Sweet potato IbCCD10a protein, coding gene and application of sweet potato IbCCD10a protein in regulation and control of sweet potato plant type

By constructing recombinant plasmids to overexpress or RNA interfere with the sweet potato IbCCD10a gene, the uprightness and short internodes of sweet potatoes were enhanced, solving the problem that the creeping nature of sweet potato vines affected mechanized operations and the utilization of light and heat resources, thus achieving increased planting density and yield of sweet potatoes.

CN121471329AActive Publication Date: 2026-02-06SANYA INSTITUTE OF NANJING AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202610014591.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-07
Publication Date
2026-02-06
Estimated Expiration
2046-01-07

AI Technical Summary

Technical Problem

In existing technologies, the creeping trait of sweet potato vines affects mechanized operations and the utilization of light and heat resources, limits planting density and yield improvement, and lacks effective gene regulation methods.

Method used

By constructing recombinant plasmids pCambia1305-IbCCD10a and pFGC5941-IbCCD10a, and overexpressing or interfering with the sweet potato IbCCD10a gene, the uprightness of sweet potatoes was enhanced, and the vine length and average internode length were reduced. The sweet potato plants were then transformed by double digestion and homologous recombination using XbaI and BstEII restriction endonucleases.

Benefits of technology

It significantly reduces vine length and internode length, increases planting density, enhances lodging resistance, reduces diseases and pests, improves photosynthetic efficiency, promotes tuber enlargement, simplifies management operations, and is suitable for mechanized planting.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121471329A_ABST
    Figure CN121471329A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of genetic engineering, and relates to a sweet potato IbCCD10a protein, a coding gene and application of the sweet potato IbCCD10a protein to regulation and control of upright and short-vine plant types of sweet potatoes. Compared with a wild type, the IbCCD10a gene overexpression sweet potato transgenic plant has the advantages that the gravity fixed point angle is obviously increased, the vine length is obviously reduced, the average internode length is obviously reduced, and the sweet potato plant type is more compact and upright. Upright sweet potato plants with short vines and short internodes are small in field expansion range and few in crossed and overlapped branches and leaves, field closing caused by traditional creeping and long-vine varieties is avoided, the sweet potato planting density can be improved, light and heat resources in a three-dimensional space can be efficiently utilized, the per unit area yield is improved, and the method is suitable for mechanical weeding and harvesting.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to the sweet potato IbCCD10a protein, its encoding gene, and its application in regulating sweet potato plant architecture. Background Technology

[0002] sweet potato( Ipomoea batatas *Ipomoea* (L.) Lam. is a hexaploid plant belonging to the Convolvulaceae family, *Ipomoea* genus, and *Ipomoea* section. It is an important food, feed, industrial raw material, and new energy crop. my country is the world's largest producer of sweet potatoes, with an annual output of approximately 51.4 million tons, accounting for 59% of the world's total production. Currently, the overall mechanization level of sweet potato production in my country is less than 40%, far lower than crops such as wheat (97%) and peanuts (67%), which seriously restricts the development of the sweet potato industry. The creeping vines of sweet potatoes not only severely affect mechanized operations such as weeding and harvesting in sweet potato production, but also limit its utilization of the three-dimensional light and heat resources of farmland, thus limiting the planting density and yield of this crop. Therefore, cultivating and creating new short-vine, upright sweet potato germplasm is of transformative significance for the future development of the sweet potato industry. However, there is limited research on gene technology for regulating sweet potato plant type in existing technologies. Summary of the Invention

[0003] To address the aforementioned technical problems, this invention provides the sweet potato IbCCD10a protein, its encoding gene, and its application in regulating sweet potato plant architecture.

[0004] The technical solution provided by this invention is as follows: A sweet potato IbCCD10a protein, the amino acid sequence of which is shown in SEQ ID No. 2.

[0005] The present invention also provides a sweet potato IbCCD10a gene, which encodes the above-mentioned sweet potato IbCCD10a protein, and the nucleotide sequence of the sweet potato IbCCD10a gene is shown in SEQ ID NO.1.

[0006] The present invention also provides an expression cassette, recombinant vector, recombinant microorganism or transgenic cell line of the above-mentioned sweet potato IbCCD10a gene.

[0007] The present invention also provides the application of the above-mentioned sweet potato IbCCD10a protein or the above-mentioned sweet potato IbCCD10a gene in enhancing the uprightness of sweet potatoes and reducing the vine length and average internode length.

[0008] The present invention also provides a method for enhancing the uprightness of sweet potatoes and reducing vine length and average internode length, the method comprising increasing the content and / or activity of the aforementioned protein in the target plant, thereby obtaining plants with enhanced uprightness and vine length and average internode length less than those of the target plant.

[0009] Furthermore, the recombinant plasmid pCambia1305-IbCCD10a was constructed by double enzyme digestion and homologous recombination, and introduced into the target plant to obtain transgenic sweet potato; compared with the target plant, the transgenic sweet potato has enhanced uprightness, reduced vine length and average internode length.

[0010] Furthermore, the primer sequences used to construct the recombinant plasmid pCambia1305-IbCCD10a are shown in SEQ ID NO.7 and SEQ ID NO.8.

[0011] Furthermore, the primer sequences for identifying genetically modified sweet potatoes are shown in SEQ ID NO.9 and SEQ ID NO.10.

[0012] Furthermore, double digestion was performed using XbaI and BstEII restriction endonucleases.

[0013] Beneficial effects

[0014] Compared to the wild type, transgenic sweet potato plants overexpressing the IbCCD10a gene showed significantly reduced vine length and average internode length, resulting in a more compact and upright plant type. The vine length decreased from 38.83 cm to 9.77 cm, a reduction of 74.84%; the average internode length decreased from 2.54 cm to 0.67 cm, a reduction of 73.62%; and the gravity-based angle, a key indicator of uprightness, increased from 122.67° to 170.33°. The shorter vines, shorter internodes, and upright posture of these sweet potato plants resulted in a smaller field spread and less overlapping of branches and leaves, allowing for higher planting density. This also avoided the canopy closure caused by the creeping vines of traditional long-vine creeping varieties, enabling more efficient use of land and light resources and increasing the number of effective tubers per unit area. Short internodes and strong upright growth result in thicker stems and greater resistance to lodging, especially in rainy and windy weather, reducing the risk of stem and leaf rot due to lodging and ensuring stable growth throughout the growing season. The compact plant type improves field ventilation, reduces leaf surface humidity, and significantly reduces the growth of moisture-loving diseases such as black spot, soft rot, and leaf spot; it also reduces the probability of aphids and spider mites hiding and multiplying. Sufficient sunlight enhances leaf photosynthetic efficiency, accumulating more photosynthetic products for transport to tubers, promoting tuber enlargement. Traditional long-vine sweet potatoes require multiple turnings during their growth period, while short-vine varieties eliminate the need for turning, saving labor. Larger spacing between plants minimizes damage to stems and leaves during field operations, making weeding, fertilization, and other management tasks easier. The compact plant type avoids the problem of vines entangled in agricultural machinery, facilitating mechanized planting, especially suitable for large-scale planting bases. This trait offers significant advantages in sweet potato planting management, yield improvement, and mechanized operations. Attached Figure Description

[0015] Figure 1This is an electrophoresis diagram of the regenerated sweet potato plants in Example 3; where M is a DNA molecular marker, L1 and L2 are plants transgenic with the IbCCD10a gene; WT represents the Sushu 33 plant, P represents the positive control (recombinant plasmid pCambia1305-IbCCD10a), and W represents the negative control (water). Figure 2 The relative expression levels of the IbCCD10a gene are shown; where L1 and L2 represent different regenerated plants, and WT represents the Sushu 33 plant. Figure 3 The appearance morphology of sweet potato plants transgenic with the IbCCD10a gene; where L1 and L2 represent different regenerated plants, and WT represents the Sushu 33 plant. Figure 4 The vine length of the transgenic sweet potato plant is shown; L1 and L2 represent different regenerated plants, and WT represents the Sushu 33 plant. Figure 5 The mean internode length of the transgenic sweet potato plant is L1 and L2, which represent different regenerated plants, and WT represents the Sushu 33 plant. Figure 6 Gravitational locating angles of IbCCD10a transgenic sweet potato plants; where L1 and L2 represent different regenerated plants, and WT represents the Sushu 33 plant. Figure 7 Electrophoresis diagram of sweet potato transgenic plants with RNA interference of the IbCCD10a gene; where M is the DNA molecular marker, Ri1 and Ri2 are transgenic plants of the IbCCD10a gene; WT represents Xushu 32 plant, P represents positive control (recombinant plasmid pFGC5941-IbCCD10a), and W represents negative control (water). Figure 8 The relative expression level of the IbCCD10a gene in sweet potato transgenic plants with RNA interference of the IbCCD10a gene; where Ri1 and Ri2 represent different regenerated plants, and WT represents the Xushu 32 plant. Figure 9 The appearance morphology of sweet potato transgenic plants with RNA interference of the IbCCD10a gene is shown; among them, Ri1 and Ri2 represent different regenerated plants, and WT represents the Xushu 32 plant. Figure 10 The vine length of sweet potato transgenic plants was measured by RNA interference with the IbCCD10a gene; Ri1 and Ri2 represent different regenerated plants, and WT represents the Xushu 32 plant. Figure 11The mean internode length of sweet potato transgenic plants with RNA interference from the IbCCD10a gene is given; where Ri1 and Ri2 represent different regenerated plants, and WT represents the Xushu 32 plant. Detailed Implementation

[0016] Example 1

[0017] Cloning of the full-length open reading frame of the IbCCD10a gene Using complementary deoxyribonucleic acid (cDNA) from sweet potato 'Xushu 32' as a template, IbCCD10a-specific primers (IbCCD10aORF-F, IbCCD10aORF-R) were designed. The full-length open reading frame fragment of IbCCD10a was amplified by polymerase chain reaction (PCR) using a high-fidelity enzyme (PrimeSTAR, Takara R040A). The PCR amplification products were subjected to agarose gel electrophoresis, the target band was excised, and purified and recovered using a gel extraction kit (YESEN 19101ES50). The recovered product was ligated into a sequencing vector (pESI-Blunt) using a cloning kit (YESEN 10910ES20) to obtain the recombinant plasmid (pESI-IbCCD10aORF). This plasmid was then transformed into *E. coli* (DH5α) using the heat shock method and plated on LB agar medium containing 100 mg / L ampicillin. The medium was incubated overnight at 37°C. Single clones were selected and amplified using polymerase chain reaction (PCR) with primers (M13-F; M13-R). Colonies with band sizes consistent with expectations were sent to a sequencing company (Sangon Biotech) for sequencing.

[0018] IbCCD10aORF-F: 5′-ATGGGCACTTGTCACTTTGGAAC-3′ (SEQ ID NO. 3); IbCCD10aORF-R: 5′-TTAGGTAATAAAAGCCCCATGAAACCAT-3′ (SEQ ID NO.4); M13-F: 5′-GTAAAACGACGGCCAGT-3′ (SEQ ID NO.5); M13-R: 5′-CAGGAAACAGCTATGAC-3′ (SEQ ID NO. 6); The full-length open reading frame sequence of the IbCCD10a gene (SEQ ID NO.1):

[0019] The protein sequence encoded by the IbCCD10a gene (SEQ ID NO.2): .

[0020] Example 2

[0021] Construction of recombinant plasmid pCambia1305-IbCCD10a The restriction enzyme sites of the vector (pCambia1305) and primer sequences were screened using software (SnapGene 4.1.9). The α vector (pCambia1305-IbCCD10) was constructed through double enzyme digestion and homologous recombination. The specific steps are as follows: (1) Amplification of the target fragment: Using the sequencing return plasmid as a template, primers designed with homologous arms (IbCCD10a1305-F; IbCCD10a1305-R) were added to amplify the target gene fragment, followed by agarose gel electrophoresis and gel recovery and purification.

[0022] IbCCD10a1305-F: 5′-TAAGTCCGGAGCTAGCTCTAGAATGGGCACTTGTCACTTTGGAAC-3′ (SEQ ID NO. 7); IbCCD10a1305-R: 5′-GGGGAAATTCGAGCTGGTCACCTTAGGTAATAAAAGCCCCATGAAAACCA-3′ (SEQ ID NO. 8).

[0023] (2) The empty vector plasmid (pCambia1305) was extracted, double digested with restriction endonucleases (XbaI; BstEⅡ), and the vector fragment was recovered by agarose gel electrophoresis and gel purification.

[0024] (3) The target gene and the linear vector were ligated using a homologous recombination kit (YESEN 10923ES20) and transformed into Escherichia coli (DH5α).

[0025] (4) Select single colonies, use primers (M13-F and M13-R) to detect positive colonies, and send them to a sequencing company for sequencing.

[0026] (5) Extract the plasmids of the colonies that were correctly sequenced.

[0027] Example 3

[0028] Sweet potato transgenic plants overexpressing the IbCCD10a gene were obtained The recombinant plasmid (pCambia1305-IbCCD10a) was transformed into Agrobacterium (EHA105) by heat shock and used to infect sweet potatoes.

[0029] In a 50 mL centrifuge tube, add 20 mL of liquid LB medium, 20 μL of 100 mg / mL kanamycin, and 20 μL of 50 mg / mL rifampin. Inoculate with 20 μL of the target Agrobacterium tumefaciens bacterial suspension and incubate overnight at 28°C and 250 rpm / min on a shaker. After measuring the OD value of the bacterial suspension, centrifuge at 5000 rpm / min for 5 min to collect the cells. Resuspend the cells in an appropriate amount of liquid MS medium, centrifuge again to collect the cells, and adjust the OD value of the bacterial suspension to 0.2-0.5 with an appropriate amount of liquid MS medium. Add acetylsuccine solution to make the concentration of acetylsuccine in the bacterial suspension 30 mg / L.

[0030] The embryogenic callus tissue of sweet potato 33 was transferred to Agrobacterium solution and placed in a horizontal shaker for 30 min. Then, the centrifuge tube was placed in an ultrasonic bath for 10-15 s to remove the bacterial solution. The sweet potato callus tissue was then transferred onto filter paper and excess bacterial solution was blotted out.

[0031] Embryogenic callus was transferred to solid MS medium containing 30 mg / L acetylsyringone and co-cultured in the dark at 28°C for 3 days. After co-culture, the sweet potato callus was transferred to Erlenmeyer flasks and washed repeatedly with liquid MS medium 5-6 times until the liquid was clear.

[0032] Transfer embryogenic callus to liquid MS medium + 300 mg / L cefixime and wash once. Remove the liquid, blot off excess liquid medium with sterile filter paper, and transfer the embryogenic callus to solid MS medium for extended culture for 1 week.

[0033] After a one-week extended culture period, the embryogenic callus was transferred to a selection medium and screened for three generations, from low to high concentrations, with subculturing every two weeks. After resistance screening, the resistant embryogenic callus was transferred to solid MS medium containing 0.1 mg / L abscisic acid to induce callus differentiation. Once the callus turned green and differentiated, it was transferred to solid MS medium with half the sucrose to induce the formation of sweet potato regenerated plants.

[0034] Polymerase chain reaction (PCR) identification of sweet potato regenerated plants: Genomic DNA was extracted from plant leaves and amplified by polymerase chain reaction (PCR) using primer pair (35S-F; IbCCD10a-TR). Then, 1% agarose gel electrophoresis was performed. If a specific band of about 1870 bp was displayed, it indicated that the PCR identification was positive.

[0035] 35S-F: 5′-CACTATCCTTCGCAAGACCCTTCCTC-3′ (SEQ ID NO. 9); IbCCD10a-TR: 5′-GGTAATAAAAGCCCCATGAAACCAT-3′ (SEQ ID NO. 10).

[0036] Electrophoresis images of some plants are shown below. Figure 1 . Figure 1 In the diagram, M represents a DNA molecular marker, L1 and L2 represent plants transgenic with the IbCCD10a gene. WT represents the Sushu 33 plant, P represents the positive control (recombinant plasmid pCambia1305-IbCCD10a), and W represents the negative control (water).

[0037] To detect the relative expression level of the IbCCD10a gene in plants transgenic with the IbCCD10a gene: Total RNA was extracted from plant leaves and reverse transcribed to obtain complementary deoxyribonucleic acid (cDNA). Using cDNA as a template and sweet potato gene (β-actin) as an internal reference gene, the relative expression level of the IbCCD10a gene was identified by real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR).

[0038] The primers used to detect the IbCCD10a gene are as follows: IbCCD10a-qF: 5′-CAAGAATTGGAGTGATGCCTCG-3′ (SEQ ID NO. 11); IbCCD10a-qR: 5′-CTCTACATGCTATAACCACAACCTC-3′ (SEQ ID NO. 12).

[0039] The primers used to detect the β-actin gene are as follows: Ibactin-F: 5′-AGCAGCATGAAGATTAAGGTTGTAGCAC-3′ (SEQ ID NO. 13); Ibactin-R: 5′-TGGAAAATTAGAAGCACTTCCTGTGAAC-3′ (SEQ ID NO. 14).

[0040] The relative expression level of the IbCCD10a gene is shown in the figure. Figure 2 . Figure 2 In the diagram, L1 and L2 represent different regenerated plants, and WT represents the Sushu 33 plant. The relative expression level of the IbCCD10a gene was significantly higher in all IbCCD10a transgenic plants than in the Sushu 33 plant.

[0041] Example 4

[0042] Characteristic identification of sweet potato plants transgenic with the IbCCD10a gene The plants were transplanted into pots filled with a substrate in the following ratio: vermiculite: nutrient soil: river sand = 3:1:1. The pots with seedlings were placed outdoors in natural light for 45 days. Then, the vine length, average internode length, and gravitational fixation angle were measured, and three biological replicates were set up.

[0043] See plant appearance morphology Figure 3 , vines grow long Figure 4 The average intersegment length is shown in Figure 5 Gravitational fixed-point angles are seen Figure 6 Compared to Sushu 33, the vine length of transgenic sweet potato lines L1 and L2 decreased from 38.83 cm to 9.77 cm and 10.60 cm, respectively, representing reductions of 74.84% and 72.70%; the average internode length decreased from 2.54 cm to 0.67 cm and 0.66 cm, respectively, representing reductions of 73.62% and 74.02%; and the gravity-dependent angle increased from 122.67° to 167.33° and 170.33°, respectively, representing increases of 36.41% and 38.85%.

[0044] Example 5

[0045] Construction of recombinant plasmid pFGC5941-IbCCD10a The restriction enzyme sites of the vector (pFGC5941) and primer sequences were screened using software (SnapGene 4.1.9). The vector (pFGC5941-IbCCD10) was constructed through double enzyme digestion and homologous recombination. The specific steps are as follows: (1) Using the sequencing return plasmid as a template, homologous arms were added to design primers (IbCCD10aM1-F; IbCCD10aM1-R) to clone the meaningful direction of the unique 352 bp sequence of the non-conserved region of IbCCD10a. Then, agarose gel electrophoresis was performed and the sequence was purified by gel recovery.

[0046] IbCCD10aM1-F: 5′- AACATTACAATTACATTTACAATTACCATGGGACGCTGGTCTATCTCAGGCA (SEQ ID NO. 15); IbCCD10aM1-R: 5′-GTAACATAAGAAATTCTTACACATTTAAATCAAGCAGATCCCCCTCAGCA-3′ (SEQ ID NO. 16).

[0047] (2) The empty vector plasmid (pFGC5941) was extracted, double digested with restriction endonucleases (NcoⅠ; SwaⅠ), and the vector fragment was purified and recovered by agarose gel electrophoresis and gel excision.

[0048] (3) The target gene and the linear vector were ligated using a homologous recombination kit (YESEN 10923ES20) to obtain the recombinant plasmid (pFGC5941-M1-IbCCD10a).

[0049] (4) Using the sequencing return plasmid as a template, homologous arm primers (IbCCD10aM2-F; IbCCD10aM2-R) were added to clone the antisense direction of the unique 352 bp sequence of the non-conserved region of IbCCD10a, followed by agarose gel electrophoresis and gel recovery purification.

[0050] IbCCD10aM2-F: 5′-TCCCGGGTCTTAATTAACTCTCTAGAGACGCTGGTCTATCTCAGGCA (SEQ ID NO. 17); IbCCD10aM2-R: 5′-TGGTCAATTTGCAGGTATTTGGATCCCAAGCAGATCCCCCTCAGCA-3′ (SEQ ID NO. 18) (5) Extract the recombinant plasmid (pFGC5941-M1-IbCCD10a), perform double digestion with restriction endonucleases (BamHI and XbaI), and perform agarose gel electrophoresis and gel purification to recover the vector fragment.

[0051] (6) The target gene and the linear vector were ligated using a homologous recombination kit (YESEN 10923ES20) to obtain the recombinant plasmid (pFGC5941-IbCCD10a).

[0052] Example 6

[0053] Obtaining IbCCD10a gene RNA interference sweet potato transgenic plants The recombinant plasmid (pFGC5941-IbCCD10a) was transformed into Agrobacterium tumefaciens (EHA105) by heat shock and used to infect sweet potatoes.

[0054] In a 50 mL centrifuge tube, add 20 mL of liquid LB medium, 20 μL of 100 mg / mL kanamycin, and 20 μL of 50 mg / mL rifampin. Inoculate with 20 μL of the target Agrobacterium tumefaciens bacterial suspension and incubate overnight at 28°C and 250 rpm / min on a shaker. After measuring the OD value of the bacterial suspension, centrifuge at 5000 rpm / min for 5 min to collect the cells. Resuspend the cells in an appropriate amount of liquid MS medium, centrifuge again to collect the cells, and adjust the OD value of the bacterial suspension to 0.2-0.5 with an appropriate amount of liquid MS medium. Add acetylsuccine solution to make the concentration of acetylsuccine in the bacterial suspension 30 mg / L.

[0055] The embryogenic callus tissue of sweet potato 32 was transferred to Agrobacterium solution and placed in a horizontal shaker for 30 min. Then, the centrifuge tube was placed in an ultrasonic bath for 10-15 s to remove the bacterial solution. The sweet potato callus tissue was then transferred onto filter paper and excess bacterial solution was blotted out.

[0056] Embryogenic callus was transferred to solid MS medium containing 30 mg / L acetylsyringone and co-cultured in the dark at 28°C for 3 days. After co-culture, the sweet potato callus was transferred to Erlenmeyer flasks and washed repeatedly with liquid MS 5-6 times until the liquid was clear.

[0057] Transfer embryogenic callus to liquid MS medium + 300 mg / L cefixime and wash once. Remove the liquid, blot off excess liquid culture medium with sterile filter paper, and transfer the embryogenic callus to solid MS medium for extended culture for 1 week.

[0058] After a one-week extended culture period, the embryogenic callus was transferred to a selection medium and screened for three generations at varying concentrations, with subculturing every two weeks. After resistance screening, the resistant embryogenic callus was transferred to MS medium supplemented with 0.1 mg / L abscisic acid to induce callus differentiation. Once the callus turned green and differentiated, it was transferred to MS medium with halved sucrose to induce the formation of regenerated sweet potato plants.

[0059] Polymerase chain reaction (PCR) identification of sweet potato regenerated plants: Genomic DNA was extracted from plant leaves and amplified by polymerase chain reaction (PCR) using primer pairs (M2F and M2R). Then, 1% agarose gel electrophoresis was performed. If a specific band of about 527 bp was shown, it indicated that the polymerase chain reaction (PCR) identification was positive.

[0060] M2F: 5′-GGTCAATTTGCAGGTATTTGGATCC-3′ (SEQ ID NO. 19); M2R: 5′-GGCGGTAAGGATCTGAGCTACAC-3′ (SEQ ID NO. 20).

[0061] Electrophoresis images of some plants are shown below. Figure 7 . Figure 7 In the diagram, M represents a DNA molecular marker, Ri1 and Ri2 represent plants transgenic with the IbCCD10a gene. WT represents the Xushu 32 plant, P represents the positive control (recombinant plasmid pFGC5941-IbCCD10a), and W represents the negative control (water).

[0062] To detect the relative expression level of the IbCCD10a gene in plants with IbCCD10a RNA interference: Total RNA was extracted from plant leaves and reverse transcribed to obtain complementary deoxyribonucleic acid (cDNA). Using cDNA as a template and sweet potato β-actin gene as an internal reference gene, the relative expression level of the IbCCD10a gene was identified by real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR).

[0063] The primers used to detect the IbCCD10a gene are as follows: IbCCD10a-qF: 5′-CAAGAATTGGAGTGATGCCTCG-3′ (SEQ ID NO. 11); IbCCD10a-qR: 5′-CTCTACATGCTATAACCACAACCTC-3′ (SEQ ID NO. 12).

[0064] The primers used to detect the β-actin gene are as follows: Ibactin-F: 5′-AGCAGCATGAAGATTAAGGTTGTAGCAC-3′ (SEQ ID NO. 13); Ibactin-R: 5′-TGGAAAATTAGAAGCACTTCCTGTGAAC-3′ (SEQ ID NO. 14).

[0065] The relative expression level of the IbCCD10a gene is shown in the figure. Figure 8 . Figure 8 In the diagram, Ri1 and Ri2 represent different regenerated plants, and WT represents the Xushu 32 plant. The relative expression levels of the IbCCD10a gene in the regenerated plants Ri1 and Ri2 were significantly lower than those in the Xushu 32 plant.

[0066] Characteristic identification of plants with RNA interference: Transplant the plants into pots filled with a substrate in the following ratio: vermiculite: potting soil: river sand = 3:1:1. Place the pots with seedlings outdoors under natural light for 45 days, then measure the vine length and average internode length, setting up 3 biological replicates.

[0067] See plant appearance morphology Figure 9 , vines grow long Figure 10 The average intersegment length is shown in Figure 11 Compared to Xushu 32, the vine length of regenerated plants Ri1 and Ri2 increased from 15.83 cm to 22.40 cm and 25.73 cm, respectively, representing increases of 41.50% and 62.54%; the average internode length increased from 8.63 mm to 12.17 cm and 13.75 cm, respectively, representing increases of 41.02% and 59.33%.

Claims

1. A sweet potato IbCCD10a protein, characterized in that, The amino acid sequence of the sweet potato IbCCD10a protein is shown in SEQ ID No.

2.

2. A sweet potato IbCCD10a gene, characterized in that, The sweet potato IbCCD10a gene encodes the sweet potato IbCCD10a protein of claim 1, and the nucleotide sequence of the sweet potato IbCCD10a gene is shown in SEQ ID NO.

1.

3. The expression cassette, recombinant vector, recombinant microorganism, or transgenic cell line of the sweet potato IbCCD10a gene as described in claim 2.

4. The application of the sweet potato IbCCD10a protein of claim 1 or the sweet potato IbCCD10a gene of claim 2 in enhancing sweet potato uprightness and reducing sweet potato vine length and average internode length.

5. A method for enhancing the uprightness of sweet potatoes and reducing vine length and average internode length, characterized in that, The method includes increasing the content and / or activity of the protein of claim 1 in the target plant to obtain plants with enhanced uprightness, vine length and average internode length smaller than those of the target plant.

6. The method for enhancing the uprightness of sweet potatoes, reducing vine length and average internode length according to claim 5, characterized in that, The recombinant plasmid pCambia1305-IbCCD10a was constructed by double enzyme digestion and homologous recombination, and introduced into the target plant to obtain transgenic sweet potato. Compared with the target plant, the transgenic sweet potato has enhanced uprightness, reduced vine length and average internode length.

7. The method for enhancing the uprightness of sweet potatoes, reducing vine length and average internode length according to claim 6, characterized in that, The primer sequences used to construct the recombinant plasmid pCambia1305-IbCCD10a are shown in SEQ ID NO.7 and SEQ ID NO.

8.

8. The method for enhancing the uprightness of sweet potatoes, reducing vine length and average internode length according to claim 6, characterized in that, The primer sequences for identifying genetically modified sweet potatoes are shown in SEQ ID NO.9 and SEQ ID NO.

10.

9. The method for enhancing the uprightness of sweet potatoes, reducing vine length and average internode length according to claim 6, characterized in that, Double digestion was performed using XbaI and BstEII restriction endonucleases.

Citation Information

Patent Citations

  • IbFLZ9 gene and application of IbFLZ9 gene in regulation and control of growth of sweet potato stems and vines

    CN120796313A

  • Gene targets for nitrogen fixation targeting for improving plant traits

    IN202017018963A