Ensifer.sp and method for producing L-carnitine through fermentation of Ensifer.sp

Abstract

The invention discloses ensifer Ensifer.sp and a method for producing L-carnitine through fermentation of the ensifer Ensifer.sp, and belongs to the technical field of biology. The strain is screened and separated from soil, is gram negative bacteria, is rod-shaped, has flagellum, can grow by taking betaine as a unique carbon and nitrogen source, and is preserved in the China Center for Type Culture Collection on September 25, 2025, the preservation number of the strain is CCTCC NO: M 20252114, under a shake flask condition, the concentration of L-carnitine is 6g / L, the molar conversion rate of a substrate is 99%, and under a fermentation tank loading condition, the concentration of the L-carnitine in the fermentation tank is 1L / L; the concentration of produced L-carnitine can reach 15.1 g / L, and the molar conversion rate of a substrate is 80.8%. An infrared spectrogram of a crystallization product extracted from fermentation liquor is consistent with that of an L-carnitine standard sample, and the specific rotation is-30.0 degrees. The invention provides the L-carnitine production method with small environmental pollution, and the L-carnitine production method has a good application prospect.

Description

Technical Field

[0001] This invention relates to a fungus Ensifer.sp and a method for producing L-carnitine by fermentation, belonging to the field of biotechnology. Background Technology

[0002] L-carnitine, also known as L-carnitine or vitamin BT, has the chemical formula C7H15NO3 and the chemical name (R)-3-carboxy-2-hydroxy-N,N,N-trimethylpropylammonium hydroxide inner salt. Its relative molecular mass is 161.20. It is a white crystalline or crystalline powder with a slightly fishy odor. L-carnitine is a water-soluble vitamin and amino acid-like nutrient, primarily functioning as a carrier for transporting fatty acids across the mitochondrial membrane in mammals. Currently, it is widely used as a food additive in infant formula, weight-loss foods, athletic foods, nutritional supplements for the elderly, nutritional fortifiers for vegetarians, and animal feed additives. Currently, most commercially available L-carnitine is chemically synthesized using epichlorohydrin as a raw material. While the chemical synthesis process is mature, it causes severe environmental pollution and introduces cyanide during production, raising safety concerns. This has spurred research into biotechnology-based L-carnitine production. Among these methods, the transformation of precursor substrates using microbial cells has become a growing trend in L-carnitine production in recent years.

[0003] Most microorganisms have the ability to convert some precursor substances into L-carnitine, including hundreds of species from dozens of genera of bacteria, actinomycetes, molds, and yeasts. There are currently two main methods for microbial production of L-carnitine. One method involves using microorganisms capable of metabolizing L-carnitine precursors (such as γ-butyl betaine or croton betaine) to ferment and convert the precursors. The other method is enzymatic production, such as using carnitine dehydratase, carnitine racemic enzyme, or carnitine amidase to enzymatically resolve the precursors, or using γ-butyl betaine hydroxylase or α-N-trimethyllysine hydroxylase for enzymatic synthesis. US Patent 4708936 discloses that the Swiss company Lonza uses microorganism DSM NO.3225 (HK13) and a cell recycling system to produce L-carnitine. This bacterium is intermediate between Agrobacterium and Rhizobium, lacking L-carnitine dehydrogenase. Under high cell concentrations, it can convert γ-butylbetaine into L-carnitine, with a yield of 60 g / L. This is currently the only successful method for industrial-scale production of L-carnitine.

[0004] Japanese Patent Hei 4-27395 discloses a method for producing L-carnitine using strains of *Achromobacter* or *Pseudomonas* from the substrate γ-butylbetaine, wherein the method utilizes strains deficient in L-carnitine dehydrogenase. Achromobacter cycloclastATCC21921 can produce 1.79 mg / mL L-carnitine, and its mutant strain 16-5 can produce 25.6 mg / mL L-carnitine. Fed-batch fermentation for 192 hours yields 63.8 mg / mL L-carnitine. Chinese patent CN96117166.9 discloses a method for enzymatic production of L-carnitine. Through ultraviolet and Co-60 mutagenesis, different L-carnitine-producing strains (CGMCC0276) were obtained. Then, the enzyme-producing strain (CGMCC0276) was induced and cultured, and the cells were collected by centrifugation. Using free or immobilized cells as the enzyme source and croton betaine as the substrate, L-carnitine was produced through enzymatic conversion. The L-carnitine concentration reached 15 g / L. Furthermore, the final step in L-carnitine biosynthesis in animals and some fungi is catalyzed by γ-butylbetaine hydroxylase (an iron / 2-oxoglutarate-dependent oxygenase). There are also reports of L-carnitine production using γ-butylbetaine hydroxylase. For example, Ma Xiaohang et al. from Zhejiang University cloned the γ-butylbetaine hydroxylase gene bbh from Pseudomonas L-1 and achieved its efficient expression in Escherichia coli. L-carnitine production using recombinant E. coli expressing the bbh gene in quiescent cells was achieved, yielding up to 12.7 mmol / L. However, the yield of L-carnitine produced by enzymatic methods is generally low. Although microbial fermentation yields are high, this is limited to a few patented strains. Summary of the Invention

[0005] To address the shortcomings of the existing technology, this invention screened a plant from the soil. Ensifer.sp The strain WQ-1 was found to produce L-carnitine by adding the precursor substrates γ-butyl betaine or croton betaine during its culture. Furthermore, the cultured microbial cells can be reused, and high-purity L-carnitine can be obtained by separating and purifying the fermentation broth. The aim is to solve the lack of technical solutions for the efficient conversion and production of L-carnitine strains.

[0006] The first technical solution provided by this invention is a strain of sword fungus ( Ensifer canadensis WQ-1 was deposited at the China Center for Type Culture Collection on September 25, 2025, with accession number CCTCC NO: M 20252114.

[0007] The strain has short rod-shaped cells. On solid culture media, colonies are translucent; after 7 days of culture, colonies turn slightly reddish and are non-spore-forming. The optimal growth temperature range is 28-35℃. The 16S rRNA gene sequence is compared with multiple strains. Ensifer.sp The 16S rRNA sequence of the bacteria has a similarity of over 99%.

[0008] The second technical solution provided by the present invention is a microbial preparation containing the *Streptococcus faecium* WQ-1 described in the first technical solution.

[0009] The third technical solution provided by the present invention is a whole-cell catalyst, wherein the whole-cell catalyst contains the *Brachys lanceolata* WQ-1 described in the first technical solution or the microbial preparation described in the second technical solution.

[0010] The fourth technical solution provided by the present invention is a method for producing L-carnitine, wherein the method utilizes the *Streptococcus faecium* WQ-1 described in the first technical solution, the microbial preparation described in the second technical solution, or the whole-cell catalyst described in the third technical solution to ferment and transform the precursor to produce L-carnitine, wherein the precursor is γ-butyl betaine or croton betaine.

[0011] In some implementations, the following steps are included: (1) The seed culture of *Strombus haematocephala* WQ-1 was inoculated into the fermentation medium at an inoculation rate of 1% to 10%, and cultured with shaking for 12 to 24 hours to obtain the fermentation broth: (2) Add the precursor to the fermentation culture medium in step (1) to continue fermentation and transformation, or isolate the strain cells from the fermentation culture medium in step (1) as a biocatalyst and carry out the transformation reaction in the fermentation medium containing the precursor.

[0012] In some embodiments, in step (1), the sword fungus WQ-1 is inoculated into a seed culture medium and cultured with shaking at 25-37°C and 120-220 rpm for 24-36 h to obtain the seed liquid of strain WQ-1. Seed culture medium formula (L): Lysine 3-6 g, betaine 5-15 g, disodium hydrogen phosphate 5-25 g, potassium dihydrogen phosphate 5-10 g, magnesium sulfate 0.1-0.5 g, ferric sulfate 0.01-0.05 g, yeast extract 0.1-0.5 g, manganese sulfate 0.1-0.5 mg, copper sulfate 0.1-0.5 mg, zinc sulfate 0.1-0.5 mg, calcium chloride 5-10 mg, cobalt chloride 0.1-0.5 mg, ammonium molybdate 0.5-1.0 mg, pH 7.0-7.5, sterilized at 121℃ for 20 min.

[0013] In some embodiments, the fermentation medium formulation in step (1) is as follows (L): betaine 5~15 g, disodium hydrogen phosphate 5~25 g, potassium dihydrogen phosphate 5~10 g, magnesium sulfate 0.1~0.5 g, ferric sulfate 0.01~0.05 g, yeast extract 0.1~0.5 g, manganese sulfate 0.1~0.5 mg, copper sulfate 0.1~0.5 mg, zinc sulfate 0.1~0.5 mg, calcium chloride 5~10 mg, cobalt chloride 0.1~0.5 mg, ammonium molybdate 0.5~1.0 mg, pH 7.0~7.5, sterilized at 121℃ for 20 min.

[0014] In some embodiments, in step (2), the final concentration of the precursor added is 1~20 g / L, added in portions or all at once, with the temperature controlled at 28-35℃, pH 7.0, time 24h~72h, and 180-220 rpm.

[0015] In some embodiments, step (3) is also included, which involves removing impurities with ion exchange resin and decolorizing with activated carbon, followed by vacuum concentration and crystallization with anhydrous ethanol / acetone to obtain L-carnitine.

[0016] Further, step (3) is as follows: add cation exchange resin to the conversion solution of step (2), elute with ammonia, collect the carnitine-containing part, process it and pass it through an anion exchange column, decolorize it with activated carbon, concentrate it under vacuum until it becomes viscous, and then add anhydrous ethanol and acetone to crystallize it.

[0017] The fifth technical solution provided by this invention is the application of the method described in the first technical solution (WQ-1), the microbial preparation described in the second technical solution, the whole-cell catalyst described in the third technical solution, or the method described in the fourth technical solution in the preparation of L-carnitine or products containing L-carnitine.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention isolates a strain of *Brachys lanceolata* capable of converting high concentrations of the substrates γ-butyl betaine or croton betaine into L-carnitine. Ensifer.sp WQ-1, a microbial fermentation method, produces L-carnitine from a high-concentration substrate. Under shake-flask conditions, the concentration of L-carnitine produced is 6 g / L, with a molar conversion rate of 99%. Under tank fermentation conditions, the concentration of L-carnitine produced can reach 15.1 g / L, with a molar conversion rate of 80.8%. The infrared spectrum of the crystalline product extracted from the fermentation broth is consistent with that of the L-carnitine standard, with a specific rotation of -30.0°. Furthermore, the microbial cells can be reused repeatedly. This invention offers mild conversion conditions, minimal environmental pollution, and promising application prospects.

[0019] Preservation of biological material samples: sword mushroom ( Ensifer canadensis WQ-1, taxonomic name is Ensifer canadensis It has been deposited at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Wuhan, China, on September 25, 2025, with accession number CCTCC NO: M 20252114. Attached Figure Description

[0020] Figure 1 This is a scanning electron microscope image of strain WQ-1.

[0021] Figure 2The images show the HPLC analysis results of the fermentation broth. The left image represents the standard, and the right image represents the fermentation broth.

[0022] Figure 3 Phylogenetic tree of 16S rRNA.

[0023] Figure 4-8 For the phylogenetic tree of the family gene. Detailed Implementation

[0024] Reference Figures 1-8 The preferred embodiments of the present invention will be described below. It should be understood that the embodiments are for better explanation of the present invention and are not intended to limit the present invention.

[0025] Test method: Fermentation and transformation: The bacterial cells were inoculated onto slant culture medium and cultured at 28-35℃ for 1-3 days. Using a sterile inoculation loop, one loopful of cells was inoculated onto seed culture medium and cultured with shaking at 25-37℃ and 120-220 rpm for 24-36 hours. The inoculation was then carried out at a rate of 1-10% (v / v) onto fermentation medium. The fermentation temperature was 25-37℃ and the rotation speed was 120-220 rpm. The fermentation conversion took 36-48 hours. Alternatively, the broth was packaged into a 5L fermentation tank and cultured at 300-500 rpm. The inoculation amount and temperature were the same as those for Erlenmeyer flask fermentation. The fermentation took 48-240 hours.

[0026] (1) During shake-flask fermentation, the initial substrate γ-butyl betaine or croton betaine is 1~10 g / L. After 12~24 h of fermentation, the substrate is added to 6~20 g / L and fermentation continues for 24~36 h.

[0027] (2) When fermenting in a fermenter, the initial substrate γ-butyl betaine or croton betaine is 1~10 g / L. When the conversion rate reaches more than 80% 24~36 h after the start of fermentation, the substrate and betaine are supplemented to 15~25 g / L and 20~30 g / L respectively, and fermentation continues until the substrate is exhausted.

[0028] Product extraction: After fermentation, the fermentation broth was collected, subjected to cation exchange column chromatography, eluted with ammonia, and the carnitine-containing fraction was collected. The fraction was then subjected to anion exchange column and activated carbon decolorization. After vacuum concentration to a viscous state, anhydrous ethanol and acetone were added for crystallization.

[0029] Product analysis methods: The components of the product in the conversion solution were analyzed by HPLC. The system used was a Shimadzu LC-20AB, with a system controller of CBM-20A, a UV-VIS detector of SPD-20AV, and a column oven of CT0-20A. The column was a C18 5μm column (4.6*250mm). Detection conditions were: detection wavelength 210nm, column temperature 30℃, mobile phase 0.002 mol / L sodium octane sulfonate solution (with 0.125% potassium dihydrogen phosphate and 0.125% dipotassium hydrogen phosphate, adjusted to pH 3.0 with phosphoric acid) - acetonitrile (92:8, V:V), flow rate 1.0 L / min, and injection volume 10 μL.

[0030] Raw materials used in the examples: Microbial slant culture medium (L): peptone 8-15g, beef extract 1-10g, NaCl 1-10g, agar 15-20g, pH 7.0-7.5.

[0031] Screening plate medium (L): betaine 1-10 g, γ-butylbetaine 1-10 g, croton betaine 1-10 g, disodium hydrogen phosphate 5-25 g, potassium dihydrogen phosphate 5-10 g, magnesium sulfate 0.1-0.5 g, ferric sulfate 0.01-0.05 g, yeast extract 0.01-0.5 g, manganese sulfate 0.1-0.5 mg, copper sulfate 0.1-0.5 mg, zinc sulfate 0.1-0.5 mg, calcium chloride 5-10 mg, cobalt chloride 0.1-0.5 mg, ammonium molybdate 0.5-1.0 mg, pH 7.0-7.5.

[0032] Fermentation medium (L): betaine 5~20g, disodium hydrogen phosphate 5~25g, potassium dihydrogen phosphate 5~10g, magnesium sulfate 0.1~0.5g, ferric sulfate 0.01~0.05g, yeast extract 0.1~0.5g, manganese sulfate 0.1~0.5mg, copper sulfate 0.1~0.5mg, zinc sulfate 0.1~0.5mg, calcium chloride 5~10mg, cobalt chloride 0.1~0.5mg, ammonium molybdate 0.5~1.0mg, substrate γ-butyl betaine or croton betaine 1~80g. pH 7.0~7.5, sterilize at 121℃ for 20 min.

[0033] Example 1 Identification of WQ-1 strain Multiple soil samples were collected from the surrounding areas of Wuxi and diluted to appropriate concentrations. These samples were then added to screening medium and cultured at 30°C with shaking for 6 days. Single bacteria were picked from isolation plates and inoculated onto slant culture medium, and then stored after 24 hours of incubation at 30°C. One loop of bacteria was inoculated from the slant into fermentation medium and cultured at 30°C and 200 rpm for 48 hours. The L-carnitine content in the supernatant was measured by centrifugation. Strain WQ-1 showed significant accumulation of L-carnitine, reaching 2.42 g / L.

[0034] Physiological and biochemical identification was performed according to Bergey's Manual of Bacterial Identification, combined with homology comparison between 16S rRNA and housekeeping genes. Details are as follows: Chromosomal DNA was extracted from strain WQ-1, and the 16S rRNA gene sequence of the strain was amplified by PCR. The 16S rRNA gene sequence (SEQ ID NO.1) was determined and compared with multiple strains of the genus *Xiong*. Ensifer Sp .) and Rhizobium sinense ( Sinorhizobium sp. The 16S rRNA gene sequence similarity of the bacteria is over 99%.

[0035] The genome of WQ-1 was extracted using the Ezup column-based bacterial genomic DNA extraction kit from Shanghai Sangon Biotech Co., Ltd. DNA samples were tested, and after passing the tests, they were randomly fragmented using a Covaris ultrasonic disruptor. The entire library preparation process involved end repair, A-tailing, sequencing adapter addition, purification, and PCR amplification. After library construction, preliminary quantification was performed using Qubit 3.0 to dilute the library. Then, Qsep100 was used to detect the insert size. Once the insert size met expectations, the effective concentration of the library was accurately quantified using Q-PCR (effective concentration > 3 nM) to ensure library quality. After passing the library tests, different libraries were pooled into flowcells according to the effective concentration and target data volume requirements. After cBOT clustering, the DNA libraries were sequenced and assembled using the Illumina HiSeq high-throughput sequencing platform based on Sequencing By Synthesis (SBS) technology (contracted to Shanghai Jiyin Biotechnology Co., Ltd.). The assembly results showed that the WQ-1 genome size was 6.97 Mbp, the GC content was 61.68%, and it contained 93 scaffolds. Gene prediction of the bacteria was performed using Prodigal-2.6.2 software, predicting 6623 genes.

[0036] Chromosomal DNA was extracted from the screened strain WQ-1 using a bacterial genomic DNA extraction kit (Shanghai Sangon Biotech Ezup column-type bacterial genomic DNA extraction kit). The 16S rRNA gene was amplified by PCR using universal bacterial primers (upstream primer ACGGTTACCTTGTTACGACTT, downstream primer AGAGTTTGATCCTGGCTCAG). Sequencing was performed by Suzhou Genewiz Biotechnology Co., Ltd., and the obtained 16S rRNA gene sequence fragment was compared with the 16S rRNA gene sequences of related strains retrieved from GenBank using BLAST (Table 1). The phylogenetic tree is shown below. Figure 3 It has high homology with *Rhizobium sinense* and *Cyclocarya paliurus*.

[0037] Table 1. Homology Analysis of 16S rRNA

[0038] Furthermore, a simplified genome sequence of strain WQ-1 was performed, and phylogenetic analysis was conducted on its housekeeping genes pnp, atpD, gltA, rpoB, and gyrB gene sequences (SEQ ID NO. 2~6) (Table 2). The housekeeping gene analysis results showed that the five housekeeping genes were related to… Ensifer canadensis They are most homologous and belong to the same branch. See the phylogenetic tree of housekeeping genes. Figure 4-8 .

[0039] Table 2. Homology Analysis of Housekeeping Genes

[0040] The WQ-1 strain has a short rod-shaped cell morphology (e.g., ... Figure 1 (As shown), 0.5-0.9×1.2-3.2μm, motile, sparsely trichomes, non-spore-forming, Gram-negative, colonies are translucent on solid media, turning slightly reddish after 7 days of culture, non-spore-forming, flagellated, can grow with betaine as the sole carbon and nitrogen source, optimal growth temperature range 28-45℃, optimal pH range 6-9. Identified according to the physiological and biochemical characteristics in the "Handbook of Systematic Identification of Common Bacteria", oxidase positive, catalase positive, indole negative, MR negative, VP negative, no gelatin liquefaction ability, cannot utilize glucose, lactose, mannitol, inositol, sorbitol, rhamnose, sucrose, melibiose, amygdalin, or arabinose to produce acid, ONPG positive, can decarboxylate arginine, lysine, and ornithine, urease positive, salt tolerance 5%, can grow at pH 5-9, and can grow at 4℃-45℃.

[0041] Example 2: WQ-1 Genome Sequencing and Data Analysis Sample preparation and data preprocessing: Take 1 mL of overnight cultured WQ-1 bacterial culture and use the Ezup column-based bacterial genomic DNA extraction kit from Sangon Biotech Co., Ltd. to extract genomic DNA from WQ-1. Then, the DNA sample is tested. Genomic data assembly and functional annotation: After the DNA sample passed the test, it was randomly fragmented using a Covaris ultrasonic disruptor, and then the entire library preparation work was completed through steps such as end repair, addition of A tail, addition of sequencing adapter, purification, and PCR amplification. After library construction, preliminary quantification was performed using Qubit 3.0 to dilute the library. Then, Qsep100 was used to detect the size of the inserted fragments. Once the inserted fragments met expectations, Q-PCR was used to accurately quantify the effective concentration of the library (effective concentration > 3 nM) to ensure library quality. After passing the library detection, different libraries were pooled into flowcells according to the effective concentration and target data volume requirements. After cBOT clustering, the DNA library was sequenced using the Illumina HiSeq high-throughput sequencing platform (Shanghai Jiyin Biotechnology Co., Ltd.) based on Sequencing By Synthesis (SBS) technology. The optimized sequence was then assembled using SPAdes v3.11.1 assembly software with multiple Kmer parameters (107, 117, 127) to obtain the optimal assembly results. The results are shown in Table 3. The WQ-1 genome size is 6.97 Mbp, the GC content is 61.68%, and it contains 93 scaffolds. Then, Prodigal-2.6.2 software was used to predict bacterial genes, and 6623 genes were predicted. L-carnitine synthesis-related enzyme gene mining: BLAST software was used to align all genes with the Nr, Swiss-Prot, GO, eggNOG / COG, KOG, KEGG, and Pfam databases. Gene annotation information was obtained. Genes related to L-carnitine metabolism mined from the annotated data include carnitine monooxygenase oxygenase subunits (G96_01088, G96_00260), carnitine acyl-CoA dehydratase (G96_01853), L-carnitine dehydrogenase (G96_01857), croton betaine / carnitine-CoA ligase (G96_01999), carnitine transport ATP-binding protein OpuCA (G96_04304), glycine betaine / carnitine transport permease protein GbuB (G96_05188), and HTH-type transcriptional regulator CdhR (G96_06122). Table 3. Genomic characteristics of WQ-1

[0042] Example 3: Shake-flask fermentation conversion The fermentation medium formulation (L) in this embodiment consists of: 10 g betaine, 15 g disodium hydrogen phosphate, 6 g potassium dihydrogen phosphate, 0.5 g magnesium sulfate, 0.01 g ferric sulfate, 0.2 g yeast extract, 0.17 mg manganese sulfate, 0.2 mg copper sulfate, 0.2 mg zinc sulfate, 7 mg calcium chloride, 0.2 mg cobalt chloride, 0.6 mg ammonium molybdate, pH 7.0~7.5, sterilized at 121℃ for 20 min.

[0043] Bacterial cells WQ-1 were inoculated onto slant culture medium and cultured at 28-35℃ for 1-3 days. A loopful of cells was then inoculated onto seed culture medium and cultured with shaking at 25-37℃ and 120-220 rpm for 24-36 hours to obtain the seed culture of strain WQ-1. The seed culture of strain WQ-1 was then inoculated into 30 mL of fermentation medium at a 5% inoculation rate. After culturing with shaking at 30℃ and 220 rpm for 12 hours, 1 g / L of the substrate γ-butyl betaine was added to the culture, and the culture was continued with shaking at 30℃ and 220 rpm for another 48 hours. The fermentation broth was centrifuged at 8000 rpm for 10 minutes, and the concentration of L-carnitine in the supernatant was determined. The result showed an L-carnitine concentration of 0.88 g / L and a molar conversion rate of 99.2%.

[0044] Example 4 Cell Reuse Transformation Following the method in Example 3, 150 mL of bacterial culture was cultured in a 1000 mL shake flask, containing 15 g / L betaine, 0.5 g / L yeast extract, and 10 g / L croton betaine. The culture was continued at 30°C and 220 rpm for 48 h with shaking. The fermentation broth was centrifuged at 8000 rpm for 10 min, and the supernatant was collected for HPLC analysis to determine the concentration of L-carnitine, which yielded 7.0 g / L of L-carnitine. The centrifuged cells were collected and transformed twice more with 6 g / L substrate. The results are shown in Table 4.

[0045] Table 4. Cases of repeated substrate transformation

[0046] Example 5: Fermentation and Conversion in a Fermenter Bacterial cells WQ-1 were inoculated onto slant agar and cultured at 28-35℃ for 1-3 days. A single loop of cells was then inoculated onto seed culture medium and cultured with shaking at 25-37℃ and 120-220 rpm for 24-36 hours to obtain the seed culture of strain WQ-1. The seed culture of strain WQ-1 was then inoculated into a 5L fermenter (using the fermentation medium from Example 3, with a concentration of 3L) at a 10% inoculation rate, with an initial substrate addition of 6 g / L. Fermentation was carried out at 30℃, 500 rpm, and 1 NL / min aeration. After 31 h, betaine and substrate γ-butyl betaine were added to the fermenter to achieve final concentrations of 20 g / L and 15 g / L, respectively. Fermentation continued for 26 h, and the addition of betaine and substrate γ-butyl betaine to the bacterial culture was repeated to achieve final concentrations of 30 g / L and 22.5 g / L, respectively. Fermentation continued for 26 h, and the concentration of L-carnitine in the product was 15.1 g / L.

[0047] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A sword fungus ( Ensifer canadensis WQ-1, characterized in that, It was deposited at the China Center for Type Culture Collection on September 25, 2025, with accession number CCTCC NO: M 20252114.

2. A microbial preparation, characterized in that, The microbial preparation contains the *Streptococcus faecium* WQ-1 as described in claim 1.

3. A whole-cell catalyst, characterized in that, The whole-cell catalyst contains the *Brachys lanceolata* WQ-1 as described in claim 1 or the microbial preparation as described in claim 2.

4. A method for producing L-carnitine, characterized in that, The method involves using the *Brachys lanceolata* WQ-1 as described in claim 1, the microbial preparation as described in claim 2, or the whole-cell catalyst as described in claim 3 to ferment and transform the precursor to produce L-carnitine, wherein the precursor is γ-butyl betaine or croton betaine.

5. The method according to claim 4, characterized in that, Includes the following steps: (1) The seed culture of *Sclerotium fasciatum* WQ-1 was inoculated into the fermentation medium at an inoculation rate of 1% to 10%, and cultured with shaking for 12 to 24 hours to obtain the fermentation broth: (2) Add the precursor to the fermentation culture medium in step (1) to continue fermentation and transformation, or isolate the strain cells from the fermentation culture medium in step (1) as a biocatalyst and carry out the transformation reaction in the fermentation medium containing the precursor.

6. The method according to claim 5, characterized in that, In step (1), the sword fungus WQ-1 was inoculated into the seed culture medium and cultured with shaking at 25-37℃ and 120-220rpm for 24-36h to obtain the seed liquid of strain WQ-1. The seed culture medium contains 3-6 g / L lysine, 5-15 g / L betaine, 5-25 g / L disodium hydrogen phosphate, 5-10 g / L potassium dihydrogen phosphate, 0.1-0.5 g / L magnesium sulfate, 0.01-0.05 g / L ferric sulfate, 0.1-0.5 g / L yeast extract, 0.1-0.5 mg / L manganese sulfate, 0.1-0.5 mg / L copper sulfate, 0.1-0.5 mg / L zinc sulfate, 5-10 mg / L calcium chloride, 0.1-0.5 mg / L cobalt chloride, and 0.5-1.0 mg / L ammonium molybdate.

7. The method according to claim 5, characterized in that, In step (1), the fermentation medium contains 5-15 g / L betaine, 5-25 g / L disodium hydrogen phosphate, 5-10 g / L potassium dihydrogen phosphate, 0.1-0.5 g / L magnesium sulfate, 0.01-0.05 g / L ferric sulfate, 0.1-0.5 g / L yeast extract, 0.1-0.5 mg / L manganese sulfate, 0.1-0.5 mg / L copper sulfate, 0.1-0.5 mg / L zinc sulfate, 5-10 mg / L calcium chloride, 0.1-0.5 mg / L cobalt chloride, and 0.5-1.0 mg / L ammonium molybdate.

8. The method according to claim 5, characterized in that, In step (2), the final concentration of the precursor added is 1~20g / L, added in portions or all at once, with the temperature controlled at 28-35℃, pH at 7.0, time at 24h~72h, and rotation speed at 180-220rpm.

9. The method according to claim 5, characterized in that, It also includes step (3), which involves removing impurities with ion exchange resin and decolorizing with activated carbon, followed by vacuum concentration and crystallization with anhydrous ethanol / acetone to obtain L-carnitine.

10. The use of the *Strombus haematocephala* WQ-1 of claim 1, the microbial preparation of claim 2, the whole-cell catalyst of claim 3, or the method of any one of claims 4 to 9 in the preparation of L-carnitine or products containing L-carnitine.

Images