System, kit and detection method for rapidly detecting clarithromycin drug-resistant gene of helicobacter pylori by one-pot method

By employing a one-pot rapid detection system that utilizes the T7 transcription system to simultaneously transcribe crRNA, combined with RPA amplification and CRISPR/Cas13a reaction, the complexity and crRNA instability of existing detection methods are resolved, enabling rapid, simple, and highly sensitive detection of clarithromycin resistance genes in Helicobacter pylori.

CN121428070APending Publication Date: 2026-01-30HENAN PROVINCE HOSPITAL OF TCM THE SECOND AFFILIATED HOSPITAL OF HENAN UNIV OF TCM
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511599326.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-04
Publication Date
2026-01-30

AI Technical Summary

Technical Problem

Existing methods for detecting Helicobacter pylori drug resistance, such as culture-based drug sensitivity testing and sequencing, are complex, time-consuming, and not easily adopted. In CRISPR/Cas technology, crRNA is difficult to preserve, making it difficult to achieve rapid and convenient on-site testing at the grassroots level.

Method used

A one-pot rapid detection system is adopted, which uses the T7 transcription system to simultaneously transcribe crRNA in one step, combined with RPA amplification and CRISPR/Cas13a reaction, to achieve simultaneous transcription and detection, simplifying the operation and solving the problem of crRNA instability.

Benefits of technology

This method enables rapid, simple, highly sensitive, and highly specific detection of clarithromycin resistance genes in Helicobacter pylori within 30 minutes at 37 ℃, reducing reagent costs, avoiding cross-contamination, and achieving high consistency between the detection results and the Sanger sequencing method.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121428070A_ABST
    Figure CN121428070A_ABST
Patent Text Reader

Abstract

The invention provides a system, a kit and a detection method for rapidly detecting a drug-resistant gene of clarithromycin of helicobacter pylori by a one-pot method. The system comprises an RPA (recombinase polymerase amplification) primer for detecting point mutation of an H. pylori 23S rRNA (ribosomal Ribonucleic Acid) gene A2143G and a T7 / crDNA (deoxyribonucleic acid) hybrid chain for transcribing and recognizing a crRNA 2143G point mutation of the H. pylori 23S rRNA gene A2143G. Based on the system, the kit disclosed by the invention can specifically recognize the helicobacter pylori clarithromycin drug-resistant gene within 30 minutes, and independent preparation of crRNA is not needed, so that the reagent cost is reduced, the experimental process is simplified, uncovering operation is not needed, and cross contamination is avoided; the detection limit of the kit is 5 copies / [mu] L, no cross reaction exists, and the result of the kit is consistent with that of a Sanger sequencing method in a clinical sample.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of gene detection, in particular to a one-pot rapid detection system, kit and method for clarithromycin-resistant genes of Helicobacter pylori. BACKGROUND

[0002] Helicobacter pylori (H. pylori for short) is a highly infectious gram-negative spiral-shaped bacterium, mainly transmitted through mouth-to-mouth and fecal-oral transmission between people. The H. pylori infection rate in China is about 50-60%, and the infection rate in different regions is also different. The infection rate in economically underdeveloped areas may exceed 60%. After being infected with H. pylori, most patients have no obvious clinical symptoms, and a part of patients may have digestive tract lesions, thereby causing chronic gastritis, peptic ulcer, gastric mucosa-associated lymphoma, and even gastric cancer and other digestive tract diseases. It is listed as a carcinogenic substance by the International Cancer Research Agency.

[0003] The main treatment method for H. pylori infection is the triple therapy or quadruple therapy of proton pump inhibitor (PPI) combined with amoxicillin and clarithromycin (or quinolone) antibiotics. However, due to the increasing resistance rate of clarithromycin and quinolone, the success rate of this therapy is gradually decreasing. Therefore, it is recommended that patients undergo drug sensitivity testing before initial treatment and select sensitive antibiotics. This not only can improve the efficacy of initial treatment, but also can reduce the abuse of antibiotics and the spread of drug-resistant strains.

[0004] At present, the main method for detecting H. pylori resistance in clinical practice is culture and drug sensitivity. Culture and drug sensitivity requires culturing H. pylori first, and then performing drug sensitivity test. The procedure is complex, time-consuming, and it is not easy to culture H. pylori. Sequencing method is complex to operate, has long detection period, and has low sensitivity. Amplification refractory mutation system real-time PCR (ARMS-qPCR) is one of the most important and most widely used technologies for detecting various point mutations in DNA. This technology is stable and repeatable, has high sensitivity and specificity, but it usually requires trained professional technicians to operate special large-scale instruments and equipment, which is not conducive to popularization to primary field detection.

[0005] In recent years, CRISPR / Cas technology has shown very good prospects in pathogen diagnosis, individualized molecular detection of tumors, identification of SNPs, and detection of genetic diseases. Combining isothermal amplification techniques such as RPA with CRISPR / Cas technology can meet the needs of on-site rapid detection. In the CRISPR / Cas13 system, CRISPR RNA (crRNA) is the core guiding element and activation switch of the CRISPR / Cas13 system. However, due to the easy degradation of RNA, it is not easy to store for a long time in the reaction system, which is a pain point and difficulty in the practical application of CRISPR / Cas technology.

[0006] Therefore, there is an urgent need for a method for detecting H. pylori and its drug-resistant mutation sites that is simple to operate, stable and reliable, and has high sensitivity. SUMMARY

[0007] The present application provides a one-pot method for rapidly detecting H. pylori clarithromycin-resistant gene system, kit and detection method. The method does not require separate preparation of crRNA, but uses the T7 transcription system in the one-step system to transcribe crRNA from the T7 / crDNA hybrid chain, and performs transcription and detection simultaneously, making the operation more simple, and also solving the problem of unstable crRNA.

[0008] The technical scheme of the present application is as follows: a one-pot method for rapidly detecting H. pylori clarithromycin-resistant gene system, which includes a detection H. pylori clarithromycin-resistant gene system including RPA amplification primers for detecting H. pylori 23S rRNA gene A2143G point mutation and T7 / crDNA hybrid chain for transcribing crRNA2143G for recognizing H. pylori 23S rRNA gene A2143G point mutation.

[0009] Further, the RPA amplification primers for detecting H. pylori 23S rRNA gene A2143G point mutation include upstream primer RPA-F and downstream primer RPA-R, the nucleotide sequence of the upstream primer RPA-F is any one of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, and the nucleotide sequence of the downstream primer RPA-R is any one of SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6.

[0010] Further, the T7 / crDNA hybridization chain is formed by mixing T7 primer and crDNA at a molar ratio of 1:1, and then denaturing and annealing at high temperature; the nucleotide sequence of the T7 primer is SEQ ID NO. 7, and the nucleotide sequence of the crDNA is any one of SEQ ID NO. 8, SEQ ID NO. 9, and SEQ ID NO. 10.

[0011] The crDNA 3 sequence is artificially mismatched from the 9th base and the 19th base at the 3' end of the target gene.

[0012] Further, the nucleotide sequence of the upstream primer RPA-F is SEQ ID NO. 2, and the nucleotide sequence of the downstream primer RPA-R is SEQ ID NO. 5; the nucleotide sequence of the crDNA is SEQ ID NO. 10.

[0013] The one-pot method rapid detection kit for Helicobacter pylori clarithromycin resistance gene comprises the system.

[0014] Further, U5 is further included, and the nucleotide sequence of U5 is SEQ ID NO. 11, and U5 is labeled with a fluorescent gene FAM at the 5' end and a quenching group BHQ1 at the 3' end.

[0015] The downstream primer RPA-R is added with a T7 promoter complementary sequence at the 5' end on the basis of a conventional RPA primer, so that the amplified product DNA is transcribed into RNA by using a T7 RNA polymerase at the same time, so as to be recognized and trans-cleaved U5 by CRISPR / Cas13a.

[0016] Further, the detection kit comprises 200-800 nM of the upstream primer RPA-F, 200-800 nM of the downstream primer RPA-R, 500 nM of U5, 0.25-2 U / μL of T7 RNA polymerase, 25-200 nM of Cas13a, 0.375-12 nM of T7 / crDNA hybridization chain, 0.5-4 mM of rNTP mix, 1 U / μL of recombinant RNAase inhibitor, 1×RPA Basic E-mix, and 14 mM of MgOAc.

[0017] Further, the detection kit comprises 400 nM of the upstream primer RPA-F, 400 nM of the downstream primer RPA-R, 500 nM of U5, 1 U / μL of T7 RNA polymerase, 50 nM of Cas13a, 1.5 nM of T7 / crDNA hybridization chain, 2 mM of rNTP mix, 1 U / μL of recombinant RNAase inhibitor, 1×RPA Basic E-mix, and 14 mM of MgOAc.

[0018] The one-pot rapid detection method of Helicobacter pylori clarithromycin resistance gene comprises the following steps: Extracting nucleic acid from the sample to be detected as a DNA template, mixing the DNA template with the detection kit, and then incubating, during the incubation process, collecting signals every set time; The method for collecting signals is as follows: collecting FAM fluorescence signals at a wavelength of 465-510 nm, and determining the type of the sample to be detected by observing the FAM fluorescence, if green fluorescence and significant difference compared with the negative control, it is judged that the sample contains A2143G gene mutation, if no light emission and no significant difference compared with the negative control, it is judged that the sample does not contain A2143G gene mutation.

[0019] Further, the incubation condition is: 37 DEG C incubation for 30-60 min.

[0020] Further, the set time is 30-60 s.

[0021] The beneficial effects of the present application are: The present application provides a one-pot rapid detection system, kit and method of Helicobacter pylori clarithromycin resistance gene, which integrates RPA amplification, product DNA transcription into RNA, T7 / crDNA hybrid chain transcription into crRNA, and CRISPR / Cas13a cis cleavage reaction together to establish a one-step reaction system. The method does not need to prepare crRNA separately, but uses the T7 transcription system in the one-step system to transcribe crRNA from T7 / crDNA hybrid chain simultaneously, and detects while transcribing, so that the operation is simpler, and the problem of unstable crRNA is also solved.

[0022] After adding the extracted DNA template into the detection system, the present application does not need to open the cover again, and simultaneously performs RPA amplification and target gene RNA transcription, crRNA transcription and CRISPR detection in one tube, without using precise and expensive instruments and equipment, and the sample of Helicobacter pylori clarithromycin resistance gene can be detected within 30 min at 37 DEG C, realizing rapid, simple, high-sensitivity, high-specificity detection, reducing reagent cost, simplifying experimental process, and without opening the cover operation, avoiding cross contamination.

[0023] The detection limit of the detection system of the present application is 5 copies / μL, there is no cross reaction, and the results are consistent with the Sanger sequencing method (100%). BRIEF DESCRIPTION OF DRAWINGS

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or prior art description will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor on the basis of these drawings.

[0025] Figure 1 Principle diagram of one-pot rapid detection of H. pylori clarithromycin resistance gene of the present application; Figure 2 RPA primer for detecting H. pylori 23S rRNA gene A2143G mutation, and crRNA screening result diagram; Figure 3 T7 / crDNA concentration optimization and detection performance comparison result diagram; Figure 4 Sensitivity test result diagram of the kit of the present application for detecting H. pylori 23S rRNA gene A2143G mutation. DETAILED DESCRIPTION

[0026] The technical solutions in the embodiments of the present application will be described clearly and completely below in combination with the drawings in the embodiments of the present application. Obviously, the described embodiments are only some embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0027] The experimental methods in the following embodiments are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents and the like used in the following embodiments can be obtained from commercial channels, unless otherwise specified.

[0028] The Cas13a in the following embodiments is a product of Tufts University, with a product number of 32117-01.

[0029] The T7 RNA polymerase in the following embodiments is a product of New England Biolabs, with a product number of M0251.

[0030] The rNTP mix in the following embodiments is a product of New England Biolabs, with a product number of N0466L.

[0031] The recombinant RNAase inhibitor in the following embodiments is a product of Wuhan Saiver Biotechnology Co., Ltd., with a product number of G3414.

[0032] The RPA lyophilized powder, RPA resuspension (RPA Basic E-mix), and 280 mM magnesium acetate (MgOAc) in the following examples are TwistDx TM Product number: TABAS03KIT.

[0033] The U5 in the following embodiments was synthesized by Shanghai Sangon Biotech Co., Ltd.

[0034] The primers and crRNA preparation templates used in the following examples were synthesized by Jiangsu Saisofi Company.

[0035] Note: The crRNA described in this invention is prepared by in vitro transcription. Specifically, the in vitro transcription of crRNA mainly includes three steps: annealing hybridization reaction, transcription, and RNA purification, as follows: (1) Preparation of T7 / crDNA hybrid strand: The 10 µL annealing reaction system contained 1 µL of chemically synthesized crDNA (100 µM), 1 µL of T7 primer (sequence: GAAATTAATACGACTCACTATAGGG) (100 µM) or 1 µL of crDNA complementary strand (100 µM) ((the nucleotide sequence of the crDNA3 complementary strand is SEQ ID NO. 12)), 1 µL of Standard Taq buffer (10×) (purchased from New England Biolabs, catalog number B9014), and 7 µL of enzyme-free sterile water (purchased from Solarbio, catalog number R1600); the reaction system was denatured at 95 °C for 5 min on an ABI PCR instrument (Thermo, model: Veriti96), and then annealed to 4 °C at a cooling rate of 0.1 °C / s.

[0036] (2) Transcription of crRNA: The HiScribe™ T7 Rapid and Efficient RNA Synthesis Kit (purchased from New England Biolabs, catalog number E2040) was used to transcribe the annealing reaction product according to the manufacturer's instructions and incubate it in a metal bath at 37 °C for 8-12 h.

[0037] (3) RNA purification: Deoxyribonuclease (purchased from Promega, catalog number M6101) was used to degrade excess DNA in the transcription product. Subsequently, according to the manufacturer's instructions, the RNA obtained from transcription was purified using the RNA Clean & Concentrator-5 Kit (purchased from ZYMO, catalog number R1013) to complete the preparation of crRNA. The prepared crRNA was quantified using a NanoDrop™ One ultra-micro spectrophotometer (Thermo, model: NanoDrop One) and stored at -80 ℃ for long-term use.

[0038] Preparation of double-stranded crDNA: Double-stranded crDNA annealing hybridization reaction: The 10 µL annealing reaction system contained 1 µL of chemically synthesized crDNA (100 µM), 1 µL of T7 primer (sequence: GAAATTAATACGACTCACTATAGGG) (100 µM) or 1 µL of crDNA complementary strand (100 µM), 1 µL of Standard Taq buffer (10×) (purchased from New England Biolabs, catalog number B9014), and 7 µL of enzyme-free sterile water (purchased from Solarbio, catalog number R1600); the reaction system was denatured at 95 °C for 5 min on an ABI PCR instrument (Thermo, model: Veriti96), and then annealed to 4 °C at a cooling rate of 0.1 °C / s.

[0039] Unless otherwise specified, the quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0040] The following examples used GraphPad Prism statistical software to process the data. The experimental results are expressed as mean ± standard deviation. The Two-tailed Student's t test was used. P < 0.0001 (****), P < 0.001 (***), P < 0.01 (**), P < 0.05 (*), and NS indicates that P > 0.05 is not statistically significant.

[0041] I. Design and synthesis of target crRNA The *H. pylori* 23S rRNA gene sequence was obtained from GenBank (GenBank ID: NR_076155). Detection sites were selected from the A2143G mutation region of the 23S rRNA gene sequence to design multiple crRNAs for the Cas13a protein. As shown in Table 1, the crRNAs for the A2143G mutation of the 23S rRNA gene are: SEQ ID NO. 8, SEQ ID NO. 9, and SEQ ID NO. 10 in Sequence Listing 2.

[0042] Table 1. crRNA prepared by in vitro transcription

[0043] II. Design and synthesis of RPA amplification primers Based on the H. pylori 23S rRNA gene sequence described above, upstream primer RPA-F and downstream primer RPA-R were designed for RPA amplification. A T7 promoter complementary sequence was added to the 5' end of the downstream primer to generate an ssRNA sequence that can be recognized and cleaved by Cas13a. The upstream primer RPA-F for the 23S rRNA gene is SEQ ID NO. 1, SEQ ID NO. 2, and SEQ ID NO. 3 in Sequence Listing 2; the downstream primer RPA-R for the 23S rRNA gene is SEQ ID NO. 4, SEQ ID NO. 5, and SEQ ID NO. 6 in Sequence Listing 2.

[0044] Table 2 RPA primer sequences and crRNA sequences

[0045] Note: Bold bases with a gray background indicate mutation sites; bold italicized bases with underlines indicate artificial mismatches; straight lines indicate repetitive sequences; and wavy lines indicate complementary sequences to the T7 promoter.

[0046] III. Rapid DNA Extraction H. pylori DNA was extracted using a rapid nucleic acid extraction kit (KAPA, catalog number: KK7101) following the kit instructions. The extracted DNA was stored at -20 °C.

[0047] IV. RPA-crRNA-CRISPR / Cas13a reaction The 10 μL reaction system for detecting the H. pylori clarithromycin resistance gene (referred to as the crRNA system) included 400 nM upstream primer RPA-F, 400 nM downstream primer RPA-R, 500 nM U5, 1 U / μL T7 RNA polymerase, 50 nM Cas13a, 100 nM crRNA, 2 mM rNTP mix, 1 U / μL recombinant RNase inhibitor, 1×RPA Basic E-mix, and 14 mM MgOAc. DNA template was then added to the detection kit, and the reaction was performed at 37 °C for 30 min on a Bio-Rad CFX96 real-time PCR instrument. FAM fluorescence signals were collected every 1 min at wavelengths of 465-510 nm.

[0048] V. RPA-double-stranded crDNA-CRISPR / Cas13a reaction The 10 μL reaction system for detecting the H. pylori clarithromycin resistance gene (referred to as the double-stranded crDNA system) included 400 nM upstream primer RPA-F, 400 nM downstream primer RPA-R, 500 nM U5, 1 U / μL T7 RNA polymerase, 50 nM Cas13a, 1.5 nM double-stranded crDNA, 2 mM rNTP mix, 1 U / μL recombinant RNase inhibitor, 1×RPA Basic E-mix, and 14 mM MgOAc. Afterwards, DNA template was added to the detection kit, and the reaction was performed at 37°C for 30 min on a Bio-Rad CFX96 real-time PCR instrument. FAM fluorescence signals were collected every 1 min at wavelengths of 465-510 nm.

[0049] VI. RPA-T7 / crDNA-CRISPR / Cas13a reaction The reaction system for detecting the H. pylori clarithromycin resistance gene (referred to as the T7 / crDNA hybridization system) consisted of 400 nM upstream primer RPA-F, 400 nM downstream primer RPA-R, 500 nM U5, 1 U / μL T7 RNA polymerase, 50 nM Cas13a, 1.5 nM T7 / crDNA hybridization strand, 2 mM rNTP mix, 1 U / μL recombinant RNase inhibitor, 1×RPABasic E-mix, and 14 mM MgOAc. DNA template was then added to the detection kit, and the reaction was performed at 37 °C for 30 min on a Bio-Rad CFX96 real-time PCR instrument. FAM fluorescence signals were collected every 1 min at wavelengths of 465-510 nm.

[0050] VII. Result Interpretation The type of sample to be tested is determined by observing the FAM fluorescence. If there is FAM fluorescence and it is significantly different from the negative control, the sample is judged to contain the A2143G gene mutation. If there is no fluorescence and the fluorescence value is not significantly different from the negative control, the sample is judged not to contain the A2143G gene mutation.

[0051] RPA-CRISPR / Cas13a reaction system was used to screen RPA amplification primers and crRNA: The RPA amplification primers F1~F3, R1~R3 ​​of the H. pylori 23S rRNA gene A2143G mutation prepared above were screened with crRNA1-3 (sequences are shown in Table 1 and Table 2). Figure 2 The image shows the RPA primer and crRNA screening results for detecting the A2143G mutation in the H. pylori 23S rRNA gene. F1~F3 are abbreviations for RPA-F1~F3, and R1~R3 ​​are abbreviations for RPA-R1~R3. Figure 2 As shown, Figure 2 At 30 cycles (i.e., 30 min incubation), the fluorescence ratio of the A2143G mutation to the wild type was detected using different RPA amplification primers and different crRNA combinations. Fluorescence detection results showed that the RPA amplification primer pair F2 / R2 combined with crRNA3 was the most effective, exhibiting the highest fluorescence ratio (5.74-fold) for detecting the A2143G mutation to the wild type. Therefore, SEQ ID NO. 10 and primer pair F2 / R2 (SEQ ID NO. 2 / SEQ ID NO. 5) were selected for the RPA-CRISPR / Cas13a reaction of the 23S rRNA gene A2143G mutation.

[0052] T7 / crDNA Concentration Optimization and Performance Comparison: Without the addition of crRNA, we tested RPA-CRISPR / Cas13a detection with different concentrations of T7 / crDNA hybrid strands, and all of them produced signal amplification. Figure 3 A), Figure 3 A represents the detection results of the T7 / crDNA hybridization system. Figure 3 The left figure (A) shows the fluorescence curve of RPA-CRISPR / Cas13a detection for the A2143G mutation in the H. pylori 23S rRNA gene. Figure 3 Figure A (right) shows the endpoint relative fluorescence units obtained after 30 min of RPA-CRISPR / Cas13a detection of the 23S rRNA gene A2143G mutation. The results indicate that the RPA-CRISPR / Cas13a reaction system exhibits optimal detection performance under 1.5 nM T7 / crDNA hybridization conditions.

[0053] Figure 3 B represents the fluorescence detection results for the crRNA system (corresponding to crRNA), the double-stranded crDNA system (corresponding to crDNAds), and the T7 / crDNA hybridization system (corresponding to T7 / crDNA). Under the optimal concentration conditions selected from the T7 / crDNA hybridization, [the following data was obtained]. Figure 3 As shown in Figure B, in the RPA-CRISPR / Cas13a reaction detecting the A2143G mutation in the H. pylori 23S rRNA gene, the T7 / crDNA hybrid strand exhibited performance comparable to crRNA. These results indicate that T7 / crDNA can serve as a functional substitute for crRNA in the presence of T7 transcription. In the RPA-CRISPR / Cas13a system, the T7 / crDNA strategy thus establishes a new positive synergistic effect between T7 transcription and CRISPR. More broadly, the advantage of achieving in-situ real-time generation and supply of crRNA via T7 / crDNA can be applied to all CRISPR detection systems compatible with T7 transcription. Compared to crRNA and crDNAds, this technology promises to reduce the operational difficulty, complexity, and cost associated with RNA use, while improving the ease of detection and user experience.

[0054] Sensitivity and specificity tests of the detection kit (one-pot RPA-T7 / crDNA-CRISPR / Cas13a) To determine the sensitivity of the one-pot RPA-T7 / crDNA-CRISPR / Cas13a reaction for the H. pylori 23S rRNA gene A2143G mutation, wild-type H. pylori samples and 23S rRNA gene A2143G mutant samples (genotype determined by Sanger sequencing) were used. Figure 4 A represents the wild-type sequencing result. Figure 4 B represents the sequencing results of the A2143G mutation (H. pylori DNA concentration determined by digital PCR). The samples were then sequentially diluted to the set concentrations and analyzed according to the optimized detection system. Results are as follows: Figure 4 As shown in Figure C, for the detection of the A2143G mutation in the H. pylori 23S rRNA gene, the fluorescence signal after 30 min amplification of templates with a concentration of 5 copeis / μL or higher was significantly higher than that of the wild-type WT group. This indicates that the H. pylori clarithromycin resistance gene detection system based on the one-pot RPA-T7 / crDNA-CRISPR / Cas13a established in this invention can detect samples with a concentration of 5 copeis / μL or higher and has high sensitivity.

[0055] Clinical sample validation of the detection kit (one-pot RPA-T7 / crDNA-CRISPR / Cas13a) To explore the clinical applicability of this method, 36 clinical samples were collected in this application and tested according to the optimized detection system. The results are shown in Table 3. The results show that all samples were accurately identified. The detection results of the clinical samples by the method described in this application are completely consistent with those of the Sanger sequencing method, indicating that this method can not only meet the clinical testing needs, but also has the advantages of short detection time and convenient operation.

[0056] Table 3. Clinical sample validation results of Sanger sequencing and the one-pot method of this application for detecting the A2143G mutation in the H. pylori 23S rRNA gene.

[0057] The Sanger sequencing method used in this study to detect the A2143G mutation in the H. pylori 23S rRNA gene served as a control for the one-pot RPA-T7 / crDNA-CRISPR / Cas13a detection method. Sanger sequencing of 36 H. pylori samples was commissioned to Beijing Tianyi Huiyuan Biotechnology Co., Ltd.

[0058] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A one-pot system for rapid detection of clarithromycin-resistant gene of Helicobacter pylori, characterized in that: The RPA amplification primer for detecting the H. pylori 23S rRNA gene A2143G point mutation and the T7 / crDNA hybrid chain for transcribing the crRNA 2143G for recognizing the H. pylori 23S rRNA gene A2143G point mutation. ​ 2. The system of claim 1, wherein: The RPA amplification primer comprises an upstream primer RPA-F and a downstream primer RPA-R, the nucleotide sequence of the upstream primer RPA-F is any one of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, and the nucleotide sequence of the downstream primer RPA-R is any one of SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO.

6.

3. The system of claim 2, wherein: The T7 / crDNA hybrid chain is formed by mixing T7 primer and crDNA at a molar ratio of 1:1 and denaturing and annealing at high temperature; the nucleotide sequence of the T7 primer is SEQ ID NO. 7, and the nucleotide sequence of the crDNA is any one of SEQ ID NO. 8, SEQ ID NO. 9, and SEQ ID NO.

10.

4. The system of claim 3, wherein: The nucleotide sequence of the upstream primer RPA-F is SEQ ID NO. 2, and the nucleotide sequence of the downstream primer RPA-R is SEQ ID NO. 5; the nucleotide sequence of the crDNA is SEQ ID NO.

10.

5. A kit for one-pot rapid detection of clarithromycin-resistant gene of Helicobacter pylori, characterized in that: The system comprises any one of claims 1-4.

6. The kit of claim 5, wherein: The kit further comprises U5, and the nucleotide sequence of U5 is SEQ ID NO. 11, and U5 is labeled with a fluorescent gene FAM at the 5' end and a quenching group BHQ1 at the 3' end.

7. The kit of claim 6, wherein: 200-800 nM upstream primer RPA-F, 200-800 nM downstream primer RPA-R, 500 nM U5, 0.25-2 U / μL T7 RNA polymerase, 25-200 nM Cas13a, 0.375-12 nM T7 / crDNA hybrid chain, 0.5-4 mM rNTP mix, 1 U / μL recombinant RNAase inhibitor, 1×RPA Basic E-mix, and 14 mM MgOAc.

8. The kit of claim 7, wherein: 400 nM upstream primer RPA-F, 400 nM downstream primer RPA-R, 500 nM U5, 1 U / μL T7 RNA polymerase, 50 nM Cas13a, 1.5 nM T7 / crDNA hybrid chain, 2 mM rNTP mix, 1 U / μL recombinant RNAase inhibitor, 1×RPA Basic E-mix, and 14 mM MgOAc.

9. A one-pot method for rapid detection of clarithromycin-resistant gene of Helicobacter pylori, characterized in that, The method comprises the following steps: extracting nucleic acid from a sample to be tested as a DNA template, mixing the DNA template with the detection kit of any one of claims 5-8, and then incubating, and during the incubation, collecting signals at a set time interval; The method for collecting signals is as follows: the FAM fluorescence signal is collected at a wavelength of 465-510 nm, the type of the sample to be detected is determined by observing the FAM fluorescence, if green fluorescence is observed and there is a significant difference compared with the negative control, it is judged that the sample contains the A2143G gene mutation, if no fluorescence is observed and there is no significant difference compared with the negative control, it is judged that the sample does not contain the A2143G gene mutation.

10. The detection method according to claim 9, characterized in that, The incubation condition is: incubation at 37 DEG C for 30-60 min.