Expression vector of AND gate positive feedback gene loop and construction method and synthetic biology application thereof

By designing a gated positive feedback gene loop and utilizing the synergistic effect of temperature and chemically inducible expression cassettes, the problem of insufficient transcription factor expression in a single chemically inducible system was solved, achieving efficient gene expression and metabolite synthesis while avoiding metabolic burden and side effects.

CN121450697APending Publication Date: 2026-02-03SHANGHAI CHENSHAN BOTANICAL GARDEN +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511638518.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-10
Publication Date
2026-02-03

AI Technical Summary

Technical Problem

Existing single chemical induction systems, when driving long-chain secondary metabolic pathways involving multiple genes, suffer from low induction efficiency and slow response due to insufficient initial transcription factor expression levels, making it difficult to achieve strict dual induction control and precise regulation of high-intensity transcriptional activation signals.

Method used

We designed an AND gate positive feedback gene loop that forms a self-sustaining positive feedback loop through the synergistic effect of temperature-inducible and chemically-inducible expression cassettes. This loop utilizes the rapid accumulation of XVE and XVE II transcription factors under dual induction to drive the high expression of downstream genes.

Benefits of technology

It enables rapid accumulation of transcription factors under dual induction, driving downstream genes to reach high expression levels, avoiding gene leakage and metabolic burden under unnecessary conditions, and meeting the needs of complex secondary metabolic pathways.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121450697A_ABST
    Figure CN121450697A_ABST
Patent Text Reader

Abstract

The invention discloses an expression vector of an AND gate positive feedback gene loop as well as a construction method and synthetic biology application thereof. The expression vector comprises an ignition element P1, a first terminator Tnos and a second terminator Tnos, wherein the ignition element P1 comprises a heat shock promoter PGmhsp17.6L, a nucleotide sequence for coding a transcription factor XVE and a first terminator Tnos; and a power element P2 comprising a chemically induced promoter PLexA35S, a nucleic acid sequence encoding a transcription factor XVE II, and a second terminator T35S. Through cooperation of P1 and P2, a dual induction control positive feedback loop is constructed: when heat shock and a chemical inducer exist at the same time, the loop is started, and rapid accumulation of transcription factors is realized through self-activation of P2, so that downstream gene expression is driven at high intensity. The design effectively overcomes the problems of insufficient expression quantity of a single induction system and heavy burden of constitutive expression metabolism, avoids cytotoxicity, and can be universally applied to synthesis of various secondary metabolites.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to an expression vector for a gated positive feedback gene loop, its construction method, and its synthetic biology applications. Background Technology

[0002] Tobacco, as a model plant, possesses advantages such as a relatively short growth cycle, ease of gene manipulation, sensitivity to transformation by Agrobacterium tumefaciens and Agrobacterium rhizogenes, relatively high transformation efficiency, strong regeneration ability, and abundant and easily hybridized seeds. Furthermore, as a higher plant, tobacco boasts abundant secondary metabolites and their precursor synthesis pathways, exhibits strong heterogeneity in gene expression at the single-cell level, and can efficiently express exogenous proteins, thus demonstrating broad application prospects in the field of synthetic biology.

[0003] Currently, the chassis cells used in heterologous synthesis of secondary metabolites based on synthetic biology strategies mainly focus on microbial systems such as *E. coli* and yeast. However, these chassis cells have drawbacks such as a lack of precursor synthesis pathways and strong gene expression restrictions. In contrast, plant cells possess unique and irreplaceable advantages as synthetic biology chassis. In recent years, with the advancement of genetic engineering and cell engineering technologies, research on improving the throughput of plant secondary metabolite synthesis using genetic engineering and cell engineering methods has been increasing. However, research using model plants (such as tobacco) as standardized, programmable secondary metabolite synthesis chassis cells is still rarely reported.

[0004] Constitutive promoters can strongly initiate the expression of heterologous or homologous target genes in plants. However, the continuous expression of the target gene by strong promoters is a metabolic waste. Furthermore, excessive accumulation of secondary metabolites can cause a series of side effects, such as affecting the normal growth of the plant and its roots, leading to stunted growth, male sterility, and even cell rupture and death. An AND gate is one of the most basic logic gates in digital logic circuits. Its function is to output a high level only when all input signals are high; otherwise, the output is low. Simply put, a positive result is obtained only when multiple conditions are met simultaneously, such as... Figure 1 This approach can also be applied in synthetic biology, such as simultaneously setting multiple inducible promoters to restrict the expression of the target gene. Only when all conditions are met can the gene circuit be closed, allowing the target gene to be expressed in large quantities. Figure 1 .

[0005] Temperature-inducible promoters and chemically-inducible promoters respond to external physical or chemical signals, respectively, and possess a natural advantage in constructing AND gate circuits. The XVE-PlexA system is a widely used chemically-inducible system, in which XVE is a transcription factor. Only after the addition of β-estradiol activates the XVE protein, does the XVE protein bind to the PlexA promoter, thereby expressing the gene linked to the promoter. However, many genes require inducible expression for long-pathway plant secondary metabolites, thus requiring high standards for XVE expression levels.

[0006] Therefore, in plant metabolic engineering, there is an urgent need to develop a precise regulatory system that can avoid the metabolic burden of constitutive expression while providing high-intensity transcriptional activation signals on demand. Existing single chemical induction systems (such as the XVE-PlexA system) often fail to quickly reach the effective threshold when driving long-chain secondary metabolic pathways involving multiple genes due to insufficient initial transcription factor expression levels, resulting in low induction efficiency and slow response. How to design a gene circuit that can achieve both strict dual induction control ("AND gate" logic) and overcome the bottleneck of low initial expression levels through internal signal amplification mechanisms has become a pressing technical challenge in this field. Summary of the Invention

[0007] The purpose of this invention is to address the shortcomings of existing technologies by providing an expression vector for a gated positive feedback gene loop, its construction method, and its synthetic biology applications.

[0008] To achieve the above objectives, the technical solution adopted by the present invention is as follows: The first aspect is to provide an expression vector for an AND-gated positive feedback gene loop, the expression vector comprising: an ignition element P1, which is a temperature-inducible expression cassette, containing an operatively connected heat-shock promoter P Gmhsp17.6L The first nucleotide sequence encoding transcription factor XVE and the first terminator T nos ; and the power element P2, which is a chemically inducible expression cassette containing an operatively linked chemically inducible promoter P LexA35S The second nucleotide sequence encoding transcription factor XVE II and the second terminator T 35S XVE and XVE II are transcription factors optimized based on plant codon preference, with their amino acid sequences having the same DNA-binding domain and transcriptional activation function. Furthermore, the nucleotide sequence of XVE II shares less than 95% identity with the nucleotide sequence of XVE. The XVE transcription factor expressed by the ignition element P1 can bind to a chemical inducer and activate the chemically induced promoter P of the motive element P2. LexA35SThe XVE II transcription factor expressed by the dynamic element P2 can also bind to the chemical inducer and activate the chemically induced promoter P of the dynamic element P2 itself. LexA35S A self-sustaining positive feedback loop is formed in the expression carrier.

[0009] Furthermore, the chemically induced promoter P LexA35S It contains the basic promoter 35S and 8 copies of the LexA operon sequence.

[0010] Furthermore, the expression vector further comprises one or more reporter gene or target gene expression cassettes, the expression of which is induced by the chemically induced promoter P. LexA35S Driven, and thus directly controlled by the power element P2.

[0011] Furthermore, the reporter gene is the GUS gene, and the target gene is a key enzyme gene in the secondary metabolic pathway.

[0012] The second aspect is to provide a host cell comprising the expression vector described in the first aspect; the host cell is *Escherichia coli* for cloning and plasmid amplification, or *Agrobacterium rhizogenes* for plant transformation.

[0013] The third aspect is to provide a plant chassis cell whose genome stably integrates the AND gate positive feedback gene loop expression vector described in the first aspect.

[0014] Furthermore, the plant basal cells are tobacco (Nicotiana tabacum L.) cells.

[0015] The fourth aspect is to provide a method for constructing plant chassis cells as described in the third aspect, the method comprising the following steps: Step 1, constructing the expression vector as described in any one of claims 1-4; Step 2, introducing the expression vector into plant explants using Agrobacterium rhizogenes; Step 3, culturing the explants in a culture medium to induce the production of transgenic hairy roots; Step 4, performing molecular biological detection on the obtained transgenic hairy roots to screen out positive hairy root lines containing the positive feedback gene loop; Step 5, regenerating the positive hairy root lines into complete transgenic plants through tissue culture; Step 6, hybridizing the transgenic plants with wild-type plants, and screening out individuals from their offspring that do not carry the Agrobacterium rhizogenes rolB gene but stably inherit the positive feedback gene loop, thereby obtaining the plant chassis cells.

[0016] The fifth aspect is to provide a method for producing a target secondary metabolite using plant chassis cells as described in the third aspect, the method comprising: (a) providing an expression vector comprising one or more promoters of the chemically induced promoter P LexA35S(a) a gene that drives and encodes a key enzyme in a secondary metabolic pathway or a transcription factor that regulates a secondary metabolic pathway; (b) the expression vector described in step (a) is introduced into the plant chassis cells to obtain recombinant plant cells; (c) the recombinant plant cells are cultured under conditions suitable for their growth; and (d) a chemical inducer and heat shock are applied sequentially or simultaneously to the culture system to activate the positive feedback gene loop, thereby enabling the recombinant plant cells to synthesize the target secondary metabolite.

[0017] Furthermore, the chemical inducer is β-estradiol, and the heat shock treatment temperature is 40-45℃; the secondary metabolite is anthocyanin.

[0018] Compared with existing technologies, this invention, employing the above technical solution, has the following technical advantages: By designing a positive feedback loop with the synergistic effect of an "ignition element" (P1, temperature-induced) and a "power element" (P2, chemical-induced), this invention effectively overcomes the bottleneck of insufficient initial expression levels in single induction systems. After activation under dual induction, this loop can rapidly accumulate transcription factors (XVE / XVE II) within the cell through the self-activation positive feedback loop of P2, thereby driving downstream genes to achieve expression levels far exceeding those of conventional induction systems, sufficient to meet the high expression requirements of multiple key enzyme genes in complex secondary metabolic pathways.

[0019] This invention abandons constitutive strong promoters and instead employs an AND gate logic controlled by dual signals from temperature and chemical inducers. Only when heat shock (activating P1) and a specific chemical inducer (such as β-estradiol, used to activate XVE protein) are present simultaneously can the entire gene circuit be fully activated and self-sustaining. This design eliminates the "leakage" expression of the target gene under unnecessary conditions and prevents sustained high energy consumption, significantly reducing the basal metabolic load on cells and avoiding problems such as plant dwarfing, growth inhibition, or cytotoxicity caused by overexpression of exogenous genes.

[0020] The plant chassis cell constructed in this invention is a highly versatile and programmable platform. This is achieved by replacing the chemically induced promoter P... LexA35S Driven by downstream reporter genes or target genes (such as key enzyme genes and transcription factors in different secondary metabolic pathways), this system can be conveniently applied to the biosynthesis of a variety of high-value compounds, demonstrating broad application prospects and promotional value. Attached Figure Description

[0021] Figure 1 The diagram shows the AND gate logic circuit and the gene circuit diagram. In the diagram, a is the AND gate logic circuit structure diagram, A and B are the input signal terminals, and Y is the output signal terminal; b is the gene circuit diagram, ignition is the ignition element, and drive is the power element.

[0022] Figure 2 The diagrams show the structure of the vectors; where a is the structure of the ignition element P1; b is the structure of the self-activating positive feedback power element P2; c is the structure of the GUS detection element; d is the structure of the positive feedback gene loop expression vector; and e is the structure of the validation vector.

[0023] Figure 3 Images show the roots of transgenic tobacco and their GUS staining and real-time quantitative PCR results; where a is a solid culture image of transgenic tobacco roots; b is a liquid culture image of transgenic tobacco roots; c is a GUS staining image of transgenic tobacco roots after cold shock, with negative roots NC on the left and positive roots GUS-5 on the right; d is a real-time quantitative PCR image of transgenic tobacco roots after 120 hours of temperature and chemical double induction.

[0024] Figure 4 The images show the validation diagrams of the T2 generation transgenic tobacco chassis cell line. Image a shows GUS staining of T2 generation transgenic tobacco chassis cells, with wild-type tobacco leaves on the left and positive T2 generation leaves on the right. Image b shows PCR testing of the rolB gene in T2 generation transgenic tobacco chassis cells, with the electrophoresis images from left to right representing the marker, positive control, three T2 generation transgenic tobacco plants, and negative control. Image c shows PCR testing of the XVE gene in T2 generation transgenic tobacco chassis cells, with the electrophoresis images from left to right representing the marker, negative control, positive control, and three T2 generation transgenic tobacco plants. Image d shows the validation diagram of T2 generation transgenic tobacco chassis cells, where the purple-red root growth indicates successful anthocyanin synthesis. Detailed Implementation

[0025] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but this is not intended to limit the invention. It should be noted that, unless otherwise specified, the embodiments and features described in the embodiments of the present invention can be combined with each other.

[0026] Experimental methods in the following examples, unless otherwise specified, were performed under standard conditions or as recommended by the manufacturer. Unless otherwise stated, all reagents and materials used in the following examples were commercially available.

[0027] All kits and enzymes used in the following examples were purchased from Tiangen Biotech, Biosharp, Thermo Fisher, NEB, and Takara. Plasmid pAGM4723 was purchased from Thermo Fisher, and BbsI restriction enzyme, BsaI restriction enzyme, and T4 ligase were purchased from NEB.

[0028] Example 1: Ignition element P1 is the temperature induction element L1-P Gmhsp17.6L -XVE-T 35S Construction (1) XVE, P Gmhsp17.6L and T nos Optimization and synthesis First, tobacco-based codon optimization was performed on the XVE gene, and the promoter adopted was the heat-shock promoter P. Gmhsp17.6L Termination sub uses T nos The BbsI and BsaI restriction sites within the sequence were screened using Vector NTI, and the two restriction sites were removed through synonymous mutations, with adapters added to both ends of the sequence.

[0029] XVE, P Gmhsp17.6L and T nos All were synthesized by GenScript, and the gene is located on the pUC57-Kan vector. (2) Ignition element P1 is the temperature induction element L1-P Gmhsp17.6L -XVE-T nos Construction Using the above three gene elements as materials, a golden gate reaction was performed to obtain the temperature-inducible element P1, with the structure shown below. Figure 2 a.

[0030] Golden Gate reaction system: 1 μL empty support, 1.5 μL pUC57-Kan-XVE, pUC57-Kan-P Gmhsp17.6L 1.5 μL, pUC57-Kan-T nos 1.5μL, NEB T4 Buffer 1.5μL, BSA (10x) 1.5μL, T4ligase 0.5μL, BsaI 0.5μL, ddH2O 10μL.

[0031] The program is set as follows: 1) 37℃, 3 min; 2) 16℃, 4 min; 3) 16℃, 15 min; 4) 50℃, 5 min; 5) 80℃, 5 min. The loop starts from 1) and ends in 2), with a total of 32 loops.

[0032] The reaction product was transformed into *E. coli* DH5α and plated on LB agar containing 100 mg / L Ampicillin. The culture was incubated at 37°C for 12 h. The following day, single colonies were picked for colony PCR verification, and positive clones were sent to a biotechnology company for sequencing. Based on the sequencing results, plasmid L1-P was extracted. Gmhsp17.6L -XVE-T nos .

[0033] The PCR primer sequences are: XVE-F: AGGGCTTACCTCTGGTTGGT (SEQ ID No. 1); XVE-R: GGCTGAGTCATGGGGAGTAA (SEQ ID No. 2); Primers were synthesized by Shanghai Sangon Biotech.

[0034] Example 2: The power element P2 is the chemical induction element L1-P. LexA35S -XVE II-T 35S The construction.

[0035] (1) XVE II, P LexA35S and T 35S Optimization and synthesis First, codon optimization was performed on XVE in Example 1, and synonymous mutations were carried out to make it have certain sequence differences from XVE. The promoter was P, which was formed by fusing the 35S basic promoter with 8 copies of the LexA operon sequence. LexA35S Termination sub uses T 35S The BbsI and BsaI restriction sites within the sequence were screened using Vector NTI, and the two restriction sites were removed through synonymous mutations, with adapters added to both ends of the sequence.

[0036] XVE II, P LexA35S and T nos All were synthesized by GenScript, and the genes are located on the pUC57-Kan vector.

[0037] (2) The driving element P2 is the chemical induction element L1-P LexA35S -XVE II-T 35S Construction Using the above three gene elements as materials, a Golden Gate reaction was performed to obtain the chemically induced element P2, with the structure shown below. Figure 2 b.

[0038] Golden Gate reaction system: 1 μL empty support, 1.5 μL pUC57-Kan-XVE II, pUC57-Kan-P LexA35S 1.5 μL, pUC57-Kan-T 35S 1.5μL, NEB T4 Buffer 1.5μL, BSA (10x) 1.5μL, T4ligase 0.5μL, BsaI 0.5μL, ddH2O 10μL.

[0039] The program is set as follows: 1) 37℃, 3 min; 2) 16℃, 4 min; 3) 16℃, 15 min; 4) 50℃, 5 min; 5) 80℃, 5 min. The loop starts from 1) and ends in 2), with a total of 32 loops.

[0040] The reaction product was transformed into *E. coli* DH5α and plated on LB agar containing 100 mg / L Ampicillin. The culture was incubated at 37°C for 12 h. The following day, single colonies were picked for colony PCR verification, and positive clones were sent to a biotechnology company for sequencing. Based on the sequencing results, plasmid L1-P was extracted. LexA35S -XVE II-T 35S .

[0041] The PCR primer sequences are: XVEII-F: TGTGCCTGGCTAGAGATCCT (SEQ ID No. 3); XVEII-R: ATGCGATGAAGTAGAGCCCG (SEQ ID No. 4); Primers were synthesized by Shanghai Sangon Biotech.

[0042] Example 3 GUS detection element L1-P CBF2 -GUS-T mas The construction.

[0043] (1) GUS, P CBF2 and T mas Optimization and synthesis First, tobacco-based codon optimization was performed on the GUS gene, and the promoter was the cold-stimulation promoter P. CBF2 Termination sub uses T mas The BbsI and BsaI restriction sites within the sequence were screened using Vector NTI, and the two restriction sites were removed through synonymous mutations, with adapters added to both ends of the sequence.

[0044] GUS, P CBF2 and T mas All were synthesized by GenScript, and the genes are located on the pUC57-Kan vector.

[0045] (2) GUS detection element L1-P CBF2 -GUS-T mas Construction Using the above three gene elements as materials, a Golden Gate reaction was performed to obtain a GUS detection element, the structure of which is shown below. Figure 2 c.

[0046] Golden Gate reaction system: 1 μL empty support, 1.5 μL pUC57-Kan-GUS, pUC57-Kan-P CBF2 1.5 μL, pUC57-Kan-T mas1.5μL, NEB T4 Buffer 1.5μL, BSA (10x) 1.5μL, T4 ligase 0.5μL, BsaI 0.5μL, ddH2O 10μL.

[0047] The program is set as follows: 1) 37℃, 3min; 2) 16℃, 4min; 3) 16℃, 15min; 4) 50℃, 5min; 5) 80℃, 5min. The loop starts from 1) and ends in 2), with a total of 32 loops.

[0048] The reaction product was transformed into *E. coli* DH5α and plated on LB agar containing 100 mg / L Ampicillin. The culture was incubated at 37°C for 12 h. The following day, single colonies were picked for colony PCR verification, and positive clones were sent to a biotechnology company for sequencing. Based on the sequencing results, plasmid L1-P was extracted. CBF2 -GUS-T mas .

[0049] The PCR primer sequences are: PCBF2-F: GAGACAGAAACTCCGCGTTC (SEQ ID No. 5); GUS-R: CAACAGACGGTGGTTACAG (SEQ ID No. 6); Primers were synthesized by Shanghai Sangon Biotech.

[0050] Example 4 Positive feedback gene loop expression vector, namely the plant expression vector L2-P which simultaneously contains an ignition element P1 and a kinetic element P2, i.e., a temperature-inducing element and a chemical-inducing element. CBF2 -GUS-T mas -P Gmhsp17.6L -XVE-T nos - P LexA35S -XVE II-T 35S The construction.

[0051] The ignition element P1 obtained above is also known as the temperature induction element L1-P. Gmhsp17.6L -XVE-T nos And the driving element P2, namely the chemical induction element L1-P LexA35S -XVE II-T 35S and GUS staining element L1-P CBF2 -GUS-T mas A golden gate reaction was performed to obtain a positive feedback gene loop expression vector, i.e., a plant expression vector containing both an ignition element P1 and a kinetic element P1, i.e., a temperature-inducible element and a chemical-inducible element, as shown in the figure. Figure 2 d.

[0052] Golden Gate reaction system: pAGM4723 1μL, L1-P Gmhsp17.6L -XVE-T nos 1.5μL, dummy2 1.5μL, dummy3 1.5μL, L1-P LexA35S -XVE II-T 35S 1.5 μL, L1-P CBF2 -GUS-T mas 1.5μL, ELE5 1.5μL, NEB T4 Buffer 1.5μL, BSA (10x) 1.5μL, T4 ligase 0.5μL, BbsI 0.5μL, ddH2O 6μL.

[0053] The program is set as follows: 1) 37℃, 3 min; 2) 16℃, 4 min; 3) 16℃, 15 min; 4) 50℃, 5 min; 5) 80℃, 5 min. The loop starts from 1) and ends in 2), with a total of 32 loops.

[0054] The reaction product was transformed into *E. coli* DH5α and plated on LB agar containing 100 mg / L Kanamycin. The culture was incubated at 37°C for 12 h. The following day, single colonies were picked for colony PCR verification, and positive clones were sent to a biotechnology company for sequencing. Based on the sequencing results, plasmid L2-P was extracted. CBF2 -GUS-T mas -P Gmhsp17.6L -XVE-T nos -P LexA35S -XVEII-T 35S .

[0055] The PCR primers are the same as SEQ ID No. 1-SEQ ID No. 6.

[0056] Example 5: Using tobacco, a positive feedback gene loop was obtained, namely, plant chassis cells containing both ignition element P1 and power element P2, i.e., temperature-inducing element and chemical-inducing element, and a cell line with high expression was obtained.

[0057] (1) The plant expression vector L2-P was expressed by electric shock. CBF2 -GUS-T mas -P Gmhsp17.6L -XVE-T nos - P LexA35S -XVE II-T 35S L2-P was obtained by transforming Agrobacterium rhizogenes Ar.1193. CBF2 -GUS-T mas -PGmhsp17.6L -XVE-T nos -P LexA35S -XVE II-T 35S Agrobacterium rhizogenes strain for expression vector.

[0058] Tobacco sterile tissue culture seedlings were transformed by infecting leaf veins. The infected leaves were placed on MS medium containing 100 μM acetylsyringone (AS) and incubated in the dark at 25°C for 48-72 h. Afterward, they were transferred to MS medium containing 400 mg / L cephalosporin (CEF). Once roots developed, cold induction treatment was performed, followed by GUS staining to preliminarily determine positivity and PCR verification. The root development in MS medium is shown in the image below. Figure 3 a.

[0059] The cold induction treatment and GUS staining procedure is as follows: 1) When the root biomass is appropriate, treat the roots at 4℃ for 2 hours for 7 consecutive days; 2) Place a small amount of roots in a 1.5mL centrifuge tube, add 1mL of the prepared GUS working solution to completely cover the roots, treat in the dark overnight, add 70% alcohol to wash twice until the negative control is colorless, and observe the color status of the roots.

[0060] Using the GUS-positive tobacco hair roots as material, genomic DNA was extracted and verified by PCR. The GUS staining results are as follows: Figure 3 c. The results showed that after cold induction treatment, the expression product of the GUS gene was detected in the positive hair roots (GUS-5), while no such signal was found in the negative control (NC). This preliminarily confirms the presence of the cold-inducible promoter (L2-P) in the constructed vector. CBF2 It is active in transgenic hair roots, and can respond to low temperature signals and initiate the expression of downstream GUS reporter genes.

[0061] (2) After 4 days of liquid culture of the above-mentioned positive roots, dual induction by temperature and chemical methods was performed. The rooting liquid culture was as follows: Figure 3 b.

[0062] The temperature and chemical dual induction program was as follows: 1) The hair roots were placed in MS liquid medium with a β-estradiol concentration of 10 μM and cultured in the dark at 25°C; 2) After 24 h, the roots were treated at 44°C for 3 h for 3 consecutive days; 3) The roots were cultured in the dark at 25°C until day 5.

[0063] Total RNA was extracted from the roots of the above-mentioned transgenic tobacco using the Tiangen Plant RNA Extraction Kit, and then synthesized into cDNA using the Invitrogen Reverse Transcription Kit. The cDNA was diluted to an appropriate concentration, with NtActin as the internal reference gene. The qPCR reaction system consisted of: 2 μL cDNA, 0.5 μL upstream primer, 0.5 μL downstream primer, 5 μL SYBR Premix Ex Taq (2×), and 2 μL ddH2O.

[0064] The qPCR program is set as follows: 1) 95℃, 30s; 2) 95℃, 5s; 3) 60℃, 30s; 4) 72℃, 30s; cycles from 2) to 4), 40 cycles in total.

[0065] The qPCR primers are SEQ ID No. 1-SEQ ID No. 4. NtActin-F: TCACAGAAGCTCCTCCTAATCCA (SEQ ID No. 9); NtActin-R: GAGGGAAAGAACAGCCTGAATG (SEQ ID No. 10); qPCR results as follows Figure 3 d. The results showed that under the dual induction of heat shock and β-estradiol, the expression level of XVEII was rapidly increased through a positive feedback mode.

[0066] Example 6: Using tissue culture and hybridization techniques, transgenic tobacco chassis cells with a positive feedback gene loop lacking the rolB gene were obtained. (1) Using tissue culture and hybridization techniques, tobacco transgenic chassis cells with a positive feedback gene loop and no rolB gene were obtained. The transgenic positive roots obtained above were transformed into tobacco plants using plant tissue culture technology, and T1 generation seeds were obtained. After germination, the T1 generation seeds were sown and the successful genetic element P was obtained by GUS staining and PCR verification. Gmhsp17.6L -XVE-T nos -P LexA35S -XVE II-T 35S The T1 generation of transgenic cell lines.

[0067] T1 generation plants were crossed with wild-type tobacco to obtain T2 generation seeds. After germination, the T2 generation seeds were sown and the resulting samples were verified by GUS staining and PCR to yield the successfully inherited target gene element P. Gmhsp17.6L -XVE-T nos -P LexA35S -XVE II-T 35S Furthermore, the T2 generation of transgenic cell lines containing the rolB gene was isolated.

[0068] The cold induction treatment and GUS staining procedure is as follows: 1) Take a whole leaflet and put it into a 2ml EP tube. Add MS liquid medium to cover the leaflet and treat it at 4℃ for 3 consecutive days for 3 hours to induce root growth. After induction, take it out and culture it under 28° light. 2) After cold shock, discard the MS medium and add 1mL of prepared GUS working solution to completely cover the leaflet. Treat it in the dark overnight and wash it twice with 70% alcohol until the negative control is colorless. Observe the color status of the leaflet.

[0069] GUS staining results are as follows Figure 4 a. The results showed that plants containing positive feedback gene loops could be obtained by hybridizing with wild-type tobacco.

[0070] The primers used for PCR are: SEQ ID No. 1, SEQ ID No. 2 ROL-F: ACTATAGCAAACCCCTCCTGC (SEQ ID No. 7); ROL-R: TTCAGGTTTACTGCAGCAGGC (SEQ ID No. 8); Genomic PCR, such as Figure 2 b, 2c, the results showed that the rolB gene was successfully isolated by hybridization with wild-type tobacco.

[0071] (2) Verification of successful construction of chassis cell line After the T2 generation of positive tobacco plants have grown, the plant expression vector L2-P, which contains the PlexA promoter to drive the SbMYB75 and SbDEL genes, is used. AtUBI5 -GFP-T mas -P LexA35S -SbMYB75-T hsp18.2 -P lexA35S -SbDEL-T nos (Structure as follows) Figure 2 e) Transgenic tobacco leaves from the T2 generation of *Agrobacterium rhizogenes* successfully inherited the target gene and isolated the positive feedback gene loop of the rolB gene. After root development, the leaves underwent dual induction using temperature and chemicals. Observation was conducted to check for reddening; reddening indicated successful construction of the chassis cell line. Root development was induced using solid culture as follows: Figure 4 d. The results show that the present invention successfully constructed the target chassis cells.

[0072] The temperature and chemical dual induction program was as follows: 1) The hair roots were placed on MS solid medium with a β-estradiol concentration of 10 μM and cultured in the dark at 25°C; 2) After 24 h, the roots were treated at 44°C for 3 h for 3 consecutive days; 3) The roots were cultured in the dark at 25°C until day 8.

[0073] The above description is merely a preferred embodiment of the present invention and does not limit the implementation and protection scope of the present invention. Those skilled in the art should realize that any equivalent substitutions and obvious changes made based on the content and illustrations of the present invention should be included within the protection scope of the present invention.

Claims

1. An expression vector for an AND-gated positive feedback gene loop, characterized in that, The expression vector comprises: an ignition element P1, which is a temperature-induced expression cassette containing an operatively connected thermally stimulated promoter P. Gmhsp17.6L The first nucleotide sequence encoding transcription factor XVE and the first terminator T nos ; and the power element P2, which is a chemically inducible expression cassette containing an operatively linked chemically inducible promoter P LexA35S The second nucleotide sequence encoding transcription factor XVE II and the second terminator T 35S XVE and XVE II are transcription factors optimized based on plant codon preference, with their amino acid sequences having the same DNA-binding domain and transcriptional activation function. Furthermore, the nucleotide sequence of XVE II shares less than 95% identity with the nucleotide sequence of XVE. The XVE transcription factor expressed by the ignition element P1 can bind to a chemical inducer and activate the chemically induced promoter P of the motive element P2. LexA35S The XVE II transcription factor expressed by the dynamic element P2 can also bind to the chemical inducer and activate the chemically induced promoter P of the dynamic element P2 itself. LexA35S A self-sustaining positive feedback loop is formed in the expression carrier.

2. The expression vector according to claim 1, characterized in that, The chemically induced promoter P LexA35S It contains the basic promoter 35S and 8 copies of the LexA operon sequence.

3. The expression vector according to claim 1, characterized in that, The expression vector further comprises one or more reporter gene or target gene expression cassettes, the expression of which is induced by the chemically induced promoter P. LexA35S Driven, and thus directly controlled by the power element P2.

4. The expression vector according to claim 3, characterized in that, The reporter gene is the GUS gene, and the target gene is a key enzyme gene in the secondary metabolic pathway.

5. A host cell, characterized in that, It comprises the expression vector according to any one of claims 1-4; the host cell is Escherichia coli for cloning and plasmid amplification, or Agrobacterium rhizogenes for plant transformation.

6. A plant basal cell, characterized in that, The genome is stably integrated with the AND gate positive feedback gene loop expression vector as described in any one of claims 1-4.

7. The plant chassis cell according to claim 6, characterized in that, The plant basal cells are tobacco (Nicotiana tabacum L.) cells.

8. A method for constructing plant chassis cells as described in claim 6 or 7, characterized in that, The method includes the following steps: Step 1, constructing the expression vector according to any one of claims 1-4; Step 2, introducing the expression vector into plant explants using Agrobacterium rhizogenes; Step 3, culturing the explants in a culture medium to induce the production of transgenic hairy roots; Step 4, performing molecular biological detection on the obtained transgenic hairy roots to screen out positive hairy root lines containing the positive feedback gene loop; Step 5, regenerating the positive hairy root lines into complete transgenic plants through tissue culture; Step 6, hybridizing the transgenic plants with wild-type plants, and screening out individuals from their offspring that do not carry the Agrobacterium rhizogenes rolB gene but stably inherit the positive feedback gene loop, thereby obtaining the plant basal cells.

9. A method for producing a target secondary metabolite using plant basal cells as described in claim 6 or 7, characterized in that, The method includes: (a) providing an expression vector containing one or more promoters of the chemically induced promoter P. LexA35S (a) a gene that drives and encodes a key enzyme in a secondary metabolic pathway or a transcription factor that regulates a secondary metabolic pathway; (b) the expression vector described in step (a) is introduced into the plant chassis cells to obtain recombinant plant cells; (c) the recombinant plant cells are cultured under conditions suitable for their growth; and (d) a chemical inducer and heat shock are applied sequentially or simultaneously to the culture system to activate the positive feedback gene loop, thereby enabling the recombinant plant cells to synthesize the target secondary metabolite.

10. The method according to claim 9, characterized in that, The chemical inducer is β-estradiol, and the heat shock treatment temperature is 40-45℃; the secondary metabolite is anthocyanin.