Blue-green algae tRNA switch and application thereof

Abstract

The invention relates to the technical field of biology, in particular to a cyanobacteria tRNA switch and application thereof. The tRNA anti-escape switch suitable for blue-green algae is developed, meanwhile, the expression application condition of blue-green algae genes is screened, appropriate reporter genes are selected, and a reporting system matched with the tRNA anti-escape switch is constructed. The tRNA anti-escape switch and the tRNA anti-escape switch report system provided by the invention can be used for blue-green algae, a traditional gene regulation mode of the blue-green algae is changed, and a new thought and a new method are provided for blue-green algae gene editing.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biotechnology, in particular to a cyanobacterial tRNA switch and application thereof. BACKGROUND

[0002] Nowadays, biotechnology is developing rapidly, and more and more life forms have been modified or artificially synthesized, accompanied by increasing biological pollution. Under this situation, it is urgent to develop an anti-escape technology to protect the safety of genetically edited life forms. One of the current anti-escape strategies is to regulate genes; some specific genetic information is used to induce the start switch or construct a nutrition-deficient organism, so that these artificially modified life forms can only survive under specific laboratory conditions, thereby achieving the effect of anti-escape. However, this strategy cannot avoid the natural intercommunication between genes and the genetic mutation of life forms.

[0003] In order to develop a new anti-escape strategy, Jia et al. proposed a tRNA-based anti-escape system, which modifies the recognition region of tRNA so that tRNA can recognize the stop codon, and can thus mutate the exogenous gene, introduce the stop codon to eliminate the function, so that the exogenous gene can only be expressed in the presence of specific tRNA, thereby achieving the effect of preventing exogenous gene leakage.

[0004] However, the genome and tRNA of Escherichia coli and cyanobacteria are too different to be directly applied. At present, the anti-escape system for cyanobacteria mainly focuses on gene regulation, but the gene manipulation means in cyanobacteria is relatively scarce, and the operable gene element module is also relatively few, which increases the difficulty of realizing anti-escape through gene regulation in cyanobacteria; therefore, it is crucial to develop a new effective anti-escape system for cyanobacteria. SUMMARY

[0005] Therefore, the technical problem to be solved by the present application is to provide a cyanobacterial tRNA switch and application thereof.

[0006] The present application provides a tRNA anti-escape switch, which comprises an inducible promoter and a variant tRNA.

[0007] The variant tRNA comprises a reverse codon carried by the tRNA for recognizing an amino acid codon, which is mutated to recognize a stop codon.

[0008] The amino acid comprises at least one of lysine, threonine, leucine, isoleucine, valine, methionine, tryptophan, phenylalanine, histidine, arginine, glycine, alanine, cysteine, aspartic acid, asparagine, glutamine, proline, serine, tyrosine and / or hydroxyproline.

[0009] The stop codon comprises TAG, TAA and / or TGA.

[0010] The inducible promoter comprises a chemical inducible promoter, a temperature inducible promoter and / or a light inducible promoter; the chemical inducible promoter comprises pLac, pTrp, pTac and / or pBad.

[0011] Further,

[0012] The inducible promoter is pTac;

[0013] The amino acid comprises tyrosine;

[0014] The stop codon comprises TAG and / or TGA.

[0015] Further, the tRNA switch comprises a pTac promoter and a variant tRNA as shown in SEQ ID NO: 2; the nucleotide sequence of the pTac promoter is shown in SEQ ID NO: 1.

[0016] The tRNA anti-escape switch is optimized in the application, including screening of the type of variant tRNA, analysis and selection of the preference of the stop codon, etc. The test results show that the tyrosine tRNA is better for preventing gene escape of cyanobacteria.

[0017] The application first develops a tRNA anti-escape switch suitable for cyanobacteria, and the tyrosine tRNA developed in the application has a wider application range compared with other switches, and other tRNA switches are difficult to function in other types of cyanobacteria.

[0018] Since there are more than 2000 types of cyanobacteria, and the genetic parentage between different species is unknown, compared with the model organism Escherichia coli, the parentage and universality are relatively backward, so the application first develops a tyrosine tRNA in cyanobacteria to attempt the tRNA anti-escape switch.

[0019] The application provides a tRNA anti-escape switch reporter system, which comprises the tRNA switch and the reporter gene.

[0020] Further, the reporter gene comprises a green fluorescent protein reporter gene, a red fluorescent protein reporter gene, a yellow fluorescent protein reporter gene, a photosensitive or temperature-sensitive reporter gene and / or a LacZ reporter gene; the application is obtained by test screening, and the effect of the LacZ reporter gene for detecting and verifying the performance of the tRNA anti-escape switch is significantly better than that of other reporter genes.

[0021] The tRNA anti-escape switch and / or tRNA anti-escape switch reporter system of the present application is a nucleic acid; in the present application, the nucleic acid can be DNA, RNA, cDNA or PNA. In the embodiments of the present application, the nucleic acid is in the form of DNA. The DNA form includes cDNA, genomic DNA or artificially synthesized DNA. The DNA can be single-stranded or double-stranded. The nucleic acid can include nucleotide sequences with different functions, such as coding regions and non-coding regions such as regulatory sequences (e.g., promoters or transcription terminators). The nucleic acid can be linear or circular in topology. The nucleic acid can be part of a vector (such as an expression or cloning vector) or a fragment. The nucleic acid can be obtained directly from a natural source, or can be prepared with the aid of recombinant, enzymatic or chemical techniques.

[0022] The present application also provides a transcription unit comprising the nucleic acid, which refers to a DNA sequence from the start of the promoter to the end of the terminator. The promoter and the terminator can also include regulatory fragments on both sides or between them, which can include promoters, enhancers, transcription termination signals, polyadenylation sequences, replication origins, nucleic acid restriction sites, and homologous recombination sites, such as enhancers of promoters, poly(A) signals, etc., which are operably linked to the nucleic acid sequence.

[0023] The recombinant vector of the present application refers to a recombinant nucleic acid vector, which is a recombinant DNA molecule comprising a desired coding sequence and appropriate nucleic acid sequences or elements necessary for the expression of the operably linked coding gene in a specific host organism or for gene editing. The recombinant vector is transformed into a suitable host, and the vector can replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. In this specification, "plasmid" and "vector" can sometimes be used interchangeably, as plasmids are the most commonly used form of vector currently. However, the present application is intended to include such other forms of expression vectors that function the same way, which are known in the art or will become known, including but not limited to: plasmids, viral vectors and / or only potential genomic inserts. In specific embodiments, the nucleic acid is constructed in various vectors to form a recombinant vector.

[0024] The host cell of the present application is transformed or transfected with the recombinant vector, and the vector constructed using recombinant DNA technology is used to transform or transfect the host cell, so that the transformed host cell has the ability to replicate or function accordingly.

[0025] Further, the transformation method includes chemical transformation and electroporation; the transfection method includes calcium phosphate coprecipitation, artificial liposome method, viral transfection. The viral transfection includes adenovirus transfection, adeno-associated virus transfection, lentivirus transfection, etc.

[0026] Further, the host cell of the present application includes plant, animal, bacteria, fungus, bacteriophage or virus, and the present application does not limit the source of the host cell. In some embodiments of the present application, the host is cyanobacteria, and in particular, Synechococcus and / or Synechocystis.

[0027] The present application provides a biological material, characterized in that it comprises at least one of the following I) to III):

[0028] I) a recombinant vector comprising the tRNA anti-escape switch of the present application or the tRNA anti-escape switch reporter system of the present application;

[0029] II) a host cell transformed and / or transfected with the recombinant vector of A);

[0030] III) a culture obtained by culturing the host cell of II).

[0031] The present application provides at least one of the following i) to iii) for use in preventing gene escape, developing an anti-escape switch system and / or detecting the performance of an anti-escape switch system:

[0032] i) the tRNA anti-escape switch of the present application;

[0033] ii) the tRNA anti-escape switch reporter system of the present application;

[0034] iii) the biological material of the present application.

[0035] Further, in the use of the present application, the host includes cyanobacteria, and in particular, Synechococcus and / or Synechocystis. In some embodiments of the present application, the cyanobacteria includes Synechococcus sp. PCC7942 (Synechococcus sp. PCC7942) and / or Synechocystis sp. PCC6803 (Synechocystis sp. PCC6803), and the test results show that the tRNA anti-escape switch of the present application works better in Synechococcus sp. PCC7942 than in Synechocystis sp. PCC6803.

[0036] The present application provides a product for preventing gene escape, developing an anti-escape switch system and / or detecting the performance of an anti-escape switch system, characterized in that it comprises an auxiliary material and at least one of the following A) to C):

[0037] A) the tRNA anti-escape switch of the present application;

[0038] B) the tRNA anti-escape switch reporter system of the present application;

[0039] C) the biological material of the present application.

[0040] Further, the auxiliary materials include, but are not limited to, buffers, culture media and / or antibiotics, etc.

[0041] The present application provides a biological gene anti-escape method, which is a tRNA anti-escape switch.

[0042] The present application provides a biological anti-escape switch system development and / or performance detection method, which is a tRNA anti-escape switch reporter system.

[0043] The present application develops a tRNA anti-escape switch suitable for cyanobacteria, and selects a suitable reporter gene by screening the expression application of cyanobacterial genes, and constructs a reporter system matched with the tRNA anti-escape switch. The tRNA anti-escape switch and the tRNA anti-escape switch reporter system provided by the present application can be used for cyanobacteria, change the traditional gene regulation mode of cyanobacteria, and provide a new idea and a new method for cyanobacterial gene editing. BRIEF DESCRIPTION OF DRAWINGS

[0044] Figure 1 Mutation of tRNA-GUA (35-36) in Synechococcus sp. PCC7942 strain;

[0045] Figure 2 Mutation of tRNA-GUA (35-36) in Synechococcus sp. PCC6803 strain;

[0046] Figure 3 Mutation of lacZ gene (296-297);

[0047] Figure 4 Construction of tRNA detection system (tRNA-report-7942-1) in PCC7942;

[0048] Figure 5 Construction of tRNA detection system (tRNA-report-6803-1) in PCC6803;

[0049] Figure 6 Construction of tRNA-report-7942-2;

[0050] Figure 7 2 beta-galactosidase activity of tRNA-report-7942-1 and tRNA-report-7942-2. DETAILED DESCRIPTION

[0051] The present application provides cyanobacterial tRNA switch and its application, those skilled in the art can learn from the content herein, and improve the process parameters as appropriate to achieve. In particular, it is pointed out that all similar substitutions and changes are obvious to those skilled in the art, and they are considered to be included in the present application. The method and application of the present application have been described by the preferred embodiments, and the relevant personnel can obviously modify or appropriately change and combine the method and application herein without departing from the content, spirit and scope of the present application, to realize and apply the present application technology.

[0052] The pTac promoter sequence is:

[0053] ttgacaattaatcatccggctcgtataatgtgtggaattgtgagcggataacaatttcacacaggaaacagacc (SEQ ID NO: 1);

[0054] The variant tRNA sequence of tyrosine in PCC7942 is:

[0055] gggtcgatgcccgagtggttaatgggggtggactTCaaatccactggctacgcctacgctggttcgaatccagctc ggccca (SEQ ID NO: 2);

[0056] The variant tRNA sequence of tyrosine in PCC6803 is:

[0057] gggtcgatgcccgagtggttaatgggggtggactTCaaatccactggctacgcctacgctggttcgaatccagctc ggccca (SEQ ID NO: 3);

[0058] The test materials used in the present application are ordinary commercially available products and can be purchased in the market. The present application is further described below in combination with examples:

[0059] Example 1 tRNA mutation

[0060] 1. tRNA mutation in PCC7942 and PCC6803

[0061] Jia et al. proposed a tRNA-based escape prevention system, which modifies the recognition region of tRNA so that tRNA can recognize the stop codon, and can thus mutate the foreign gene to introduce a stop codon elimination function, so that the foreign gene can only be expressed in the presence of a specific tRNA, achieving the effect of preventing the leakage of foreign genes.

[0062] The application can also develop an escape prevention system in cyanobacteria by modifying tRNA in cyanobacteria, by finding tRNA sequences in sequenced cyanobacteria, changing the recognition region, and then selecting a suitable reporter gene and introducing point mutations at the appropriate position to destroy the translation of the original gene. Finally, the expression of the tRNA is regulated by an inducible promoter, and the expression of the reporter gene is detected to verify whether the reporter gene can be expressed better in the presence of tRNA variants, and the effect of preventing escape in cyanobacteria is achieved.

[0063] The gene manipulation means in cyanobacteria is relatively scarce, and the application realizes the manipulation of cyanobacterial genes by modifying tRNA in cyanobacteria. It is proved by test screening that tyrosine tRNA-TGA can more efficiently and accurately realize the manipulation of cyanobacterial genes:

[0064] There are more than 2000 species of cyanobacteria, and the research on genome sequencing and annotation of cyanobacteria is less, and after screening, Synechococcus sp. PCC7942 and Synechocystis. PCC 6803 are selected as research targets for tRNA development. The development steps of tyrosine tRNA-TGA in the above two algae are as follows:

[0065] tRNA-GUA is found in the whole genome of Synechococcus sp. PCC7942, which is 82 bp long and is responsible for recognizing tyrosine. Then the specific position of the anticodon in the tRNA sequence is determined by tRNAdb website trna.bioinf.uni-leipzig.de (35bp-36bp mutation, SEQ ID NO: 2), and it is mutated to TAG in Snapgene software. The specific sequence and mutation position are shown in Figure 1 .

[0066] The length of tRNA-GUA in the genome of Synechocystis sp. PCC6803 is 82 bp, and the base GT is changed to TC at (35bp-36bp), so that the recognition region is changed from TAC to TGA. The specific sequence (SEQ ID NO: 3) and mutation position are shown in Figure 2 .

[0067] The tRNA-GUA of tyrosine of PCC7942 and PCC6803 has a length of 82 bp, belongs to an oligonucleotide chain, and is difficult to develop. Although the genomes of PCC7942 and PCC6803 can be obtained through conventional means, and primers can be designed to attempt to obtain tRNA-GUA from the genomes through PCR, the PCR product is too short, with a tRNA length of less than 100 bp. Such a PCR product is difficult to recover, and if the length of the fragment is enlarged, the tRNA sequence will be mixed with other sequences, which can affect the experiment. After several attempts, the strategy of PCA assembly is finally adopted, the sequence of tRNA is split into several segments, primers are synthesized, and then the tRNA fragment is obtained through PCR splicing, so that the tRNA fragment can be successfully assembled.

[0068] 2. Verification of the construction of the tRNA functional system

[0069] At present, there are few studies on gene expression of cyanobacteria at home and abroad, far less than the existing model organisms Escherichia coli and Saccharomyces cerevisiae. There is a huge species difference between cyanobacteria and model organisms such as Escherichia coli and Saccharomyces cerevisiae. Therefore, the reporter system of the tRNA switch of cyanobacteria needs to be developed.

[0070] The reporter gene suitable for the tRNA switch reporter system is screened in cyanobacteria. The product of green gene expression will conflict with the color of cyanobacteria itself, resulting in inconspicuous reporting. The expression effect of red fluorescent gene in PCC7942 is poor. The lacZ gene has good expression effect in cyanobacteria, and the detection method is simple, so it is more suitable for the development of the tRNA switch reporter system.

[0071] A Tyr amino acid on lacZ is subjected to point mutation, and the position is shown in Figure 3 The Tyr amino acid is changed to TGA, interrupting the translation process of the amino acid chain and destroying its function. The mutated lacZ gene and the mutant tRNA (PCC7942-tRNA variant) of PCC7942 and the ptrc-laco and lacI genes are connected, and then connected with the linearized Escherichia coli-cyanobacteria shuttle vector PJA2 and the Saccharomyces cerevisiae vector PRS415, assembled in yeast through homologous recombination, and transformed into Escherichia coli, as shown in Figure 4 The constructed plasmid is named tRNA-report-7942-1, and then transferred to PCC7942 through triparental mating.

[0072] The procedure for establishing the tRNA switch system in PCC6803 is similar to that in PCC7942. The mutant lacZ gene and the mutant tRNA of PCC6803 (PCC6803-tRNA variant) and ptrc-laco (isopropyl-β-d-1-thiogalactopyranoside (IPTG) inducible) and lacI gene are connected, and are connected with the linearized Escherichia coli-cyanobacteria shuttle vector PJA2 and the Saccharomyces cerevisiae vector PRS415, assembled in yeast by homologous recombination, transformed into Escherichia coli, and then transferred to PCC6803 by triparental mating, as shown in Figure 5 The constructed plasmid is named tRNA-report-6803-1.

[0073] The expression of tRNA is placed under the control of an inducible promoter, and the tRNA can be expressed only after the addition of an inducer, thereby regulating the expression of lacZ. In this way, the effect of tRNA is positively related to the expression level of lacZ, and the effect of tRNA in gene regulation can be detected by detecting the activity of the lacZ expression product β-galactosidase.

[0074] 3. Detecting tRNA function by measuring β-galactosidase activity

[0075] In order to verify whether the modified tRNA functions, the mutant lacZ gene in tRNA-report-7942-1 is connected with the Escherichia coli-cyanobacteria-Saccharomyces cerevisiae shuttle vector alone (without the tRNA variant segment, other elements are the same), as shown in Figure 6 The constructed plasmid is named tRNA-report-7942-2, which is used as a negative control to detect β-galactosidase activity together with tRNA-report-7942-1 and tRNA-report-6803-1. The successfully transformed tRNA-report-7942-1, 2 and tRNA-report-6803-1 are cultured, and the cells are harvested in the logarithmic phase, centrifuged and disrupted to release β-galactosidase, which is incubated with OPNG (Chinese name: o-nitrophenyl-β-D-galactopyranoside, English name: 2-Nitrophenyl β-D-galactopyranoside), and the β-galactosidase activity is measured to determine the effect of tRNA in gene regulation.

[0076] The β-galactosidase activity determination method is as follows: 1 mL of Synechocystis sp. after culture is taken, and the OD 730The precipitate was collected by centrifugation at 13000×g. 1 mL of Z buffer (60 mM disodium hydrogen phosphate, 40 mM sodium dihydrogen phosphate, 10 mM potassium chloride, 1 mM magnesium sulfate, and 40 mM β-mercaptoethanol), 50 μL of 0.1% sodium dodecyl sulfate, 50 μL of chloroform, and 200 μL of o-nitrobenzene-β-D-galactoside (ONPG; 4 mg / mL) were added sequentially, and the mixture was incubated at 30 °C for 20 min. Finally, 500 μL of 1 M sodium carbonate was added to stop the reaction. The final solution was centrifuged at 13000×g for 2 min, and the OD of the supernatant was measured. 420 The formula for quantifying LacZ activity: "Miller = 1000 × OD" 420 / (1mL×20minOD 730 )".

[0077] After adding the inducer, OD under the same growth conditions 730 =0.5, the β-galactosidase activity of tRNA-report-7942-1 and 2 was measured, such as Figure 7 As shown, compared to tRNA-report-7942-2, tRNA-report-7942-1 successfully enhanced β-galactosidase activity, indicating that in the presence of mutant tRNA, it can repair damaged amino acid chains and increase lacZ expression.

[0078] However, in the cyanobacterium PCC6803, neither the experimental group tRNA-report-6803-1 (whose β-galactosidase activity was close to zero) nor the control group tRNA-report-7942-2 showed β-galactosidase activity. This indicates that a mutation was performed on the tyrosine-containing tRNA-GUA in the cyanobacterium PCC6803, but the mutant tRNA could not function properly in PCC6803. In contrast, the tRNA switching system in the cyanobacterium PCC7942 functioned normally. This suggests that the mutation was based on cyanobacterial genes. The lack of operating systems and the complexity of the operational background mean that tRNA cannot function well in PCC6803. However, in the current state of cyanobacterial gene manipulation, achieving something from scratch and then being able to achieve experimental objectives to a certain extent is crucial for further research on cyanobacterial gene networks and lays the foundation for subsequent research. Furthermore, the tRNA-report-7942-1 of this invention successfully enhanced β-galactosidase activity, discovering a practical tool in the gene editing of Synechococcus PCC7942 and achieving the goal of preventing gene escape in cyanobacteria.

[0079] The above merely is the preferred embodiment of the present application, it should be pointed out that, for ordinary skilled in the art, without departing from the principles of the present application, can also make a number of improvements and refinements, these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. A tRNA anti-escape switch, characterized in that The tRNA includes an inducible promoter and a variant tRNA. The variant tRNA includes a mutation of an anticodon carried by the tRNA for recognizing a codon of an amino acid to recognize a stop codon. The amino acid includes at least one of lysine, threonine, leucine, isoleucine, valine, methionine, tryptophan, phenylalanine, histidine, arginine, glycine, alanine, cysteine, aspartic acid, asparagine, glutamine, proline, serine, tyrosine, and / or hydroxyproline. The stop codon includes TAG, TAA, and / or TGA. The inducible promoter includes a chemical inducible promoter, a temperature inducible promoter, and / or a light inducible promoter; the chemical inducible promoter includes pLac, pTrp, pTac, and / or pBad.

2. The tRNA escape prevention switch according to claim 1, wherein The inducible promoter is pTac. The amino acid includes tyrosine. The stop codon includes TAG and / or TGA.

3. The tRNA anti-escape switch of claim 1 or 2, wherein, The tRNA switch includes a pTac promoter and a variant tRNA as shown in SEQ ID NO:

2.

4. A tRNA escape prevention switch reporter system, comprising the tRNA switch according to any one of claims 1 to 3 and a reporter gene.

5. The tRNA anti -escape switch reporter system of claim 4, wherein, The reporter gene includes LacZ.

6. Biomaterials characterized in that, The biological material includes at least one of I) to III) as follows: I) a recombinant vector containing the tRNA escape prevention switch according to any one of claims 1 to 3 or the tRNA escape prevention switch reporter system according to claim 4 or 5; II) a host cell transformed and / or transfected with the recombinant vector as described in A); III) a culture obtained by culturing the host cell as described in II).

7. Use of at least one of i) to iii) as follows in the development of a biological prevention of gene escape, an escape prevention switch system, and / or the detection of the performance of an escape prevention switch system: i) the tRNA escape prevention switch according to any one of claims 1 to 3; ii) the tRNA escape prevention switch reporter system according to claim 4 or 5; iii) the biological material according to claim 6.

8. Use according to claim 7, characterized in that, The biological material includes at least one of I) to III) as follows:

9. Products for the development of and / or the performance testing of biological containment escape prevention, escape prevention switch systems, characterized in that A) the tRNA escape prevention switch according to any one of claims 1 to 3; B) the tRNA escape prevention switch reporter system according to claim 4 or 5; C) the biological material according to claim 6. The tRNA escape prevention switch according to any one of claims 1 to 3 is used.

10. A method for bio-genetic escape prevention, characterized by ​

Images