Nucleic acid combination products, PCR premixes, methods and kits for identifying respiratory pathogens

By designing specific primer-probe compositions and PCR premixes, efficient joint detection of seven respiratory pathogens was achieved in the same PCR reaction system. This solves the problems of cross-reactivity and insufficient anti-interference ability in the detection of multiple respiratory infection bacteria in existing technologies, and improves the accuracy and efficiency of detection.

CN121380395BActive Publication Date: 2026-04-03SANSURE BIOTECH INC
View PDF 8 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-26
Publication Date
2026-04-03

AI Technical Summary

Technical Problem

Existing technologies are insufficient for the efficient detection of multiple respiratory infection bacteria in the same PCR reaction system, and they also suffer from cross-reactivity and insufficient anti-interference capabilities.

Method used

Design specific primer and probe compositions, including SEQ ID NO: 1 to SEQ ID NO: 21 and SEQ ID NO: 22 to SEQ ID NO: 24, labeled with different fluorescent reporter groups, combined with PCR premixes and kits, to achieve joint detection of 7 respiratory pathogens, and perform nucleic acid detection in closed reaction tubes.

Benefits of technology

It enables efficient detection of multiple respiratory pathogens in the same PCR reaction system, avoids cross-reactions, has strong anti-interference ability, simplifies the detection process, and improves the accuracy and efficiency of detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121380395B_ABST
    Figure CN121380395B_ABST
Patent Text Reader

Abstract

This application relates to the field of biodetection technology, and particularly to nucleic acid combination products, PCR premixes, methods, and kits for identifying respiratory pathogenic bacteria. The nucleic acid combination products include primer pairs and probes shown in SEQ ID NO: 1 to SEQ ID NO: 21. This application provides nucleic acid detection products for detecting Klebsiella pneumoniae, Streptococcus pneumoniae, Haemophilus influenzae, Pseudomonas aeruginosa, Acinetobacter baumannii, Staphylococcus aureus, and Moraxella catarrhalis. These products can amplify and detect conserved fragments of each target pathogen in the same PCR reaction system, offering high efficiency and low cost. Furthermore, they exhibit strong anti-interference capabilities and high sensitivity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of biodetection technology, and in particular to nucleic acid combination products, PCR premixes, methods and kits for identifying respiratory pathogenic bacteria. Background Technology

[0002] Respiratory infections are a major challenge in global public health. According to the World Health Organization (WHO), lower respiratory tract infections are the leading cause of death worldwide, causing nearly 2.6 million deaths globally in 2019, making it the fourth leading cause of death. These infections can be caused by a variety of pathogens, including bacteria, viruses, and fungi, with bacterial lower respiratory tract infections being of particular concern. Common bacteria causing lower respiratory tract infections include Klebsiella pneumoniae, Streptococcus pneumoniae, Haemophilus influenzae, Pseudomonas aeruginosa, Acinetobacter baumannii, Staphylococcus aureus, and Moraxella catarrhalis.

[0003] Current reports on the detection of common bacteria causing lower respiratory tract infections include:

[0004] CN115992270A discloses a primer-probe composition, reagent, and kit for detecting respiratory bacterial pathogens. The primer-probe composition includes primers for detecting Klebsiella pneumoniae, Streptococcus pneumoniae, Haemophilus influenzae, Pseudomonas aeruginosa, Acinetobacter baumannii, Staphylococcus aureus, and Moraxella catarrhalis. Based on the optimization of the provided primers, this patent document can achieve nucleic acid detection of up to five targets in a single reaction, but it cannot achieve simultaneous detection of seven respiratory pathogens. Other documents, such as CN119242864A, CN106399568A, CN111876509A, and CN112481401A, also only involve the detection of a few targets and cannot achieve simultaneous detection of seven respiratory pathogens.

[0005] There are also commercially available respiratory pathogen nucleic acid detection kits (fluorescent PCR melting curve method), which detect 15 pathogens including Klebsiella pneumoniae, Streptococcus pneumoniae, Haemophilus influenzae, Pseudomonas aeruginosa, Acinetobacter baumannii, Staphylococcus aureus, and Moraxella catarrhalis. While this kit can detect seven common respiratory infection bacteria, it has poor resistance to interference from zanamivir and purified mucin, and exhibits cross-reactivity with common pathogens, including Enterococcus faecalis, Micrococcus luteus, Rhodococcus equi, Listeria monocytogenes, Acinetobacter jumbo, Mycoplasma pneumoniae, Chlamydia pneumoniae, Influenza A virus, Influenza B virus, Aspergillus terreus, Candida glabrata, and Candida tropicalis. Summary of the Invention

[0006] Based on this, one or more embodiments of this application provide primer-probe compositions, methods, and kits for identifying the nucleic acids of respiratory pathogens. These include the following technical solutions:

[0007] One or more embodiments of this application provide a nucleic acid combination product for identifying respiratory pathogenic bacteria, the nucleic acid combination product comprising primer pairs and probes shown in SEQ ID NO: 1 to SEQ ID NO: 21.

[0008] In some embodiments of this application, the nucleic acid combination product further includes the primer pairs and probes shown in SEQ ID NO: 22 to SEQ ID NO: 24.

[0009] In some embodiments of this application, the types of fluorescent reporter groups labeled on each probe in the nucleic acid combination product are different;

[0010] Optionally, the fluorescent reporter group labeled on each probe is selected from any one of FAM, VIC, ROX, CY5, QUASAR705, ATTO425, CY7 and AF405.

[0011] One or more embodiments of this application provide a PCR premix for identifying respiratory pathogenic bacteria, the PCR premix comprising the aforementioned nucleic acid combination product and other PCR amplification reagents;

[0012] Optionally, the other PCR amplification reagents include PCR buffer, Mg... 2+ One or more of dNTPs, Taq enzymes, and UDG enzymes.

[0013] In some embodiments of this application, the PCR premix further includes a lyophilization protectant.

[0014] In some embodiments of this application, the PCR premix is ​​in a lyophilized state.

[0015] One or more embodiments of this application provide a kit for identifying respiratory pathogenic bacteria, the kit comprising the nucleic acid combination product or the PCR premix.

[0016] In some embodiments of this application, the kit further includes one or more of the following: employing tools, sample preservation reagents, nucleic acid release reagents, and nucleic acid extraction reagents.

[0017] One or more embodiments of this application provide a method for identifying respiratory pathogenic bacteria for non-diagnostic purposes, wherein the method uses the described nucleic acid combination product, the described PCR premix, or the described kit to detect the nucleic acid of the sample to be tested.

[0018] In some embodiments of this application, the method includes performing the following operations in a closed reaction tube: placing the sample to be tested in the nucleic acid release reagent for pretreatment, and quantitatively mixing the resulting pretreatment product with the lyophilized PCR premix to achieve nucleic acid detection of the sample to be tested.

[0019] In some embodiments of this application, the sample to be tested includes sputum.

[0020] Compared with traditional technologies, this application has the following advantages:

[0021] This application provides a nucleic acid detection product for Klebsiella pneumoniae, Streptococcus pneumoniae, Haemophilus influenzae, Pseudomonas aeruginosa, Acinetobacter baumannii, Staphylococcus aureus, and Moraxella catarrhalis. It can amplify and detect conserved fragments of each target pathogen in the same PCR reaction system, exhibits strong resistance to interference from zanamivir and purified mucin, and shows no cross-reaction with common pathogens, including Enterococcus faecalis, Micrococcus luteus, Rhodococcus equi, Listeria monocytogenes, Acinetobacter jumbo, Mycoplasma pneumoniae, Chlamydia pneumoniae, Influenza A virus, Influenza B virus, Aspergillus terreus, Candida glabrata, and Candida tropicalis. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of this application and to more completely understand this application and its beneficial effects, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1a and Figure 1b The results are the detection results for the magnetic bead method and the ultrasonic direct expansion method used in Example 3, respectively.

[0024] Figure 2 The results are the sensitivity detection results from Example 4.

[0025] Figure 3 The detection results are for using other primers and probes with ultrasonic direct amplification.

[0026] Figure 4 To enable the use of other primers and probes for specific detection results.

[0027] Figure 5 To mitigate interference with detection results using other primers and probes. Detailed Implementation

[0028] The present application will be further described in detail below with reference to the accompanying drawings, embodiments, and examples. It should be understood that these embodiments and examples are for illustrative purposes only and are not intended to limit the scope of the present application. The purpose of providing these embodiments and examples is to enable a more thorough and comprehensive understanding of the disclosure of the present application. It should also be understood that the present application can be implemented in many different forms and is not limited to the embodiments and examples described herein. Those skilled in the art can make various modifications or alterations without departing from the spirit of the present application, and the equivalent forms obtained also fall within the protection scope of the present application. Furthermore, numerous specific details are set forth in the following description to provide a fuller understanding of the present application. It should be understood that the present application can be implemented without one or more of these details.

[0029] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein in the specification of this application is for descriptive purposes only and is not intended to be limiting of the application.

[0030] Unless otherwise stated or in case of contradiction, the terms or phrases used herein shall have the following meanings:

[0031] The terms "and / or," "or / and," and "and / or" as used herein include any one of two or more of the related listed items, as well as any and all combinations of the related listed items. These arbitrary and all combinations include any two related listed items, any more related listed items, or a combination of all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or," "or / and," and "and / or," it should be understood that in this application, the technical solution undoubtedly includes technical solutions connected by "logical AND," and also undoubtedly includes technical solutions connected by "logical OR." For example, "A and / or B" includes three parallel solutions: A, B, and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, a technical solution that is connected by "logical OR"), as well as any and all combinations of A, B, C, and D, that is, combinations of any two or three of A, B, C, and D, and also combinations of all four of A, B, C, and D (that is, a technical solution that is connected by "logical AND").

[0032] In this application, the terms "multiple", "various", "multiple times", "multi-dimensional", etc., unless otherwise specified, refer to a quantity greater than or equal to 2. For example, "one or more" means one or more than or equal to two.

[0033] The terms “combinations of,” “any combination of,” and “any combination of” used in this article include all suitable combinations of any two or more of the listed items.

[0034] In this document, the term "suitable" as used in phrases such as "suitable combination," "suitable method," and "any suitable method" refers to the ability to implement the technical solution of this application, solve the technical problem of this application, and achieve the expected technical effect of this application.

[0035] In this document, terms such as “preferred,” “better,” “more suitable,” and “ideal” are merely used to describe implementation methods or examples that achieve better results, and should be understood not to limit the scope of protection of this application.

[0036] In this application, terms such as "further," "even further," and "particularly" are used to describe purposes and indicate differences in content, but should not be construed as limiting the scope of protection of this application.

[0037] In this application, "optionally," "optionally," and "optional" mean that something is optional, that is, it means that it is selected from either "with" or "without." If there are multiple "optional" entries in a technical solution, unless otherwise specified, and there are no contradictions or mutual constraints, each "optional" entry shall be independent.

[0038] In this application, the terms "first aspect," "second aspect," "third aspect," "fourth aspect," etc., are used for descriptive purposes only and should not be construed as indicating or implying relative importance or quantity, nor should they be construed as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first," "second," "third," "fourth," etc., serve only as a non-exhaustive enumeration and should be understood not to constitute a closed limitation on quantity.

[0039] In this application, the technical features described in an open-ended manner include both closed technical solutions consisting of the listed features and open technical solutions that include the listed features.

[0040] In this application, numerical intervals (i.e., numerical ranges) are involved. Unless otherwise specified, the selected numerical distributions within the aforementioned numerical intervals are considered continuous and include the two endpoints (i.e., the minimum and maximum values) of the numerical range, as well as every value between these two endpoints. Unless otherwise specified, when a numerical interval refers only to integers within that interval, it includes the two endpoint integers of the numerical range, as well as every integer between the two endpoints. In this document, this is equivalent to directly listing every integer. For example, if t is an integer selected from 1 to 10, it means that t is any integer selected from the group of integers consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. Furthermore, when multiple ranges are provided to describe features or characteristics, these ranges can be merged. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all subranges to which they are included.

[0041] Unless otherwise specified, the temperature parameters in this application are permitted to be either constant-temperature treatment or variations within a certain temperature range. It should be understood that the constant-temperature treatment allows temperature fluctuations within the precision range of the instrument control, such as ±5℃, ±4℃, ±3℃, ±2℃, or ±1℃.

[0042] In this application, %(w / w) and wt% both represent weight percentage, %(v / v) refers to volume percentage, and %(w / v) refers to mass-volume percentage.

[0043] All references to this application are incorporated herein by reference as if each document were individually incorporated herein by reference. Unless they conflict with the purpose and / or technical solution of this application, all cited references are incorporated herein by reference in their entirety and for all purposes. When references are cited in this application, the definitions of relevant technical features, terms, nouns, phrases, etc., are also incorporated herein by reference. Examples and preferred embodiments of the cited technical features may also be incorporated herein by reference, but only to the extent that they enable the implementation of this application. It should be understood that when the cited content conflicts with the description in this application, this application shall prevail or modifications shall be made adaptably to the description in this application.

[0044] A first aspect of this application provides a nucleic acid combination product for identifying respiratory pathogenic bacteria, the nucleic acid combination product comprising primer pairs and probes shown in SEQ ID NO: 1 to SEQ ID NO: 21.

[0045] In some embodiments of this application, the nucleic acid combination product further includes the primer pairs and probes shown in SEQ ID NO: 22 to SEQ ID NO: 24.

[0046] In some embodiments of this application, the types of fluorescent reporter groups labeled on each probe in the nucleic acid combination product are different;

[0047] Optionally, the fluorescent reporter group labeled on each probe is selected from any one of FAM, VIC, ROX, CY5, QUASAR705, ATTO425, CY7 and AF405.

[0048] This application allows each probe to be a single-quenching probe (e.g. labeled TAMRA, BHQ1, BHQ2, BBQ650, etc.) or a double-quenching probe (e.g., the main quenching group is located at the 3' end, such as MGB-NFQ or BHQ, and the secondary quenching group / fine-tuning quenching group is located on a base inside the probe, such as ZEN or TAO).

[0049] A second aspect of this application provides a PCR premix for identifying respiratory pathogenic bacteria, the PCR premix comprising the aforementioned nucleic acid combination product and other PCR amplification reagents;

[0050] Optionally, the other PCR amplification reagents include PCR buffer, Mg... 2+ One or more of dNTPs, Taq enzymes, and UDG enzymes.

[0051] It is understood that the PCR premix of this application may be in liquid or dry form. In dry PCR premix, solvents such as water have been removed, and optionally, the PCR premix may also include a lyophilization protectant.

[0052] A third aspect of this application provides a kit for identifying respiratory pathogenic bacteria, the kit comprising the aforementioned nucleic acid combination product or the aforementioned PCR premix.

[0053] In some embodiments of this application, the kit further includes one or more of the following: employing tools, sample preservation reagents, nucleic acid release reagents, and nucleic acid extraction reagents.

[0054] A fourth aspect of this application provides a method for identifying respiratory pathogenic bacteria for non-diagnostic purposes, wherein the method uses the aforementioned nucleic acid combination product, the aforementioned PCR premix, or the aforementioned kit to detect the nucleic acid of the sample to be tested.

[0055] This application does not impose any particular limitation on the method. The sample to be tested can be pretreated first, and then the nucleic acid obtained from the pretreatment can be manually added to the PCR premix for detection. Alternatively, the nucleic acid can be directly mixed with the PCR premix for detection without relying on manual transfer of nucleic acid. For example, the following operation can be performed in a closed reaction tube: the sample to be tested is placed in the nucleic acid release reagent for pretreatment, and the resulting pretreatment product is quantitatively mixed with the lyophilized PCR premix defined above to achieve detection of nucleic acid in the sample to be tested. For example, the detection device and detection method described in the invention patent application with publication number CN116555007A can be used, which simplifies the process and avoids contamination.

[0056] This application does not specifically limit the type of sample to be tested, which includes, but is not limited to, sputum, such as clinically used sputum, or simulated sputum.

[0057] The embodiments of this application will be described in detail below with reference to examples. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of this application. For experimental methods in the following embodiments where specific conditions are not specified, please refer to the guidelines given in this application, or follow experimental manuals or conventional conditions in the art, or follow the conditions recommended by the manufacturer, or refer to experimental methods known in the art.

[0058] In the specific embodiments described below, the measurement parameters involving raw material components may have slight deviations within the weighing accuracy range unless otherwise specified. Temperature and time parameters are subject to acceptable deviations due to instrument testing accuracy or operational precision.

[0059] Example 1

[0060] The primers and probes used in this application are shown in the table below:

[0061] Table 1

[0062]

[0063] The fluorescent reporter group of the KPN-P probe is FAM, and the quencher group is Super Quencher 1; the fluorescent reporter group of the SP-P probe is VIC, and the quencher group is Super Quencher 1; the fluorescent reporter group of HI-P is ROX, and the quencher group is Super Quencher-X; the fluorescent reporter group of PA-P is CY5, and the quencher group is BHQ3; the fluorescent reporter group of AB-P is QUASAR705, and the quencher group is Super Quencher 3; the fluorescent reporter group of SA-P is ATTO425, and the quencher group is Super Quencher 1; the fluorescent reporter group of MC-P is CY7, and the quencher group is Super Quencher 3; and the fluorescent reporter group of IC-P is AF405, and the quencher group is Super Quencher 0.

[0064] This application designs specific primers and probes for conserved regions of seven respiratory pathogens, as well as primers and probes for the GAPDH gene. This allows for the simultaneous detection of seven respiratory pathogens in a single reaction using a one-tube eight-color fluorescent PCR technique combined with lyophilized PCR reagents and direct amplification, significantly reducing detection time. The primer and probe design concept of this application is as follows:

[0065] (1) Gene sequence alignment: Gene sequences (FASTA format files) of Klebsiella pneumoniae, Streptococcus pneumoniae, Haemophilus influenzae, Pseudomonas aeruginosa, Acinetobacter baumannii, Staphylococcus aureus, and Moraxella catarrhalis were obtained respectively. Conserved regions of each bacterial target were identified through sequence alignment for subsequent primer and probe design. The following conserved sequences of each bacterium were found using the above method:

[0066] The conserved region of Klebsiella pneumoniae (SEQ ID NO: 25) is as follows:

[0067] TGGCTGGAAGGTCACCTGGATCAGCCGCTTTTCTGGATAATGTGGCGGCGAAGGCAGGTTATTCCAAGTGGCATTTGCAGCGAATGTTTAAGGATGTCACCGGCCATGCCATCGGTGCCTATATTCGCGCGCGCCGCTTGTC GAAATCTGCTGTCGCATTACGCCTGACCGCCCGTCCAATCCTTGATTTGCGCTGCAGTACCGTTTCGACTCCCAGCAGACCTTCACCCGAGCGTTTAAGAAACAATTCTCGCTGACGCCGGCGCTCTACCGCCGCTCGCCG*

[0068] The conserved region of Streptococcus pneumoniae (SEQ ID NO: 26) is as follows:

[0069] ATGGTGCCTGGGACGTTGGGGGCGGTTGGAATGCTGAGACCTATGCAGCGGTTGAACTGATTGAAAGCCATTCAACCAAAGAAGAGTTCATGACGGACTACCGCCTTTATATCGAACTCTTACGCAATCTAGCAGATGAAGCAGGTTTGCCGAAAACGCTTGATACAGGGAGTTTAGCTGGAATTAAAACGCACGAGTATTGCACGAATAACCAACCAAACAACCACTCAGACCACGTTGACCCTTATCCATATCTTGCTAAATGGGGCATTAGCCGTGAGCAGTTTAAGCATGATATTGAGAACGGCTTGACGATTGAAACAGGCTGGCAGAAGAATGACACT*

[0070] The conserved region of Haemophilus influenzae (SEQ ID NO: 27) is as follows:

[0071] ATCAAATCTCTTTATCAACGTAACGGCATTGGTCAATACAGTTTTAATACTTTATTTAAATTACATTGGTTAAAAACACACAAGCCAGATGTTTTCCAAAAAATGGCTAAATTCGTTTTTATTTCGTCAATGCTCACTCAACGCTTAACTGGTCAATTCACTACAGATCACACAATGGCGGGAACATCAATGATGACAAACCTTACTAGCGGTAATTGGGATCCATCGATTTTAGCATCGCTGGGTTTAAGTAATAACCATTTCCCTCCTATGCGTTATGCAGGTGAAAAAGTTGGAAAATTACGTACACCGTTAGCCCAGAAATGGGGATTAAATCCCGTACCT*

[0072] The conserved region of Pseudomonas aeruginosa (SEQ ID NO: 28) is as follows:[[ID=]14]

[0073] GTCGTGCCAAGGCCGTTCAGCGCTACCTGGTGCTGCAGGGCGTTTCGCCGGCCACGCTGGAACTGGTTTCCTATGGTAAAGAGCGTCCGGTCGCTACCGGCCACGACGAGCAGTCCTGGGCTCAGAACCGTCGCGTCGAGCTGAAGAAGTAAGAAGTCGTTATGCCCAAGCACCTGCGTGTCCTGACGTTCCTCGCGTCCAGCCTGCCATTAGC*

[0074] The conserved region of Acinetobacter baumannii (SEQ ID NO: 29) is as follows:

[0075] Ctagttgcaggcggtattatcgctgcagcatcaaatcatgatagtgatgatgattcttcagcacctgttgataccactccaccaagtaccgatggcgtaactttctcggttgaccctgttacttctgataatgtgat*

[0076] The conserved region of Staphylococcus aureus (SEQ ID NO: 30) is as follows:

[0077] TGACATTCAGACTATTATTGGTTGATACACCTGAAACAAAGCATCCTAAAAAAGGTGTAGAGAAATATGGTCCTGAAGCAAGTGCATTTACGAAAAAAATGGTAGAAAATGCAAAGAAAATTGAAGTCGAGTTTGACAAAGGTCAAAGA ACTGATAAATATGGACGTGGCTTAGCGTATATTTATGCTGATGGAAAAATGGTAAACGAAGCTTTAGTTCGTCAAGGCTTGGCTAAAGTTGCTTATGTTTATAAACCTAACAATACACATGAACAACTTTAAGAAAAAGTGAAGCACA*

[0078] The conserved region of Moraxella catarrhalis (SEQ ID NO: 31) is as follows:

[0079] TGCCGCGTGCTGGCGTTGCTCACAGCAAACCAACCATGCACAATGTCAAATTTAGTGGCAATCCTGAATATGCCGTGCGTACAGGTCGTACATGGACAGCAGATGTCGCCTATCGCCTGCCAAACCCCAGTGTAGAGCTTGGTGTGAGACACACATTGGTTGAAGGGGTAGATGCCAAAGACACATCCATCATAAGTGGTGAAGTTAGCAAACTTAACCGTGAAGGCTATAATGTCAGTGACATCTATGCCA*

[0080] The GAPDH gene sequence (SEQ ID NO: 32) is as follows:

[0081] CTGGGGCTGGCATTGCCCTCAACGACCACTTTGTCAAGCTCATTTCCTGGTATGACAACGAATTTGGCTACAGCAACAGGGTGGTTGGACCTCATGGCCCACATGGCCTCCAAGGAGTAAGACCCCTGGACCACCAGCCCCAGCAAGAGCACAAGAGGAAG AGAGAGACCCTCACTGCTGGGGAGTCCCTGCCACACTCAGTCCCCCACCACACTGAATCTCCCCTCCTCACAGTTGCCATGTAGACCCCTTGAAGAGGGGAGGGGCCTAGGGAGCCGCACCTTGTCATGTACCATCAATAAAGTACCCTGTGCTCAACCA*

[0082] (2) Primer and probe design: According to the primer and probe design principles, primers and probes are designed, and primer specificity analysis is performed. Based on experience, primers and probes with good performance are manually selected as target primers and probes.

[0083] Simultaneously, following the same procedure, primers and probes for the human housekeeping gene GAPDH were designed as internal standard primers and probes. The 5' end of the probe was labeled with fluorescent reporter groups (FAM, HEX, ROX, CY5, QUSAR705, ATTO425, CY7, AF405), and the 3' end was labeled with non-fluorescent double quencher groups to reduce background interference.

[0084] Example 2, Detection Method

[0085] (1) PCR reaction system

[0086] This application is based on real-time PCR technology. A common reaction system contains at least the following components: PCR buffer, Taq enzyme, UNG enzyme, dNTPs, primer-probe mix, and Mg2+ required for catalyzing DNA polymerase. 2+ Since the PCR amplification reagents used in this application (excluding the template in Table 3) are lyophilized reagents, the PCR reaction system also contains lyophilization protectants (trehalose, sucrose, mannitol, nonionic surfactant Brij58, etc.). All the above-mentioned raw materials were purchased from Hunan Kangde Biotechnology Co., Ltd.

[0087] The primer-probe combination Mix in this application was tested using orthogonal experiments, and the final optimal solution was determined as follows:

[0088] Table 2 (Primer and Probe Mix)

[0089]

[0090] The PCR reaction solution for this application is:

[0091] Table 3

[0092]

[0093] The above PCR reaction solution was converted into solid dry powder (lyophilized balls) using lyophilization technology and packaged in a vacuum environment to ensure its stability.

[0094] (2) Sample processing

[0095] The sample type was sputum sample, specifically a simulated positive sputum sample with multiple bacterial co-infections. The preparation process of this sample was as follows: seven corresponding target bacterial quality control samples were added to the negative sputum sample to make the final concentration of each target 1.0E+05 copies / mL.

[0096] The simulated positive sputum samples were liquefied using an equal volume of physiological saline, 4 wt% NaOH, or sample diluent (Xiangchang Medical Device Registration No. 20221578). Nucleic acid was extracted from the liquefied sputum samples using a magnetic bead method. The extraction reagent used was the nucleic acid extraction or purification reagent from Sansure Biotech Co., Ltd. (Xiangchang Medical Device Registration No. 20210120), denoted as the magnetic bead method.

[0097] Alternatively, the simulated positive sputum sample can be transferred to a dropper or storage tube containing 2 mL of sputum liquefaction solution (sample diluent, Xiangchang Medical Device Registration No. 20221578) using a swab. Then, use an ultrasound instrument with a frequency of 10kHz-80kHz to sonicate at 55kHz for 120s (any frequency within the range of 10kHz-80kHz can be selected during the process). After sonication, let it stand for 3 minutes to allow the sample to cool before use. After processing the sample in this way, PCR amplification can be performed directly for detection. This is called the direct ultrasound amplification method. Unless otherwise specified, subsequent examples and comparative examples shall refer to this method.

[0098] (3) Detection

[0099] 25 µL of the nucleic acid sample extracted in step (2) was added to the PCR amplification reagent (lyophilized bulbs) shown in Table 3. The mixture was then centrifuged and placed on a SLAN-48S real-time quantitative PCR analyzer for amplification. PCR amplification was performed according to a specific temperature and time program. The preferred scheme used in this application is shown in Table 4. It is understood that the amplification program can be adjusted according to the actual application platform.

[0100] Table 4 (PCR Amplification Procedure)

[0101]

[0102] (4) Analysis

[0103] After the reaction is complete, the results are automatically saved, and the amplification curves of the target and internal standard are analyzed separately. Based on the analyzed images, adjust the Start, End, and Threshold values ​​of the Baseline (users can adjust these values ​​according to their actual situation; the Start value can be set between 3 and 15, and the End value between 5 and 20; adjust the amplification curve of the negative control to make it flat or below the threshold line), click Analyze to analyze, and ensure that all parameters meet the requirements in the "Quality Control" section below. Then, record the qualitative results in the Plate window.

[0104] Quality Control

[0105] Negative controls: FAM, HEX / VIC, ROX, CY5, QUSAR705, ATTO425, CY7, and AF405 channels all had no Ct value or Ct > 36;

[0106] Positive controls: Ct≤30 for all channels of FAM, HEX / VIC, ROX, CY5, QUSAR705, ATTO425, CY7, and AF405;

[0107] All of the above requirements must be met simultaneously in the same experiment; otherwise, the experiment is invalid and must be repeated.

[0108] [Positive cutoff value] Based on the study of reference values, the reference value of Ct for the target gene detected by this kit is 36, and the reference value of Ct for the internal standard is 35.

[0109] [Interpretation of Test Results] Interpretation of Positive and Negative Results: A Ct value ≤ 36 for the detected target point is considered positive; a Ct value > 36 or no Ct value is considered negative, as detailed below:

[0110] Table 5 (Test Results Table)

[0111]

[0112] Example 3, Testing Case

[0113] Using the primers and probes shown in Example 1, the simulated positive sputum sample described in Example 2 was compared and detected by magnetic bead method and direct ultrasound amplification method according to the detection method shown in Example 2.

[0114] The results are as follows Figure 1a (Corresponding to the magnetic bead method) and Figure 1b As shown in the diagram (corresponding to direct ultrasound amplification), both the magnetic bead method and the direct ultrasound amplification method can detect 7 bacterial targets normally, and the detected CT values ​​are basically the same. This indicates that the direct ultrasound amplification method can obtain detection results comparable to the magnetic bead method. The direct ultrasound amplification method eliminates the extraction process of the magnetic bead method, thus reducing the detection time.

[0115] Example 4, Sensitivity

[0116] Pretreatment of test samples: Positive test samples are quality control samples of 7 target bacteria after digital PCR determination. The positive test samples are added to the negative sputum samples, mixed well, and then diluted to a final concentration of 500 copies / mL with sputum liquefaction solution (sample diluent, Xiangchang Medical Device Registration No. 20221578) to prepare simulated positive sputum samples.

[0117] The above-mentioned LOD concentration simulated positive sputum samples were processed by direct ultrasound amplification in Example 2 and then tested. The test was repeated 20 times, the number of detected samples was counted, and the detection rate was calculated.

[0118] Test results show that even with 500 copies / mL of simulated positive sputum samples, all seven targets can still be detected with 100% accuracy, proving that the sensitivity of this application reaches 500 copies / mL. The detection results are as follows: Figure 2 As shown.

[0119] Example 5, Specificity

[0120] Using the detection method of Example 2, the following pathogens (bodies) that are likely to cause the same or similar clinical symptoms were detected: Staphylococcus epidermidis, Escherichia coli, Serratia marcescens, Enterococcus faecalis, Candida albicans, Klebsiella pneumoniae, Streptococcus pyogenes, Micrococcus luteus, Rhodococcus equi, Listeria monocytogenes, Acinetobacter jumbo, Mycoplasma pneumoniae, Chlamydia pneumoniae, Neisseria meningitidis, Mycobacterium tuberculosis, Influenza A virus, Influenza B virus, Aspergillus flavus, Aspergillus terreus, Aspergillus fumigatus, Candida glabrata, and Candida tropicalis.

[0121] The only difference from Example 2 is that in this example:

[0122] The samples were simulated positive sputum samples using the following pathogenic microorganisms, referring to Example 4: Staphylococcus epidermidis, Escherichia coli, Serratia marcescens, Enterococcus faecalis, Candida albicans, Klebsiella pneumoniae, Streptococcus pyogenes, Micrococcus luteus, Rhodococcus equi, Listeria monocytogenes, Acinetobacter jumbo, Mycoplasma pneumoniae, Chlamydia pneumoniae, Neisseria meningitidis, Mycobacterium tuberculosis, Influenza A virus, Influenza B virus, Aspergillus flavus, Aspergillus terreus, Aspergillus fumigatus, Candida glabrata, and Candida tropicalis.

[0123] The sample processing method was as follows: sample processing and detection were performed using the direct ultrasonic amplification method described in Example 2. The results showed that the detection method of this application had no cross-reactivity with the aforementioned pathogens. See the table below for details:

[0124] Table 6

[0125]

[0126] Example 6: Anti-interference and stability

[0127] Interfering substances that may be present in sputum samples include: cefotaxime hydrochloride, zanamivir, azithromycin, budesonide, beclomethasone, mometasone, fluticasone, histamine hydrochloride, lopinavir, triamcinolone, arbidol, purified mucin, and heme.

[0128] The detection method of Example 2 was used to verify whether the following concentrations of interfering substances interfered with the detection method of this application: 50 μg / mL cefotaxime hydrochloride, 100 μg / mL zanamivir, 100 μg / mL azithromycin, 320 μg / mL budesonide, 50 μg / mL beclomethasone, 100 μg / mL mometasone, 200 μg / mL fluticasone, 200 μg / mL histamine hydrochloride, 100 μg / mL lopinavir, 100 μg / mL triamcinolone, 100 μg / mL arbidol, 20 μg / mL purified mucin, and 10 μg / mL heme.

[0129] The only difference from Example 2 is that in this example:

[0130] The sample was a simulated positive sputum sample with the above-mentioned interfering substance added. The preparation of the simulated positive sputum sample was as described in Example 2.

[0131] The sample processing method was: direct ultrasonic amplification.

[0132] After testing and verification, the above-mentioned interfering substances have no significant impact on the detection results of low-concentration samples in this application. The difference between the theoretical Ct value and the average detected Ct value is ≤2, as shown in the table below.

[0133] Table 7 (Interference Objects)

[0134]

[0135] Comparative Example 1: Using other primers and probes

[0136] The inventors of this application also designed other primers and probes (sequences shown in Table 8) to form different detection systems, which are also used for the multiplex detection of 7 pathogens in this application.

[0137] Table 8

[0138]

[0139] Based on the primers and probes provided in Table 8, simulated positive sputum samples with multi-target co-infection were prepared according to the detection method in Example 2. Detection was performed using direct ultrasound amplification, and the results are shown below: Klebsiella pneumoniae, Streptococcus pneumoniae, Haemophilus influenzae, Pseudomonas aeruginosa, Acinetobacter baumannii, Staphylococcus aureus, and Moraxella catarrhalis all showed positive results. Figure 3 As shown in Table 8, the primers and probes used can successfully detect seven bacterial targets.

[0140] The detection specificity of the primers and probes shown in Table 8 was verified according to the method in Example 5. The results are as follows: 12 non-target pathogens were detected, and CT values ​​were detected in different corresponding channels, such as... Figure 4 As shown in the figure, the test results indicate that the detection protocol is positive for Enterococcus faecalis, Micrococcus luteus, Rhodococcus equi, Listeria monocytogenes, Acinetobacter jugularis, Mycoplasma pneumoniae, Chlamydia pneumoniae, Influenza A virus, Influenza B virus, Aspergillus terreus, Candida glabrata, and Candida tropicalis.

[0141] The anti-interference ability of the primers and probes shown in Table 8 was verified according to the method in Example 6. The results are shown below. After adding zanamivir and purified mucin interferon, the detection CT and detection efficiency of the target were significantly reduced. Figure 5 As shown in the figure. The results indicate that this detection method is affected by zanamivir and purified mucin.

[0142] The technical features of the above-described embodiments and examples can be combined in any suitable manner. For the sake of brevity, not all possible combinations of the technical features in the above-described embodiments and examples are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0143] The embodiments described above are merely illustrative of several implementation methods of this application, intended to facilitate a detailed understanding of the technical solutions of this application, but should not be construed as limiting the scope of protection of the patent application. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the scope of protection of this application. Furthermore, it should be understood that after reading the above teachings of this application, those skilled in the art can make various alterations or modifications to this application, and the equivalent forms obtained also fall within the scope of protection of this application. It should also be understood that technical solutions obtained by those skilled in the art based on the technical solutions provided in this application through logical analysis, reasoning, or limited experimentation are all within the scope of protection of the appended claims. Therefore, the scope of protection of this patent application should be determined by the content of the appended claims, and the specification and drawings can be used to interpret the content of the claims.

Claims

1. A nucleic acid combination product for identifying respiratory pathogenic bacteria, characterized in that, The nucleic acid combo product includes primer pairs and probes shown in SEQ ID NO: 1 to SEQ ID NO: 21; The nucleic acid combination product identifies the following respiratory pathogens: Klebsiella pneumoniae, Streptococcus pneumoniae, Haemophilus influenzae, Pseudomonas aeruginosa, Acinetobacter baumannii, Staphylococcus aureus, and Moraxella catarrhalis.

2. The nucleic acid combination product for identifying respiratory pathogenic bacteria according to claim 1, characterized in that, The nucleic acid combo product also includes the primer pairs and probes shown in SEQ ID NO: 22 to SEQ ID NO:

24.

3. The nucleic acid combination product for identifying respiratory pathogenic bacteria according to any one of claims 1 to 2, characterized in that, In the nucleic acid combination product, each probe is labeled with a different type of fluorescent reporter group.

4. The nucleic acid combination product for identifying respiratory pathogenic bacteria according to claim 3, characterized in that, The fluorescent reporter group labeled on each probe is selected from any one of FAM, VIC, ROX, CY5, QUASAR705, ATTO425, CY7 and AF405.

5. A PCR premix for identifying respiratory pathogenic bacteria, characterized in that, The PCR premix includes the nucleic acid combination product according to any one of claims 1 to 4 and other PCR amplification reagents; The PCR premix identifies the following respiratory pathogens: Klebsiella pneumoniae, Streptococcus pneumoniae, Haemophilus influenzae, Pseudomonas aeruginosa, Acinetobacter baumannii, Staphylococcus aureus, and Moraxella catarrhalis.

6. The PCR premix for identifying respiratory pathogenic bacteria according to claim 5, characterized in that, The PCR premix meets one or more of the following conditions: (1) The other PCR amplification reagents include PCR buffer, Mg 2+ One or more of dNTPs, Taq enzymes, and UDG enzymes; (2) The PCR premix further includes a lyophilization protectant; and, (3) The PCR premix is ​​in a lyophilized state.

7. A kit for identifying respiratory pathogenic bacteria, characterized in that, The kit comprises the nucleic acid combination product of any one of claims 1 to 4, or the PCR premix of any one of claims 5 to 6; The kit identifies the following respiratory pathogens: Klebsiella pneumoniae, Streptococcus pneumoniae, Haemophilus influenzae, Pseudomonas aeruginosa, Acinetobacter baumannii, Staphylococcus aureus, and Moraxella catarrhalis.

8. The kit for identifying respiratory pathogenic bacteria according to claim 7, characterized in that, The kit also includes one or more of the following: tools, sample preservation reagents, nucleic acid release reagents, and nucleic acid extraction reagents.

9. A method for identifying respiratory pathogenic bacteria for non-diagnostic purposes, characterized in that, The method uses the nucleic acid combination product of any one of claims 1 to 4, the PCR premix of any one of claims 5 to 6, or the kit of any one of claims 7 to 8 to detect the nucleic acid of the sample to be tested; The method identifies the following respiratory pathogens: Klebsiella pneumoniae, Streptococcus pneumoniae, Haemophilus influenzae, Pseudomonas aeruginosa, Acinetobacter baumannii, Staphylococcus aureus, and Moraxella catarrhalis.

10. The method for identifying respiratory pathogenic bacteria for non-diagnostic purposes according to claim 9, characterized in that, The method includes performing the following operations in a closed reaction tube: placing the sample to be tested in a nucleic acid release reagent for pretreatment, and quantitatively mixing the resulting pretreatment product with the lyophilized PCR premix defined in condition (3) of claim 6 to achieve nucleic acid detection of the sample to be tested.

Citation Information

Patent Citations

  • Multiple PCR detection primers of escherichia coli, pseudomonas aeruginosa and staphylococcus aureus, kit and detection method

    CN106399568A

  • PCR method for detecting high-toxicity acinetobacter baumannii

    CN111876509A

  • Kit for simultaneously detecting streptococcus pneumoniae, legionella pneumophila and Moraxella catarrhalis

    CN112481401A

  • Primer probe composition, reagent and kit for respiratory tract bacterial pathogen detection

    CN115992270A

  • Detection device and detection method

    CN116555007A