Traceless induction method for eukaryote polycistron expression ability
By introducing expression cassettes into eukaryotic cells and inducing culture using selectable marker genes, the problems of genomic instability and construction complexity of polycistronic expression in eukaryotes were solved, achieving efficient and stable polycistronic expression with no trace deletion of sequences during passaging.
Patent Information
- Application Number
- CN202410996483.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-24
- Publication Date
- 2026-01-27
AI Technical Summary
Polycistronic expression in eukaryotes suffers from genomic instability and construction complexity. Existing strategies such as IRESs and 2A peptides rely on exogenous sequences and are inefficient, failing to meet the requirements of high efficiency, fidelity, and throughput.
By introducing expression cassettes containing promoters, upstream genes, and downstream genes into eukaryotic cells, polycistronic expression was achieved through induction culture using selection marker genes. The CRISPR-Cas9 method was used to delete the inducible sequence without leaving a trace, ensuring the stability and efficiency of the expression cassettes.
It achieves stable and efficient polycistronic expression in eukaryotes, with downstream cistron expression levels being comparable to upstream levels, without relying on the intercistronic region, and maintaining expression capacity even after more than 20 passages without selection pressure.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to a method for the traceless induction of polycistronic expression in eukaryotes in the field of biotechnology. Background Technology
[0002] The current challenge in synthetic biology is not merely producing single proteins, but rather producing sufficient quantities of multiple proteins with balanced activity to avoid the accumulation of byproducts or intermediates. To achieve synergistic regulation of multiple gene products, they can be expressed in polycistronic form in prokaryotes, but most eukaryotic industrial chassis lack natural polycistronic expression capabilities. If multiple genes are expressed independently under the same promoter and terminator, recombination events due to repeated use of homologous sequences will occur frequently, leading to genetic instability and reduced performance in industrial production. Expressing them under different promoters presents challenges in construction technology and increases material and labor costs.
[0003] Unlike prokaryotes, the vast majority of genes in eukaryotes are transcribed into monocistronic mRNAs and then translated into single proteins. Designing efficient and widely applicable polycistronic expression for eukaryotes would reduce the complexity of gene construction, simplify multi-step strain engineering, and facilitate the simultaneous expression of pathway enzymes at predetermined levels under desired fermentation conditions. Current strategies for polycistronic expression in eukaryotes utilize internal ribosome entry sites (IRESs), self-cleaving 2A peptides, and intercistronic regions (IGGs) from filamentous fungi. IRESs recruit ribosomes to initiate independent translation of the cap of the second open reading frame (ORF) at the internal start site of the polycistronic mRNA. However, IRESs are typically around 500 nucleotides long, and downstream cisstronic expression levels are only about 10% of the first cisstronic expression, limiting their widespread application in metabolic engineering and synthetic biology. The 2A peptide guides the production of independent proteins from single mRNAs via a ribosome jumping mechanism. The applications of 2A peptides have been demonstrated in several metabolic engineering applications, such as the production of C-glucosylflavones or β-carotene. 2A peptides exhibit ribosome jumping efficiency as high as 80%, which can be approached 100% by adding a GSG motif before the 2A peptide sequence. However, even fully processed proteins often have additional peptides appended to their ends, which can affect their structure and function. More importantly, these approaches are heavily reliant on exogenous sequences to function, and the repeated use of the same sequence can lead to genomic instability. Therefore, current polycistronic expression solutions fail to meet the demands for high efficiency, fidelity, and throughput for convenient and predictable complex biosynthetic pathways, such as those for natural products. Summary of the Invention
[0004] The technical problem to be solved by this invention is how to achieve polycistronic expression in eukaryotes.
[0005] To address the aforementioned technical problems, this invention first provides a method for inducing polycistronic expression in eukaryotes, the method comprising: 1) An expression cassette is introduced into a eukaryotic cell, or a fragment of the expression cassette other than the promoter is introduced downstream of a promoter-active DNA fragment in the eukaryotic cell, enabling the DNA fragment to drive the expression of the gene in the expression cassette, thereby obtaining a recombinant cell. The expression cassette contains a promoter, an upstream gene, and a downstream gene, wherein the downstream gene is a selection marker gene, and the upstream gene and the downstream gene are connected by a cistron-intergenic region, which is either A1 or A2). A1) is either a1) or a2): a1) The DNA fragment shown in positions 1136-1186 of SEQ ID No. 1; a2) DNA molecules that have 75% or more identity with the nucleotide sequence defined by a1) and have the same function; A2) is as follows: a3) or a4): a3) The DNA fragment shown in positions 1991-2055 of SEQ ID No. 1; DNA molecules that have 75% or more identity with the nucleotide sequences defined in a4) and a3) and have the same function; 2) The recombinant biological cells are induced and cultured using the screening markers corresponding to the downstream genes. The resulting functionally activated cells are eukaryotic cells with polycistronic expression ability (i.e., able to express two genes with or without exogenous fragment spacers in one expression cassette), thereby realizing the induction of polycistronic expression ability in eukaryotes.
[0006] The DNA fragment with promoter activity can be any active promoter in the eukaryotic cell.
[0007] In the above method, the expression cassette can be introduced into the eukaryotic cells via a recombinant vector (such as the pRS415-G418 vector).
[0008] The above method may further include deleting the expression cassette or a fragment of the expression cassette other than the promoter in the functionally activated cell.
[0009] Deleting the expression cassette or a fragment of the expression cassette other than the promoter in the functionally activated cell can be achieved using gene editing methods (such as the CRISPR-Cas9 method).
[0010] In the above method, the eukaryote can be yeast.
[0011] In one embodiment of the present invention, the screening marker gene is the LEU2, URA3 and / or HIS3 gene.
[0012] The induction culture of the recombinant cells using the selection marker can be carried out in a medium lacking the component of the selection marker gene downstream of the cis-trans-interphase region in the expression cassette. For example, when the selection marker gene downstream of the cis-trans-interphase region in the expression cassette is LEU2, URA3, or HIS3, the medium lacks LEU, URA, or HIS.
[0013] The upstream gene can be a selection marker gene or any gene that can be expressed. When the upstream gene is a selection marker gene, the corresponding component is also lacking in the culture medium.
[0014] In the above method, the expression cassette may further contain transcribed DNA from a 3′UTR, wherein the transcribed DNA from the 3′UTR is as follows (a5) or (a6): a5) The DNA fragment shown at positions 2719-2832 of SEQ ID No. 1; DNA molecules that have 75% or more identity with the nucleotide sequences defined by a6) and a5) and have the same function.
[0015] In the above text, 75% or more of the sameness can be 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.
[0016] The term "identity" used here refers to sequence similarity to a natural nucleic acid sequence. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.
[0017] Functionally activated cells obtained by inducing the expression of polycistronic cells in eukaryotes are also within the scope of protection of this invention.
[0018] This invention also provides a method for expressing multiple genes in eukaryotic cells using an expression cassette, the method comprising: introducing an expression cassette containing multiple genes (the genes in the expression cassette may or may not have exogenous fragment spacers) into the functionally activated cell, or introducing a fragment of the expression cassette other than the promoter into the downstream of a promoter-active DNA fragment in the functionally activated cell, thereby enabling the DNA fragment to drive the expression of the genes in the expression cassette, thus realizing the expression of multiple genes in eukaryotic cells using an expression cassette.
[0019] In the above method, the plurality of genes can be two or more genes.
[0020] This invention develops a rapid and traceless induction method for polycistronic expression in eukaryotes, enabling the induction of polycistronic expression in *Saccharomyces cerevisiae* within a short period. The induced cells exhibit no genomic changes and do not depend on any sequences in the intercistronic region or upstream and downstream genes. In the absence of the intercistronic region, downstream cistronic expression levels are comparable to upstream cistronic expression, and this ability, once activated, can be stably passaged more than 20 times under no selection pressure. Polycistronic expression can still be achieved by tracelessly deleting the induction sequence from the polycistronic expression strain induced by this invention.
[0021] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way. Attached Figure Description
[0022] Figure 1 This diagram illustrates the insertion of polycistronic sequences used for induction. E. coli genes are represented by purple boxes, endogenous genes from Saccharomyces cerevisiae are represented by blue boxes, and the coding regions of transgenes are represented by orange boxes.
[0023] Figure 2 The induction process and growth curves of a polycistronic Saccharomyces cerevisiae strain are shown below. Top: Functional activation induction flowchart; Bottom: Growth curves during induction.
[0024] Figure 3 To detect the expression of polycistronic mRNA in the strain after induction. BY4741 represents Saccharomyces cerevisiae BY4741 (his3△1 leu2△0 met15△0 ura3△0), and Polycistronic DNA represents the polycistronic expression induction fragment.
[0025] Figure 4To detect the expression of polycistronic plasmids with different forms in activated bacteria. Immunoblotting was performed using a GFP monoclonal antibody; rGFP: commercially available recombinant GFP protein (abcam, ab84191).
[0026] Figure 5 This study aimed to detect the expression of polycistronic insertions downstream of genomic genes in activated bacteria. A GFP nucleotide sequence was inserted after the TAA of the TEF1 (FLAG tag, FLAG antibody used for Western blotting: TransGen, HT201) genomic gene, with the TAA directly linked to the ATG (without an intercalary region).
[0027] Figure 6 The results of passage stability assays for the bicistronic expression capacity of the induced strain.
[0028] Figure 7 For the scarless cell line BY4741 A Detection of polycistronic expression.
[0029] Figure 8 For the scarless cell line BY4741 A Phenotypic detection of bicistronic expression of carotenoid synthesis.
[0030] Figure 9 The expression of polycistronic proteins in activated bacteria induced by LEU plasmids was detected. Immunoblotting was performed using a GFP monoclonal antibody; rGFP: a commercially available recombinant GFP protein (abcam, ab84191). Detailed Implementation
[0031] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following examples are all commercially available. All quantitative experiments in the following examples were performed in at least three replicates, and the results were averaged. Unless otherwise specified, in the following examples, the first position of each nucleotide sequence in the sequence listing is the 5′ terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3′ terminal nucleotide of the corresponding DNA / RNA.
[0032] The Saccharomyces cerevisiae BY4741 (his3△1 leu2△0 met15△0 ura3△0) in the following examples (Carrie Baker Brachmann et al., Designer Deletion Strains derived from Saccharomyces cerevisiae S288C: a useful set of Strains and plasmids for PCR-mediated gene Disruption and Other Applications, YEAST, VOL. 14: 115-132 (1998)) is available to the public from the applicant. This biological material is only for repeating the relevant experiments of the present invention and shall not be used for other purposes.
[0033] pRS415-G418 vector: This is a vector obtained by replacing the LEU2 expression cassette in the pRS415 vector with the G418 expression cassette. Specifically, the complete sequence of the pRS415-G418 vector is shown in SEQ ID No. 3.
[0034] SD / -Leu solid medium: a yeast auxotrophic solid medium lacking leucine; SD / -Leu liquid medium: a yeast auxotrophic liquid medium lacking leucine; SD / -Ura solid medium: a yeast auxotrophic solid medium lacking uracil; SD / -Leu / -Ura liquid medium: a yeast auxotrophic liquid medium lacking leucine and uracil.
[0035] Example 1: Induction of polycistronic expression in yeast I. Strain Construction and Functional Induction 1. Based on the polycistronic expression cassette of simultaneously expressing the lacZ, lacY, and lacA genes from *Escherichia coli* MG1655, the lacZ, lacY, and lacA genes were replaced with the LEU2, URA3, and HIS3 genes from *Saccharomyces cerevisiae* S288C (GCF_000146045.2_R64), respectively. The portion excluding the promoter is the polycistronic expression inducible fragment, the sequence of which is positions 41-2832 of SEQ ID No. 1 in the sequence listing. Figure 1 ).
[0036] 2. Add to both ends of the polycistronic expression-inducing fragment obtained in step 1. FAA1The 40 bp homologous arm flanking the promoter region yielded the DNA fragment shown in SEQ ID No. 1. Figure 1 ).
[0037] In SEQ ID No. 1, bits 1-40 are shown as FAA1 The promoter homologous arm, bits 2833-2872, is shown below. FAA1 The gene homology arms show the LEU2 gene from positions 41-1135, the URA3 gene from positions 1187-1990, and the HIS3 gene from positions 2056-2718. Positions 1136-1186 and 1991-2055 represent the cistron-mesotropic region of the *E. coli* lac operon, respectively. lac I. lac The sequence of II, positions 2719-2832, represents the transcribed DNA of the 3′UTR.
[0038] 3. The DNA fragment shown in SEQ ID No. 1 was transformed into *Saccharomyces cerevisiae* BY4741 (his3△1leu2△0 met15△0 ura3△0) using lithium acetate conversion. The resulting recombinant bacteria were plated on SD / -Leu solid medium and cultured at 30°C. Single colonies grew on days 2-3, achieving homologous recombination between the DNA fragment shown in SEQ ID No. 1 and the genomic DNA of *Saccharomyces cerevisiae* BY4741 (his3△1 leu2△0 met15△0 ura3△0). The resulting single colony was designated as *Saccharomyces cerevisiae* BY4741-L. A :U:H, This recombinant yeast strain is a recombinant strain obtained by inserting the polycistronic expression inducible fragment shown at positions 41-2832 of SEQ ID No. 1 between the FAA1 promoter and the FAA1 gene of Saccharomyces cerevisiae BY4741 (his3△1 leu2△0 met15△0 ura3△0).
[0039] 4. Take the brewing yeast BY4741-L obtained in step 3. A :U:H (superscript A indicates that the gene expression ability is activated, the same below) was inoculated into 50 mL shake flasks containing 10 mL SD / -Leu liquid medium and cultured at 30℃ and 180 rpm for 12 h to obtain Saccharomyces cerevisiae BY4741-L. A :U:H bacterial solution.
[0040] 5. Inoculate the bacterial culture obtained in step 4 into a 50 mL shake flask containing 10 mL of SD / -Leu / -Ura liquid medium at OD=0.1. Incubate at 30℃ and 180 rpm for 5-6 days. Induce the strain under strict auxotrophic selection conditions and monitor its growth curve, using *Saccharomyces cerevisiae* BY4741 as a control. The obtained strain expresses the second polycistronic gene (URA3) and is designated BY4741-L. A :U A :H strain.
[0041] The induction flowchart and growth curve of the strain are as follows: Figure 2 As shown.
[0042] II. Functional Verification of Strains The Saccharomyces cerevisiae strain that can express polycistronic acid obtained in step one (i.e., BY4741-L) A :U A Strain H was used as the test strain to detect its gene expression and stability. *Saccharomyces cerevisiae* BY4741 (his3△1 leu2△0 met15△0ura3△0), *Saccharomyces cerevisiae* S288C, and BY4741-L were used respectively. A :U:H bacteria and polycistronic expression-inducible fragments were used as controls. The procedure is as follows: 1. RNA level detection: The polycis-trans mRNA transcription of the test strains was detected using a Northern Blot kit (Roche, Indianapolis, IN, USA; Cat. #11585614910) with a 200 bp digoxigenin-labeled URA3 gene-specific fragment as a probe (the sequence of which is SEQ ID No. 2).
[0043] The results are as follows Figure 3 As shown, strain BY4741-L was induced under strict defective screening conditions. A :U A In :H, the URA3 gene can be transcribed normally, and the mRNA associated with the URA3 gene still exhibits a polycistronic form.
[0044] 2. Protein level detection: The DNA fragment between the SalI and BamHI recognition sequences in the pRS415-G418 vector was replaced with different polycistronic expression cassettes (expression cassette 1-expression cassette 4) to obtain different recombinant vectors (recombinant vectors 1-4); the different recombinant vectors were then introduced into BY4741-L. A :U A Four different recombinant bacteria, BY4741-L, were obtained from H. A :UA :H-1~BY4741-L A :U A :H-4; Transform the recombinant vector containing expression cassette 1 into BY4741-L A :U:H serves as a control (BY4741-L) A Different recombinant bacteria (U:H-1) were cultured, and the protein expression of each strain was detected using Western blotting. The results are as follows: Figure 4 As shown.
[0045] Expression cassette 1 consists of the FAA1 promoter, the LEU2 gene, and the cistrans-mesotropic region. lac I. GFP gene, cistron-metazoline region lac II. The HIS3 gene, 3′UTR, and FAA1 terminator are linked in sequence; Expression cassette 2: consists of the PGK1 promoter, RFP gene, GFP gene, and PGK1 terminator linked in sequence, with the stop codon of the RFP gene and the start codon of the GFP gene linked by overlapping TAATG (TAA is the stop codon of the RFP gene and ATG is the start codon of the GFP gene). Expression cassette 3: consists of the PGK1 promoter, RFP gene, GFP gene, and PGK1 terminator linked in sequence, with the stop codon of the RFP gene and the start codon of the GFP gene directly linked by TAAATG (TAA is the stop codon of the RFP gene and ATG is the start codon of the GFP gene). Expression cassette 4 consists of the PGK1 promoter, RFP gene, intercistronic region araⅠ, GFP gene, and PGK1 terminator linked together in sequence.
[0046] The GFP gene was introduced into BY4741-L using homologous recombination. A :U:H and BY4741-L A :U A Downstream of the TEF1 stop codon of the H gene (the TEF1 gene has a FLAG tag fused to its 3' end, and the stop codon is directly linked to the GFP gene start codon via TAAATG (TAA is the stop codon of the RFP gene, and ATG is the start codon of the GFP gene), two recombinant bacteria were cultured, and the protein expression of each strain was detected using Western blotting. The results are as follows: Figure 5 As shown.
[0047] The FAA1 startup sequence is as follows: CTTAGAATATGGATGATGCAGCCCTGTCATATTCTTCCATAAGGGAATGACAAGGACAATAGTAAAGTCGATCACGCCCTGTCAGGAACATGATCTCCGCCATGTGAATATTTATGCATGATACAGGCACGAATACATCATATAATACGAATGACACAGGGGCACCCACCCATCGCATATCAGGAGAACTTCCCTGTGCATACGGGACAGCAGAGATAGGCTGTTCTCGCGCGTTTTTTTTTTTTTTTTGCTTTTTTTGGTTCCTTTCGCGGATATCGTATTATCGATATTACAACAAAAATGTTTGGAGATCTCCTTCGCTGTCTTTAAGTAAAAGGCTTTAACCGCTTATTTTTCTCTCTTTTTTTCCTTTTACCCCTCACTTGTCGTGAGACAATTGTAGTATATTTAGTAAGTATAGAAAGTTCTTGTTGTTAAAAAACTCGTTAGGATACAATAAAAACTAGAACAAACACAAAAGACAAAAAAAGACAACAAT。
[0048] The FAA1 terminator sequence is as follows: TGGATCAACATTTCCATGATAGGAAAGCCTCATCATACTAAAGCACTTTTTCAGTTTTTTGCTTTAGAACTGCTACCAATTATAAAATAGAATGCACAGGTTATCTTGTTTGGTTTGTTATTATCCTTTTTTCTTCTTTACCAGTCATATCACCTCATTCACGTATGTTCGTAATTTATAATGTTAAAAATGGCATATATAGATATATTTATGAACATCCTAAAAAATAACTAAATTTTTCTACATTTCAAAAAAGGTAACGTTGACTGCCGCATGGCAGTCTAATTAGGAGCTTAGTGATACATATATATATATATATAAATTTCGGCCAAGACACCTCACATAAGAAGCATTACCAGAGGTGTCCTGATCTGAGATGGACCCTGTCTCATTTGTTGAGTTGACAAAATATCAGGGAAATTGATTACCCTGGTGTGCACTGACTCCTTAGTACTCATTTTCACAGCTTCGTACACATCATGGAAGACAAACCATAGCAA。
[0049] The PGK1 promoter sequence is as follows: CGATTTGGGCGCGAATCCTTTATTTTGGCTTCACCCTCATACTATTATCAGGGCCAGAAAAAGGAAGTGTTTCCCTCCTTCTTGAATTGATGTTACCCTCATAAAGCACGTGGCCTCTTATCGAGAAAGAAATTACCGTCGCTCGTGATTTGTTTGCAAAAAGAACAAAACTGAAAAAACCCAGACACGCTCGACTTCCTGTCTTCCTATTGATTGCAGCTTCCAATTTCGTCACACAACAAGGTCCTAGCGACGGCTCACAGGTTTTGTAACAAGCAATCGAAGGTTCTGGAATGGCGGGAAAGGGTTTAGTACCACATGCTATGATGCCCACTGTGATCTCCAGAGCAAAGTTCGTTCGATCGTACTGTTACTCTCTCTCTTTCAAACAGAATTGTCCGAATCGTGTGACAACAACAGCCTGTTCTCACACACTCTTTTCTTCTAACCAAGGGGGTGGTTTAGTTTAGTAGAACCTCGTGAAACTTACATTTACATATATATAAACTTGCATAAATTGGTCAATGCAAGAAATACATATTTGGTCTTTTCTAATTCGTAGTTTTTCAAGTTCTTAGATGCTTTCTTTTTCTCTTTTTTACAGATCATCAAGGAAGTAATTATCTACTTTTTACAACAAATATAAAACA。
[0050] The PGK1 terminator sequence is as follows: ATTGAATTGAATTGAAATCGATAGATCAATTTTTTTCTTTTCTCTTTCCCCATCCTTTACGCTAAAATAATAGTTTATTTTATTTTTTGAATATTTTTTATTTATATACGTATATATAGACTATTATTTATCTTTTAATGATTATTAAGATTTTTATTAAAAAAAAATTCGCTCCTCTTTTAATGCCTT。
[0051] The LEU2 gene sequence is as follows:
[0052] The RFP gene sequence is as follows: ATGGCGAGTAGCGAAGACGTTATCAAAGAGTTCATGCGTTTCAAAGTTCGTATGGAAGGTTCCGTTAACGGTCACGAGTTCGAAATCGAAGGTGAAGGTGAAGGTCGTCCGTACGAAGGTACCCAGACCGCTAAACTGAAAGTTACCAAAGGTGGTCCGCTGCCGTTCGCTTGGGACATCCTGTCCCCGCAGTTCCAGTACGGTTCCAAAGCTTACGTTAAACACCCGGCTGACATCCCGGACTACCTGAAACTGTCCTTCCCGGAAGGTTTCAAATGGGAACGTGTTATGAACTTCGAAGACGGTGGTGTTGTTACCGTTACCCAGGACTCCTCCCTGCAAGACGGTGAGTTCATCTACAAAGTTAAACTGCGTGGTACCAACTTCCCGTCCGACGGTCCGGTTATGCAGAAAAAAACCATGGGTTGGGAAGCTTCCACCGAACGTATGTACCCGGAAGACGGTGCTCTGAAAGGTGAAATCAAAATGCGTCTGAAACTGAAAGACGGTGGTCACTACGACGCTGAAGTTAAAACCACCTACATGGCTAAAAAACCGGTTCAGCTGCCGGGTGCTTACAAAACCGACATCAAACTGGACATCACCTCCCACAACGAAGACTACACCATCGTTGAACAGTACGAACGTGCTGAAGGTCGTCACTCCACCGGTGCTTAA。
[0053] The GFP gene sequence is as follows: ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCTTCACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCACGGCATGGACGAGCTGTACAAGGGTTAG。
[0054] The sequence of each intercistronic region ( Figure 4 ) is as follows: [[ID=##]] lac I: TAATAACCGGGCAGGCCATGTCTGCCCGTATTTCGCGTAAGGAAATCCATT; lac II: GCAATCAATGTCGGATGCGGCGCGAGCGCCTTATCCGACCAACATATCATAACGGAGTGATCGCA; ara I: GGACACGATA.
[0055] The 3′UTR sequence is as follows: ATTATAAAAATTGCCTGATACGCTGCGCTTATCAGGCCTACAAGTTCAGCGATCTACATTAGCCGCATCCGGCATGAACAAAGCGCAGGAACAAGCGTCGCATCATGCCTCTTT.
[0056] The FLAG tag sequence is as follows: GATTACAAGGATGACGACGATAAG.
[0057] The antibodies used in the Western Blot method were: GFP antibody (TransGen Biotech, Beijing, China; Cat. # HT801) and FLAG antibody (TransGen Biotech, Beijing, China; Cat. #HT201).
[0058] Western Blot results are as follows Figure 4 , 5 As shown, the results indicate that the detected proteins are all expressed at independent protein sizes, not fusion expressions, which suggests the polycistronic expression pattern and the substitutability of upstream and downstream gene sequences, spacer sequences, promoters, etc.
[0059] 3. Passage stability test: BY4741-L obtained in step 2 A :U A Taking H-3 as an example, the passage stability of polycistronic expression capacity was tested. BY4741-L A :U A H-3 cells were continuously passaged in SD / -Ura liquid medium (with polycistronic expression selection pressure) or SD liquid medium (without selection pressure), with each passage inoculated at a 1:50 dilution every 24 hours. Each inoculation constituted one passage. Cells were cultured at 30°C and 180 rpm. Samples were taken after each passage to detect GFP fluorescence signal and OD. 600 GFP fluorescence occurs at an excitation wavelength of 483 nm and an emission wavelength of 520 nm. Relative fluorescence intensity is calculated by dividing the fluorescence intensity by the optical density at 600 nm. (Example: BY4741-L) A :U:H was passaged in SD liquid medium (without selection pressure) as a control.
[0060] The results are as follows Figure 6 As shown, it can be stably propagated for more than 20 generations with or without screening pressure.
[0061] III. Construction of scarless cell lines expressing polycistronic proteins 1. Strain construction For the induced strain BY4741-L A :U A :H underwent genome resequencing, and the results showed that it was similar to the recombinant strain BY4741-L A Compared to :U:H, no mutations (SNVs) or deletions / insertions (InDels) were detected except for artificially inserted polycistronic sequences.
[0062] To construct a scarless cell line expressing polycistronic proteins, BY4741-L was used. A :U A :H strain was the recipient bacterium. The inserted polycistronic sequence was seamlessly deleted using the CRISPR / Cas9 system (sgRNA targeting sequence: GAAGAGTAAAAAATTGTACT). Sequencing was performed, and strains with complete deletion of the inserted polycistronic sequence were selected and named BY4741. A (Superscript A indicates that bicistronic expression is activated). Then, to BY4741 A BY4741, BY4741-L A :U:H、BY4741-L A :U A Import the recombinant vector containing expression cassette 3 obtained in step 2 into H and detect polycistronic expression.
[0063] The results are as follows Figure 7 As shown, even after deleting the artificially inserted polycistronic inducing sequence, the cell line can still express polycistronic molecules, achieving rapid and seamless induction of polycistronic expression in eukaryotes.
[0064] 2. Production of secondary metabolites The fungus derived from Blancosella trisporioides ( B. trispora Carotenoid synthesis genes CARRP The stop codon (encoding bifunctional phytopenic lycopene synthase and lycopene cyclase) and CARB The start codons encoding phytosterol desaturase were directly linked by TAAATG to construct a bicistronic expression cassette. The DNA fragment between the SalI and BamHI recognition sequences of the high-copy plasmid containing the fragments of both expression cassettes was replaced to obtain a recombinant vector (the sequence of which is SEQ ID No. 4). The resulting recombinant vector was then introduced into BY4741 and BY4741, respectively. A Different recombinant strains BY4741-B and BY4741 were obtained. A -B; Cultivate different recombinant bacteria and observe their phenotypes.
[0065] In SEQ ID No. 4, bits 771-1475 represent the ADH1 promoter, and bits 1476-2453 represent... GGPPS The gene, positions 2454-2779, represents the ADH1 terminator; positions 2786-3435 represent the PGK1 promoter; and positions 3436-5328 represent the gene... CARRP The gene, positions 5329-7125, is shown below. CARB The gene, positions 7126-7625, is the PGK1 terminator.
[0066] The results are as follows Figure 8 As shown, BY4741 A -B exhibits a distinct yellow phenotype, indicating that in the bicistronic expression frame... CARRP and CARB Both were expressed and jointly synthesized the product, but this was not observed in BY4741-B, indicating that BY4741 lacks bicistronic expression capability, thus limiting the expression of the product within the expression cassette. CARB Without expression, product synthesis cannot be completed.
[0067] IV. Expanding Screening Methods – Plasmid Expression with Other Inducible Markers to Activate Polycistronic Expression Ability The DNA fragment between the SalI and BamHI recognition sequences in the pRS415-G418 vector was replaced with an RFP-LEU2 expression cassette, and the resulting recombinant vector was introduced into BY4741 to obtain the recombinant strain BY4741-pR. A :L; BY4741-pR A The strain BY4741-pR was cultured in SD / -LEU2 liquid medium and its bicistronic expression was induced using the same induction method as described in this invention to obtain the strain. A :L A The recombinant vector 3 obtained above was then transformed into BY474-pR. A :L A Recombinant strain BY4741-pR was obtained. A :L A -3, and the expression of bicistronic GFP was detected by Western blotting.
[0068] The expression cassette RFP-LEU2 consists of the PGK1 promoter, the RFP gene, and the cistron-mesotropic region. lac I. The LEU2 gene and the PGK1 terminator are linked in sequence.
[0069] The results are as follows Figure 9As shown, GFP can be expressed independently, indicating that polycistronic expression in yeast can be activated by different expression forms (genomic or plasmid) and induction tags (LEU2 or URA3) according to the described induction method.
[0070] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.
Claims
1. Methods for inducing polycistronic expression in eukaryotes, including: 1) An expression cassette is introduced into a eukaryotic cell, or a fragment of the expression cassette other than the promoter is introduced downstream of a promoter-active DNA fragment in the eukaryotic cell, enabling the DNA fragment to drive the expression of the gene in the expression cassette, thereby obtaining a recombinant cell. The expression cassette contains a promoter, an upstream gene, and a downstream gene, wherein the downstream gene is a selection marker gene, and the upstream gene and the downstream gene are connected by a cistron-intergenic region, which is either A1 or A2). A1) is either a1) or a2): a1) The DNA fragment shown in positions 1136-1186 of SEQ ID No. 1; a2) DNA molecules that have 75% or more identity with the nucleotide sequence defined by a1) and have the same function; A2) is as follows: a3) or a4): a3) The DNA fragment shown in positions 1991-2055 of SEQ ID No. 1; DNA molecules that have 75% or more identity with the nucleotide sequences defined in a4) and a3) and have the same function; 2) The recombinant biological cells are induced and cultured using the screening markers corresponding to the downstream genes. The resulting functionally activated cells are eukaryotic cells with polycistronic expression ability, thereby realizing the induction of polycistronic expression ability in eukaryotic organisms.
2. The method according to claim 1, characterized in that: The expression cassette was introduced into the eukaryotic cells via a recombinant vector.
3. The method according to claim 1 or 2, characterized in that: The method further includes deleting the expression cassette or a segment of the expression cassette other than the promoter in the functionally activated cell.
4. The method according to any one of claims 1-3, characterized in that: The eukaryote is yeast.
5. The method according to any one of claims 1-4, characterized in that: The expression cassette also contains transcribed DNA from a 3′UTR, wherein the transcribed DNA from the 3′UTR is as follows (a5) or (a6). a5) The DNA fragment shown at positions 2719-2832 of SEQ ID No. 1; DNA molecules that have 75% or more identity with the nucleotide sequences defined by a6) and a5) and have the same function.
6. Functionally activated cells obtained by the method described in any one of claims 1-5.
7. Methods for expressing multiple genes using a single expression cassette in eukaryotic cells include: An expression cassette containing multiple genes is introduced into the functionally activated cell of claim 6, or a fragment of the expression cassette other than the promoter is introduced downstream of a DNA fragment with promoter activity in the functionally activated cell, so that the DNA fragment can drive the expression of the genes in the expression cassette, thereby enabling the expression of multiple genes in eukaryotic cells using one expression cassette.
8. The method according to claim 7 or the method thereof, characterized in that: The term "multiple genes" refers to two or more genes.