Application of OsLNT gene in enhancing low-nitrogen resistance of rice in seedling stage

By overexpressing the OsLNT gene in rice, the problem of limited growth of rice under low nitrogen conditions was solved, the tolerance of rice to low nitrogen was improved, its growth and yield in low nitrogen environment were enhanced, and genetic resources were provided for breeding.

CN121472249APending Publication Date: 2026-02-06AGRI GENOMICS INST CHINESE ACADEMY OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511977438.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-25
Publication Date
2026-02-06

AI Technical Summary

Technical Problem

In existing technologies, rice growth is restricted under low nitrogen conditions, resulting in slowed growth and development, yellowing leaves, stunted plants, reduced tiller number, and lower grain yield. There is a lack of effective low nitrogen tolerance gene resources.

Method used

Overexpression of the OsLNT gene in rice enhances the rice seedlings' tolerance to low nitrogen. By introducing and overexpressing the OsLNT gene into Nipponbare rice, its response to low nitrogen and nitrogen transport capacity are enhanced.

Benefits of technology

Overexpression of the OsLNT gene resulted in higher stem length, root length, root-to-shoot ratio, fresh weight, and dry matter content in rice under low nitrogen conditions. This improved nitrate assimilation efficiency, enhanced rice's tolerance to low nitrogen, and provided important genetic resources for breeding low-nitrogen tolerant rice varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121472249A_ABST
    Figure CN121472249A_ABST
Patent Text Reader

Abstract

The invention discloses an application of an OsLNT (Oryza sativa LNT) gene in enhancing low-nitrogen resistance in a rice seedling stage, and belongs to the technical field of plant genetic engineering and molecular breeding, and a CDS (Coding Sequence) sequence of the OsLNT gene is as shown in SEQ ID No.1. Through overexpression of the OsLNT gene in rice Nipponbare, a new application of the OsLNT gene in enhancement of low nitrogen stress resistance of rice is found, and an important gene resource is provided for cultivation of low nitrogen resistant rice varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering and molecular breeding technology, specifically involving the application of the OsLNT gene in enhancing the low nitrogen tolerance of rice. Background Technology

[0002] Rice (Oryza sativa L.) is one of the most widely cultivated and important food crops globally, with its planting area exceeding two-thirds of the total crop planting area in China. Over 60% of my country's population relies on rice as their staple food. In recent years, my country's rice planting area has remained relatively stable at around 30 million hectares, accounting for a quarter of the total grain planting area, making it the most widely planted grain crop in the country. Currently, my country's rice production and demand are only slightly balanced, but to meet the ever-increasing demand, rice production needs to be increased, placing significant pressure on future grain production. In rice production, increased nitrogen fertilizer application has effectively achieved high yields. However, excessive application of nitrogen fertilizer in farmland not only reduces fertilizer utilization efficiency but also causes serious damage to water resources, soil, and the atmospheric environment. Low-nitrogen-tolerant rice varieties can improve their nitrogen utilization efficiency under low nitrogen conditions, maintain normal growth, reduce rice's dependence on nitrogen fertilizer, and mitigate the environmental damage caused by excessive nitrogen fertilizer application. Therefore, research on low-nitrogen-tolerant genes in rice has become particularly important.

[0003] Nitrogen is an essential nutrient element for plant growth and development, playing a crucial role in crop growth and yield. Nitrogen deficiency has adverse effects on plant growth. On the one hand, it inhibits the growth of above-ground parts while promoting root growth, leading to an increased root-to-shoot ratio. On the other hand, nearly three-quarters of the nitrogen in plant leaves is found in chloroplasts; nitrogen deficiency can reduce chlorophyll content and photosynthetic rate, affecting photosynthesis and causing premature leaf senescence. Therefore, when rice is deficient in nitrogen, its growth rate will continuously slow down or even stop. The visible external manifestations are generally yellowing leaves, stunted plants, and restricted formation and development of reproductive organs, leading to a reduction in tiller number and grain yield. Conversely, excessive nitrogen supply often causes crops to remain vegetatively green and mature late, with a prolonged growing season, dark green leaves, soft plants, and susceptibility to external damage; cereal crops are also prone to lodging.

[0004] Rice tolerance to low nitrogen levels refers to the ability of rice to maintain normal growth and achieve biological yields similar to those under nitrogen-sufficient conditions. Such rice varieties typically exhibit high nitrogen use efficiency (NUE), a complex trait determined by numerous processes including nitrogen uptake, translocation, assimilation, and reuse. It can be simply defined as the grain yield per unit of nitrogen applied, and is a combination of nitrogen uptake efficiency (NUpE) and nitrogen utilization efficiency (NUtE). NUpE is the efficiency with which roots acquire nitrogen from the soil, while NUtE is the efficiency with which plants assimilate and reactivate nitrogen into total biomass or grain yield. Different genotypes of the same crop exhibit varying tolerance to low nitrogen levels and NUE, and the same genotype also shows differences in NUE under different nitrogen supply levels. During the seedling stage, the main indicators for evaluating the tolerance to low nitrogen and nitrogen efficiency of different genotypes include conventional indicators such as plant height, root length, aboveground biomass, root biomass, root-shoot ratio, and root volume. Supplementary indicators may include chlorophyll content, SPAD value, and NR (norepinephrine) activity of enzymes involved in nitrogen assimilation. Finally, the nitrogen efficiency and tolerance to low nitrogen are determined based on the changing trends of these indicators under different nitrogen supplies, or the degree to which the indicators under low nitrogen supply approximate those under normal nitrogen supply.

[0005] This invention aims to discover low-nitrogen-tolerant genes in rice and further explore their functions and applications in regulating the response of rice seedlings to low nitrogen and in nitrogen transport processes, providing new gene resources and theoretical basis for future nitrogen-efficient rice breeding programs. Summary of the Invention

[0006] The technical problem to be solved by this invention is to provide a new use of the OsLNT gene in enhancing the low nitrogen tolerance of rice.

[0007] The technical solution of the present invention is: the application of the OsLNT gene in enhancing the tolerance of rice seedlings to low nitrogen, wherein the nucleotide sequence of the OsLNT gene is as shown in SEQ ID No.1 or a degenerate nucleotide sequence encoding the same protein as SEQ ID No.1.

[0008] Furthermore, the method for enhancing the tolerance of rice seedlings to low nitrogen is to overexpress the OsLNT gene in rice, thereby improving the tolerance of rice to low nitrogen.

[0009] Furthermore, the rice variety mentioned is Nipponbare.

[0010] This invention introduces the OsLNT gene as the target gene into the japonica rice variety Nipponbare to obtain T0 generation overexpressing plants. The T0 generation and subsequent generations were identified using hygromycin primers. RNA was extracted from each generation of overexpressing materials using the Trizol method, and the expression level was detected by RT-PCR. After screening, an independent overexpressing line, OsLNT-OE1, was finally obtained. Phenotypic indicators, including relative stem length, relative root length, relative root-to-shoot ratio, relative stem fresh weight, relative root fresh weight, relative stem dry weight, relative root dry weight, and relative dry matter, were analyzed after low-nitrogen treatment of OsLNT-OE1 and its control wild-type Nipponbare rice plants. The results showed that all of these indicators were higher in OsLNT-OE1 than in Nipponbare after low-nitrogen treatment.

[0011] Rice leaves and roots were sampled after 14 days of low-nitrogen treatment to detect relative chlorophyll content and relative nitrate nitrogen (NO3). - The study measured the nitrate content, relative nitrate reductase (NR) activity, and relative nitrite reductase (NiR) activity. The results showed that OsLNT-OE1 plants had a higher nitrate assimilation efficiency than wild-type Nipponbare rice.

[0012] The above experiments demonstrate that overexpression of the OsLNT gene can improve the resistance of rice to low nitrogen stress, indicating that the OsLNT gene has significant application value in plant low nitrogen tolerance genetic engineering.

[0013] Compared with the prior art, the present invention has the following beneficial effects:

[0014] This invention discovers a new use for the OsLNT gene in enhancing the low nitrogen tolerance of rice by overexpressing the OsLNT gene in wild-type Nipponbare rice plants, and provides an important genetic resource for breeding low nitrogen tolerant rice varieties. Attached Figure Description

[0015] Figure 1 This is a graph showing the expression levels of the OsLNT gene in wild-type and OsLNT-overexpressing plants.

[0016] Figure 2 The growth of OsLNT gene overexpressing plants and wild-type plants during the seedling stage under low nitrogen (LN) and normal nitrogen (NN) treatments.

[0017] Figure 3 The relative stem length, relative root length, relative root-to-shoot ratio, relative stem fresh weight, relative root fresh weight, relative stem dry weight, relative root dry weight, and relative dry matter content were measured in rice OsLNT gene overexpressing plants and wild-type plants after 14 days of low nitrogen stress.

[0018] A: Comparison of relative stem length between wild-type and OsLNT-overexpressing plants;

[0019] B: Comparison of relative root length between wild-type and OsLNT-overexpressing plants;

[0020] C: Comparison of the relative root-to-shoot ratio between wild-type and OsLNT-overexpressing plants;

[0021] D: Comparison of relative fresh stem weight between wild-type and OsLNT-overexpressing plants;

[0022] E: Comparison of relative root fresh weight between wild-type and OsLNT-overexpressing plants;

[0023] F: Comparison of relative stem weight between wild-type and OsLNT-overexpressing plants;

[0024] G: Comparison of relative root dry weight between wild-type and OsLNT-overexpressing plants;

[0025] H: Comparison of relative dry weight between wild-type and OsLNT-overexpressing plants.

[0026] Figure 4 The relative chlorophyll content, relative nitrate nitrogen content, relative nitrate reductase activity, and relative nitrite reductase activity of rice OsLNT gene overexpressing plants and wild-type plants after 14 days of low nitrogen stress were measured.

[0027] A: Comparison of relative chlorophyll content between wild-type and OsLNT-overexpressing plants;

[0028] B: Comparison of relative nitrate nitrogen content in leaves of wild-type and OsLNT-overexpressing plants;

[0029] C: Comparison of relative nitrate nitrogen content in roots between wild-type and OsLNT-overexpressing plants;

[0030] D: Comparison of relative nitrate reductase activity in leaves of wild-type and OsLNT-overexpressing plants;

[0031] E: Comparison of relative nitrate reductase activity in roots between wild-type and OsLNT-overexpressing plants;

[0032] F: Comparison of relative nitrite reductase (NiR) activities in leaves of wild-type and OsLNT-overexpressing plants;

[0033] G: Comparison of relative nitrite reductase activity in roots between wild-type and OsLNT-overexpressing plants;

[0034] In the figure, * indicates P < 0.05, and ** indicates P < 0.01. Detailed Implementation

[0035] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were all purchased from commercial sources.

[0036] Example 1: Construction and Obtaining OsLNT Overexpressing Plants

[0037] (1) Construction of overexpression vector

[0038] Primers for the overexpression vector were designed based on the CDS sequence of the OsLNT gene (as shown in SEQ ID No. 1):

[0039] OsLNT-OE-F: TTGTGGTGCAGCCCGGGATCCATGGCGGAGATGGTGGCG,

[0040] OsLNT-OE-R:TCCATGGTACCTGCAGGATCCAAGCCACAGTGCACCGGC;

[0041] The OsLNT gene fragment was amplified from Nipponbare rice and ligated with an overexpression vector fragment containing the Ubi promoter to obtain the overexpression vector Ubi-OsLNT. This overexpression vector was then transformed into competent Escherichia coli DH5α. Positive clones identified by colony PCR were sequenced to obtain the correct overexpression plasmid.

[0042] (2) Obtaining transgenic plants

[0043] The overexpression plasmid from step (1) was transformed into Agrobacterium EHA105, which was then infecting prepared rice callus tissue and co-cultured. After washing, selection culture, differentiation, rooting, and seedling vigorization, T0 generation and progeny transgenic plants were obtained; and quantitative primers for OsLNT were used:

[0044] OsLNT-qPCR-F:CGGGAAGGAGATGGAGAAGG,

[0045] OsLNT-qPCR-R:CTTGAGCAAGGGCACGAG;

[0046] RT-PCR was used to detect its expression level ( Figure 1 ), and selected one independent plant with a high expression level for the experiment.

[0047] Example 2: Resistance of OsLNT-overexpressing plants to low nitrogen stress

[0048] The rice OsLNT overexpression line OsLNT-OE1 obtained in Example 1 and its control wild type were treated under normal nitrogen and low nitrogen conditions.

[0049] (1) Rice seedling stage treatment experiment

[0050] Rice seeds were sown and cultured in a 0.5 mM CaCl2 solution for 5 days. Then, seedlings with uniform growth were transferred to an environment with a nitrogen content of 0.2 mM NO3. - -N (low nitrate nitrogen, LN) and 2 mM NO3 - Rice was cultured in Yoshida medium containing -N (normal nitrate nitrogen, NN), and the medium was changed every 3 days.

[0051] (2) Determination of stem length, root length, root-to-shoot ratio, fresh weight of stem, fresh weight of root, dry weight of stem, dry weight of root and dry matter

[0052] On the 14th day of treatment, four rice seedlings of uniform growth were selected, and the stem length and seed root length were measured using a centimeter ruler to calculate the root-to-shoot ratio. The roots were rinsed clean with deionized water, and the surface moisture was patted dry with paper towels. The fresh weight of the stems and roots was measured using an electronic balance. The seedlings were then placed in an oven at 105 ℃ for 30 min to kill the green, and then dried at 45 ℃ until constant weight. The dry weight of the stems and roots was measured again. Three biological replicates were performed, and the average value was taken. The relative stem length, relative root length, relative root-to-shoot ratio, relative stem fresh weight, relative root fresh weight, relative stem dry weight, relative root dry weight, and relative dry matter were then calculated.

[0053] The relative value is calculated as (value measured under low nitrogen / value measured under normal nitrogen) × 100%.

[0054] The results showed that higher relative stem length, relative root length, relative root-to-shoot ratio, relative stem fresh weight, relative root fresh weight, relative stem dry weight, relative root dry weight, and relative dry matter content correlated with better low nitrogen tolerance in rice. Overall, the overexpression line OsLNT-OE1 exhibited higher values ​​for all of these parameters than the wild-type Nipponbare rice, indicating that the overexpression line OsLNT-OE1 demonstrated superior low nitrogen tolerance compared to wild-type Nipponbare rice. Figure 3 ).

[0055] (3) Determination of chlorophyll content, nitrate nitrogen content, nitrate reductase activity and nitrite reductase activity

[0056] Samples were collected 14 days after treatment for analysis. Chlorophyll content was measured using visible spectrophotometry. Nitrate nitrogen content was measured using a plant nitrate nitrogen (nitrate) content assay kit. Nitrate reductase activity was measured using a nitrate reductase activity assay kit. Nitrite reductase activity was measured using a nitrite reductase assay kit. Relative chlorophyll content, relative nitrate nitrogen content, relative nitrate reductase activity, and relative nitrite reductase activity were then calculated.

[0057] The relative value is calculated as (value measured under low nitrogen / value measured under normal nitrogen) × 100%.

[0058] The results showed that there was almost no difference in chlorophyll content between the overexpressing line OsLNT-OE1 and the wild-type. The relative nitrate nitrogen content in leaves of the overexpressing line OsLNT-OE1 was lower than that of Nipponbare, while the relative nitrate nitrogen content in roots was higher. The relative nitrate reductase activity in both leaves and roots of the overexpressing line OsLNT-OE1 was higher than that of Nipponbare. The relative nitrite reductase activity in leaves of the overexpressing line OsLNT-OE1 was higher than that of Nipponbare, while the relative nitrite reductase activity in roots was lower. In summary, plants overexpressing OsLNT exhibited higher nitrate assimilation efficiency under low nitrogen conditions than the wild-type. Figure 4 ).

Claims

1. Application of OsLNT gene in enhancing low nitrogen tolerance of rice seedling stage, wherein the nucleotide sequence of the OsLNT gene is shown as SEQ ID No. 1 or a degenerate nucleotide sequence encoding the same protein as SEQ ID No.

1.

2. Use according to claim 1, characterized in that, The method for enhancing low nitrogen tolerance of rice seedling stage is overexpressing OsLNT gene in rice, thereby improving low nitrogen tolerance of rice.

3. Use according to claim 1 or 2, characterized in that, The rice is Nipponbare.