Application of pepper promoter CanASP25 in driving anther expression

Abstract

The invention relates to application of a pepper promoter CanASP25 in driving anther expression, and belongs to the technical field of gene engineering. The nucleotide sequence of the pepper promoter CanASP25 is shown as SEQ ID NO.5, and the pepper promoter CanASP25 can drive specific expression of anther in plants, can be used for creating male sterile lines, crop hybrid seed production and crop crossbreeding, can improve the seed purity and hybrid seed production and crossbreeding efficiency, and has a wide application prospect. Therefore, an effective tool gene is provided for anther specific expression regulation and pollen expression regulation of pepper and other solanaceae crops.

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of genetic engineering, and particularly relates to application of a pepper promoter CanASP25 in driving anther expression. BACKGROUND

[0002] A plant promoter is a DNA sequence for regulating transcription initiation of a gene, and specific expression characteristics of the plant promoter have important application values in crop genetic improvement. An anther-specific promoter can drive specific expression of a target gene in an anther tissue, and is widely applied to fields such as construction of a male sterile line, hybrid seed production, pollen fertility regulation and biological safety control. At present, an anther-specific promoter has been reported in crops such as Arabidopsis, rice and corn, but research on the anther-specific promoter of a pepper is still blank.

[0003] Common anther promoters are mostly derived from model plants or other crops, such as rice OsIPA and corn Zm13, however, these promoters have problems such as low expression efficiency, poor tissue specificity, weak species adaptability, easy influence by a genomic position effect and the like in the pepper, are difficult to realize accurate anther directional expression of the pepper, cannot meet the demand of accurate pollen fertility regulation in pepper hybrid breeding, and greatly limit the application in pepper molecular breeding. SUMMARY

[0004] The application aims to provide application of a pepper promoter CanASP25 in driving anther expression, and to provide an effective tool gene for creation of a pepper male sterile line, hybrid breeding and pollen fertility regulation.

[0005] In order to realize the above application purposes, the application provides the following technical solutions. The application provides application of a pepper promoter CanASP25 in driving anther expression, and the nucleotide sequence of the pepper promoter CanASP25 is shown as SEQ ID NO. 5.

[0006] The application further provides a primer pair for amplifying the pepper promoter CanASP25, and the nucleotide sequences of the primer pair are shown as SEQ ID NO. 6-7. The nucleotide sequence of the pepper promoter CanASP25 is shown as SEQ ID NO. 5.

[0007] The application further provides a recombinant plasmid for expressing the pepper promoter CanASP25, and the recombinant plasmid comprises the pepper promoter CanASP25 and a blank vector. The nucleotide sequence of the pepper promoter CanASP25 is shown as SEQ ID NO. 5. The blank vector is pCAMBIA1305.

[0008] The application further provides a recombinant bacterium expressing the pepper promoter CanASP25, wherein the recombinant bacterium comprises the recombinant plasmid and an empty bacterium. The empty bacterium is an Agrobacterium GV3101 strain.

[0009] The application further provides an application of the recombinant plasmid or the recombinant bacterium in driving anther expression.

[0010] The application further provides an application of the recombinant plasmid or the recombinant bacterium in creating a male sterile line.

[0011] The application further provides an application of the recombinant plasmid or the recombinant bacterium in crop seed production and / or breeding.

[0012] The application further provides an application of the recombinant plasmid or the recombinant bacterium in regulating pollen fertility.

[0013] The application has the following technical effects and advantages: The application first identifies an anther-specific promoter CanASP25 in peppers, which can drive anther-specific expression in plants, and can be used for creating a male sterile line, crop hybrid seed production and crop hybrid breeding, thereby improving seed purity, hybrid seed production and hybrid breeding efficiency, and providing an effective tool gene for anther-specific expression regulation and pollen expression regulation of peppers and other Solanaceae crops. BRIEF DESCRIPTION OF DRAWINGS

[0014] Figure 1 The qRT-PCR result of the pepper promoter CanASP25, wherein 4R, 4S and 4L are root tissue, stem tissue and leaf tissue of a pepper grown for 4 weeks, 10R, 10S and 10L are root tissue, stem tissue and leaf tissue of a pepper grown for 10 weeks, FL1 and FL2 are leaf tissue at the flower bud stage and the full bloom stage, and FR1, FR2, FR3 and FR4 are root tissue at the fruit setting stage, the green and mature stage, the color changing stage and the mature stage, respectively; Figure 2 The electrophoresis detection result of the pepper promoter CanASP25; Figure 3 The vector map of the pepper promoter pCAMBIA1305-GUS; Figure 4 The colony PCR positive identification result of the E. coli DH5a strain; Figure 5 The identification result of the positive Arabidopsis plant; Figure 6 The GUS tissue chemical staining result of the homozygous transgenic Arabidopsis line. DETAILED DESCRIPTION

[0015] The technical solutions provided by the present application are described in detail below in combination with examples, but they should not be understood as limiting the scope of protection of the present application.

[0016] In the test materials of the present application, the ST-8 variety of pepper is from Huazhong Agricultural University; In the reagents of the present application, SuperScript TM II reverse transcriptase is purchased from Invitrogen Company of the United States, and qPCR SYBR Green Master Mix is purchased from Nanjing Novozyme Bio-tech Co., Ltd.; In the instruments of the present application, Lightcycle 480 type quantitative PCR instrument is purchased from Roche Company of Switzerland.

[0017] Example 1: Expression pattern of pepper promoter CanASP25 Trizol method is used to extract RNA in root tissue (4R), stem tissue (4S), leaf tissue (4L) of 4-week-old pepper, root tissue (10R), stem tissue (10S), leaf tissue (10L) of 10-week-old pepper, leaf tissue (FL1) in flower bud stage, leaf tissue (FL2) in full flowering stage, root tissue (FR1) in fruit setting stage, root tissue (FR2) in green and mature stage, root tissue (FR3) in color changing stage, and root tissue (FR4) in full mature stage, SuperScript TM II reverse transcriptase is used to reverse transcribe RNA into cDNA, qRT-PCR technology is used to verify the expression pattern of pepper promoter CanASP25 in different tissues in different development periods, Actin is used as the internal reference gene of pepper, and 2 -ΔΔCt method is used to relatively quantify the transcript abundance of each sample, and each primer and result is shown in Table 1 and Figure 1

[0018] Table 1: qRT-PCR related primers Gene Primer sequence (5'-3') SEQ ID NO. CanASP25 F: ATGAAGATGTGTCATCACCCC 1 R: AGAAGAAGAATCCGGCAACA 2 Actin F: GAGGGTGAGTGAGCAGTTC 3 R: CTTCATCGTCATCTGCTGTC 4 The results show that the pepper promoter CanASP25 is a flower organ-specific high expression promoter.

[0019] Example 2: Acquisition and analysis of pepper promoter CanASP25 ​The nucleotide sequence of the PCR primer for amplifying the pepper promoter CanASP25 was designed based on the promoter sequence of about 1500 bp upstream of the CanASP25 gene obtained from the pepper genome database (Sol Genomics Network), and the primer sequence is shown in Table 2; the cDNA of the pepper genome of the ST-8 variety extracted by the CTAB method was used as a template for PCR amplification, and the PCR amplification system was 50 μL, including 2×Phanta Max Buffer 25 μL, 10 mmol / L dNTP mix 1 μL, Phanta Max Super-Fidelity DNA Polymera 1 μL, genomic cDNA 2 μL, CanASP25-F primer 2 μL, CanASP25-R primer 2 μL, and the rest was deionized water; the PCR amplification conditions were: 95°C pre-denaturation for 3 min, followed by 95°C denaturation for 30 s, 55°C reannealing for 30 s, and 72°C extension for 45 s, for a total of 35 cycles, and finally 72°C extension for 2 min, to obtain the pepper promoter CanASP25 sequence (as shown in SEQ ID NO. 5), and the electrophoresis detection result is shown in Figure 2 SEQ ID NO. 5: ​ Table 2 Primers for amplifying pepper promoter CanASP25 Name Primer sequence (5'-3') SEQ ID NO. F TCTAGAGGATCCCCTTTGCAATCCATAGCGCTAC 6 R ACATAAGGGACTGACCACCCTTTTTATTTATTCTATTAGAATTTTC 7 The pepper promoter CanASP25 was cloned into pCAMBIA1305-GUS vector by homologous recombination, and pCAMBIA1305-GUS-CanASP25 plasmid was obtained after the E. coli DH5a strain was transformed. After positive identification by colony PCR, the sequencing was entrusted to Beijing Qikexin Biotechnology Co., Ltd., and the results are shown in Table 1. Figure 3-4

[0020] The results show that the sequencing results and the alignment results of the expected vector sequence are completely consistent, indicating that the vector construction is successful.

[0021] Example 3: Arabidopsis transformation of pepper promoter CanASP25 The pCAMBIA1305-GUS-CanASP25 plasmid with correct sequencing in Example 2 was transformed into Agrobacterium GV3101 strain, and Arabidopsis was transformed by Agrobacterium-mediated flower immersion method to obtain T1 generation Arabidopsis seeds. The single plant genomic DNA of T1 generation Arabidopsis was extracted, and positive identification primers were designed and used for PCR to identify positive Arabidopsis plants. T2 and T3 generation seeds were collected, and homozygous transgenic Arabidopsis lines were obtained by cultivation. The nucleotide sequence of the positive identification primer is shown in Table 3, and the identification results of the positive Arabidopsis plants are shown in Table 4. Figure 5

[0022] Table 3 Positive identification primer Name Primer sequence (5'-3') SEQ ID NO. M13-47 CGCCAGGGTTTTCCCAGTCACGAC 8 Gus-R CTGAATGCCCACAGGCCG 9 The results show that Arabidopsis plants successfully transformed with pepper promoter CanASP25 are obtained.

[0023] Example 4: GUS reporter gene histochemical staining The homozygous transgenic Arabidopsis lines obtained in Example 3 were subjected to GUS histochemical staining, and the results are shown in Table 4. Figure 6

[0024] The results show that GUS signal is only specifically expressed in anthers and not expressed in other tissues, indicating that the pepper promoter CanASP25 is specifically expressed in floral organs.

[0025] ​​​From the above examples, the application provides application of the pepper promoter CanASP25 in driving anther expression. The pepper promoter CanASP25 of the application can drive anther-specific expression in plants, and can be used for creating male sterile lines, crop hybrid seed production and crop hybrid breeding, and can improve seed purity, hybrid seed production and hybrid breeding efficiency, thereby providing effective tool genes for anther-specific expression regulation and pollen expression regulation of peppers and other solanaceous crops.

[0026] The above only describes the preferred embodiments of the present application, and it should be noted that, for those skilled in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, and these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. Use of the Capsicum annuum promoter CanASP25 for driving anther expression, characterized in that, The nucleotide sequence of the pepper promoter CanASP25 is shown as SEQ ID NO.

5.

2. A primer pair for amplifying the pepper promoter CanASP25, characterized in that, The nucleotide sequences of the primer pair are shown as SEQ ID NO. 6-7; The nucleotide sequence of the pepper promoter CanASP25 is shown as SEQ ID NO.

5.

3. A recombinant plasmid expressing a pepper promoter CanASP25, characterized by, The recombinant plasmid comprises the pepper promoter CanASP25 and an empty vector; The nucleotide sequence of the pepper promoter CanASP25 is shown as SEQ ID NO.

5. The empty vector is pCAMBIA1305.

4. A recombinant bacteria expressing the Capsicum promoter CanASP25, characterized in that, The recombinant bacteria comprise the recombinant plasmid of claim 3 and an empty vector; The empty vector is Agrobacterium GV3101 strain.

5. The recombinant plasmid of claim 3 or the recombinant bacteria of claim 4 for use in driving anther expression.

6. The recombinant plasmid of claim 3 or the recombinant bacteria of claim 4 for use in creating a male sterile line.

7. The recombinant plasmid of claim 3 or the recombinant bacteria of claim 4 for use in crop seed production and / or breeding.

8. The role of the recombinant plasmid of claim 3 or the recombinant bacteria of claim 4 in regulating pollen fertility.

Images