)AB786664.1_7329~7368,(c58)AB786664.1_7487~7527,(c59)AB786664.1_7646~7678,(c60)AB786664.1_7727~7771,(c61)AB786664.1_7765~7807,(c62)AB786664.1_8046~8083,(c63)AB786664.1_8082~8114,(c64)AB786664.1_8197~8242,(c65)AB786664.1_8360~8392,(c66)AB786664.1_8383~8423,(c67)AB786664.1_8511~8540,(c68)AB786664.1_8687~8729,(c69)AB786664.1_8971~9007,(c70)AB786664.1_9064~9097,(c71)AB786664.1_9096~9128,(c72)AB786664.1_9361~9398,(c73)AB786664.1_9386~9429,(c74)AB786664.1_9514~9551,(c75)AB786664.1_9669~9709,(c76)AB786664.1_9789~9830,(c77)AB786664.1_9820~9861,(c78)AB786664.1_9946~9982,(c79)AB786664.1_10065~10108,(c80)AB786664.1_10262~10301,(c81)AB786664.1_10295~10332,(c82)AB786664.1_10390~10423,(c83)AB786664.1_10418~10456,(c84)AB786664.1_10560~10604,(c85)AB786664.1_10857~10894,(c86)AB786664.1_10886~10925,(c87)AB786664.1_11157~11189,(c88)AB786664.1_11308~11340,(c89)AB786664.1_11398~11429,(c90)AB786664.1_11480~11520,(c91)AB786664.1_11566~11610,(c92)AB786664.1_11725~11755,(c93)AB786664.1_11895~11932,(c94)AB786664.1_11919~11963,(c95)AB786664.1_12073~12113,(c96)AB786664.1_12201~12234,(c97)AB786664.1_12323~12354,(c98)AB786664.1_12413~12457,(c99)AB786664.1_12529~12576,(c100)AB786664.1_12575~12607,(c101)AB786664.1_12683~12728,(c102)AB786664.1_12723~12759,(c103)AB786664.1_12845~12884,(c104)AB786664.1_12875~12915,(c105)AB786664.1_12973~13006,(c106)AB786664.1_13302~13336,(c107)AB786664.1_13453~13487,(c108)AB786664.1_13485~13519,(c109)AB018440.2_381~421,(c110)AB018440.2_540~573,(c111)AB018440.2_720~754,(c112)AB018440.2_846~878,(c113)AB018440.2_989~1029,(c114)AB018440.2_1111~1150,(c115)AB018440.2_1133~1181,(c116)AB018440.2_1270~1302,(c117)AB018440.2_1391~1423,(c118)AB018440.2_1412~1453,(c119)AB018440.2_1573~1607,(c120)AB018440.2_1663~1700,(c121)AB018440.2_1795~1820,(c122)AB018440.2_2059~2095,(c123)AB018440.2_2415~2456,(c124)AB018440.2_2507~2547,(c125)AB018440.2_2661~2698,(c126)AB018440.2_2687~2729,(c127)AB018440.2_2818~2850,(c128)AB018440.2_3028~3070,(c129)AB018440.2_3069~3105,(c130)AB018440.2_3277~3316,(c131)AB018440.2_3484~3521,(c132)AB018440.2_3519~3557,(c133)AB018440.2_3645~3680,(c134)AB018440.2_3681~3708,(c135)AB018440.2_3797~3827,(c136)AB018440.2_3947~3985,(c137)AB018440.2_3971~4014,(c138)AB018440.2_4094~4134,(c139)AB018440.2_4374~4406,(c140)AB018440.2_4493~4525,(c141)AB018440.2_4673~4706,(c142)AB018440.2_5006~5039,(c143)AB018440.2_5155~5188,(c144)AB018440.2_5189~5232,(c145)AB018440.2_5287~5326,(c146)AB018440.2_5319~5364,(c147)AB018440.2_5418~5454,(c148)AB018440.2_5451~5484,(c149)AB018440.2_5663~5694,(c150)AB018440.2_5817~5854,(c151)AB018440.2_5995~6034,(c152)AB018440.2_6144~6186,(c153)AB018440.2_6185~6217,(c154)AB018440.2_6362~6396,(c155)AB018440.2_6694~6729,(c156)AB018440.2_6723~6760,(c157)AB018440.2_6819~6844,(c158)AB018440.2_6849~6882,(c159)AB018440.2_6973~7000,(c160)AB018440.2_7061~7094,(c161)AB018440.2_7274~7316,(c162)AB018440.2_7586~7624,(c163)AB018440.2_7743~7767,(c164)AB018440.2_7826~7866,(c165)AB018440.2_7862~7904,(c166)AB018440.2_8143~8180,(c167)AB018440.2_8179~8210,(c168)AB018440.2_8294~8336,(c169)AB018440.2_8460~8490,(c170)AB018440.2_8483~8520,(c171)AB018440.2_8792~8829,(c172)AB018440.2_9084~9118,(c173)AB018440.2_9207~9239,(c174)AB018440.2_9472~9509,(c175)AB018440.2_9495~9539,(c176)AB018440.2_9626~9661,(c177)AB018440.2_9780~9820,(c178)AB018440.2_9900~9941,(c179)AB018440.2_9931~9972,(c180)AB018440.2_10057~10093,(c181)AB018440.2_10180~10217,(c182)AB018440.2_10373~10407,(c183)AB018440.2_10406~10443,(c184)AB018440.2_10501~10534,(c185)AB018440.2_10529~10560,(c186)AB018440.2_10671~10714,(c187)AB018440.2_10971~11007,(c188)AB018440.2_11000~11036,(c189)AB018440.2_11275~11307,(c190)AB018440.2_11426~11458,(c191)AB018440.2_11685~11730,(c192)AB018440.2_11845~11876,(c193)AB018440.2_12019~12056,(c194)AB018440.2_12043~12087,(c195)AB018440.2_12197~12237,(c196)AB018440.2_12325~12358,(c197)AB018440.2_12449~12479,(c198)AB018440.2_12538~12582,(c199)AB018440.2_12654~12700,(c200)AB018440.2_12700~12733,(c201)AB018440.2_12808~12848,(c202)AB018440.2_12848~12878,(c203)AB018440.2_12970~13009,(c204)AB018440.2_12997~13040,(c205)AB018440.2_13098~13131,(c206)AB018440.2_13429~13463,(c207)AB018440.2_13580~13614,(c208)AB018440.2_13614~13646,(c209)AB786664.1_2049~2087,(c210)AB786664.1_1938~2296,(c211)pathogen_EMU_contig_0773_5425~5637,(c212)CM038617.1_337864~337985,(c213)JAIKUZ010000010.1_1996161~1996192,(c214)JAIKUZ010000014.1_4770453~4770643,(c215)CM038612.1_664221~664239, (c216)pathogen_EMU_contig_0157_10569~10592, (c217)pathogen_E MU_contig_0157_12687~12703,(c218)JAIKUZ010000023.1_36048~36081,(c219)pathoge n_EmW_scaffold_01_2995559~2995581,(c220)CM038614.1_200244~200269,(c221)path ogen_EMU_contig_0221_11060~11080, (c222)pathogen_EMU_contig_0157_8849~8886, (c 223)CM038616.1_15667405~15667437, (c224)CM038615.1_13640134~13640155, (c225)p athogen_EMU_contig_0221_2020~2036,(c226)CM038617.1_5902005~5902044,(c227)CM0 At least one of the following: 38615.1_17402454~17402479, (c228)JAIKUZ010000010.1_1993076~1993160, (c229)CM038618.1_1993198~1993328, and (c230)pathogen_EmW_scaffold_04_1366252~1366286.
2. A primer, characterized in that, The primers are used to amplify at least a portion of the nucleic acid sequence of any gene marker of claim 1.
3. The primer according to claim 2, characterized in that, The primers include external primers and / or internal primers; Optionally, the length of the external primer is 15bp to 35bp; Optionally, the length of the internal primer is 36bp to 56bp; Optionally, the internal primer comprises at least one of a UMI sequence, a fixed recognition sequence, a complementary circular sequence, and a nucleotide chain sequencing primer binding sequence; Optionally, the binding region of the internal primer is within the nucleic acid fragment amplified by the external primer; Optionally, some primers have nucleotide sequences as shown in SEQ ID NO:1-2.
4. Use of the primers according to claim 2 or 3 in the preparation of a kit for the diagnosis of echinococcosis.
5. Use of the primers according to claim 2 or 3 in the preparation of a kit for identifying the typing of echinococcosis; Optionally, the classification includes Eg type and Em type.
6. A reagent kit, characterized in that, include: The primer as described in claim 2 or 3; Optionally, the kit includes at least one of the following: external reference primers, internal reference primers, nucleic acid extraction reagents, library preparation reagents, and high-throughput sequencing reagents; Optionally, the library construction reagent includes PCR amplification reagent; Optionally, the PCR amplification reagent includes at least one of PCR amplification enzyme, PCR cleaning enzyme, PCR additive, and dual-labeled primers.
7. A method for preparing a sequencing library, characterized in that, include: The nucleic acid template is subjected to a first amplification process using the kit described in claim 6; Based on the tag primers, the first amplification product is subjected to a second amplification process to obtain the sequencing library.
8. The method according to claim 7, characterized in that, The first amplification process includes: amplifying a nucleic acid template using external primers to obtain a first amplification product; Optionally, the first amplification process is performed in a first amplification process system in which the concentration of PCR amplification enzyme is 4 U / μL-6 U / μL, preferably 5 U / μL; Optionally, in the first amplification processing system, the concentration of PCR cleaning enzyme is 0.8 U / μL-1.2 U / μL, preferably 1 U / μL; Optionally, in the first amplification process, the concentration of the external primers is 0.15–0.2 μM.
9. The method according to claim 7, characterized in that, The second amplification process includes: The first amplification product was subjected to a third amplification process using internal primers. The product of the third amplification process was amplified a fourth time using tag primers to obtain the sequencing library.
10. The method according to claim 9, characterized in that, The third amplification process is carried out in a third amplification process system, in which the concentration of PCR amplification enzyme is 4U / μL-6U / μL, preferably 5U / μL; Optionally, in the third amplification treatment system, the concentration of the PCR cleaning enzyme is 0.8 U / μL-1.2 U / μL, preferably 1 U / μL; Optionally, in the third amplification process, the concentration of the primers for amplifying the intermediate nucleic acid sequence of the gene marker is 0.08 μM-0.15 μM, preferably 0.1 μM.
11. The method according to claim 9, characterized in that, The fourth amplification process is performed in a fourth amplification process system, in which the concentration of the tag primer is 3-7 μM, preferably 5 μM.
12. A sequencing data analysis method, characterized in that, include: The sequencing library is obtained by the method according to any one of claims 7 to 11; The sequencing library is subjected to sequencing processing to obtain sequencing data; Based on the difference in the proportion of reads in the test sample and the proportion of reads in the negative control in the sequencing data, the sequencing data is analyzed and processed. Optionally, the analysis process includes: In the sequencing data, if the proportion of Echinococcus granulosus reads in the sample to be tested is not less than 4-10 times that of the proportion of Echinococcus granulosus reads in the negative control, then the sample to be tested is a positive sample. Preferably, in the aforementioned sequencing data, if the proportion of Echinococcus granulosus reads in the test sample is not less than 10 times the proportion of Echinococcus granulosus reads in the negative control, then the test sample is a positive sample.
13. The method according to claim 12, characterized in that, The analysis and processing further includes: Obtain reference sequences for Echinococcus tapeworm Em and Eg types; The sequencing reads of the positive samples were compared with the Em and Eg type reference sequences, respectively, to determine the proportion of the Em and Eg type reads in the positive samples; Based on the aforementioned proportional differences, the type of Echinococcus tapeworm in the positive samples was determined; Optionally, determining the Echinococcus type of the positive sample based on the proportional difference includes: If the proportion of Em-type sequencing reads in the positive sample is not less than 95%, then the positive sample is of the Em type. If the proportion of Eg-type sequencing reads in the positive sample is not less than 95%, then the positive sample is of type Eg.