Spartina anglica ascorbic acid peroxidase SanAPX11 gene and application thereof
By expressing the ascorbate peroxidase SanAPX11 gene of Spartina alterniflora in plants, the problem of insufficient resistance of plants to drought, salt stress and oxidative stress was solved, and the effects of enhancing plant stress resistance and reducing oxidative damage were achieved.
Patent Information
- Application Number
- CN202511992200.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-26
- Publication Date
- 2026-02-06
AI Technical Summary
Existing technologies are insufficient to effectively enhance plant resistance to abiotic and biotic stresses, especially in the areas of drought, salt stress, and oxidative stress, and the application of ascorbate peroxidase (APX) in plant defense systems is inadequate.
Provide the Spartina alterniflora ascorbate peroxidase SanAPX11 gene and its encoded protein, and express them in plants through recombinant expression vectors (such as pTRV2-SanAPX11 and pRI101-AN-GFP-SanAPX11) to enhance plant stress resistance.
It improved the plant's tolerance to drought, oxidation and salt stress, reduced oxidative damage, and enhanced the plant's stress resistance.
Smart Images

Figure CN121472261A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to an ascorbate peroxidase from Spartina alterniflora. SanAPX11 Genes and their applications. Background Technology
[0002] Spartina alterniflora ( Spartinaanglica *Spartina alterniflora* is a perennial herbaceous plant belonging to the genus *Spartina* of the Poaceae family. It grows in coastal salt marshes and estuaries and is highly susceptible to biotic and abiotic stresses. When under stress, the plant produces large amounts of ROS (including superoxide anions O2). - Hydrogen peroxide (H₂O₂) and hydroxyl radicals (OH⁻) - Ozone (O3) and singlet oxygen 1 Excessive accumulation of reactive oxygen species (ROS) (O2) leads to oxidative stress, which causes oxidative damage to proteins, DNA, and lipids, ultimately affecting cells and causing cellular damage. Plants remove reactive oxygen species using either enzymatic or non-enzymatic scavenging systems to maintain intracellular ROS levels within normal ranges. The main enzymatic scavenging systems include peroxidase (APX), catalase (CAT), and superoxide dismutase (SOD). Among these, APX has the strongest affinity for hydrogen peroxide (H2O2), the most common reactive oxygen molecule in organisms.
[0003] APX plays a crucial role in plants, particularly in responding to abiotic stresses. It protects cells from oxidative damage by scavenging reactive oxygen species (ROS) through its involvement in the ascorbic acid-glutathione cycle. Studies have shown that overexpression of APX in various plant species enhances their tolerance to heavy metals, salinity, high temperatures, waterlogging, drought, and cold stress. Furthermore, APX also plays a role in plant growth and development, such as influencing lateral root formation, nodule development, leaf senescence, and programmed cell death.
[0004] In addition to responses to abiotic stresses, APXs have also demonstrated importance in resisting biotic stresses. For example, overexpression in tobacco... cytAPX Genes can enhance plant resistance to crown gall by precisely controlling the oxidative burst caused by the pathogen to effectively resist it. Similarly, overexpression of this gene in rice... OsAPX8 It also showed stronger resistance to bacterial wilt.
[0005] These studies highlight the central role of APX in plant defense systems, and the improved application of this gene has broad prospects for enhancing plants' ability to resist biotic and abiotic stresses. Summary of the Invention
[0006] To solve the above-mentioned technical problems, the present invention provides a rice grass ascorbate peroxidase. SanAPX11 Genes and their applications.
[0007] This invention is achieved by providing a Spartina alterniflora ascorbate peroxidase. SanAPX11 Genes, the ones mentioned SanAPX11 The nucleotide sequence of the gene is shown in SEQ ID NO.1.
[0008] Provides the aforementioned rice grass ascorbate peroxidase SanAPX11 A gene-encoded protein, the amino acid sequence of which is shown in SEQ ID NO.2.
[0009] Provides a method for cloning the aforementioned Spartina alterniflora ascorbate peroxidase SanAPX11 The primer pair for the gene, wherein the sequence of the primer pair is: F:ATGGCGAAGAACTACCCG R: TTACGCATCACCAAACCC.
[0010] Provides a solution containing the aforementioned Spartina alterniflora ascorbate peroxidase SanAPX11 Recombinant gene expression vectors.
[0011] Specifically, the recombinant expression vector is specifically used to express the... SanAPX11 The silencing plasmid pTRV2- was obtained by inserting the gene between the BamHI and KpnI sites of pTRV2. SanAPX11 and will SanAPX11 The overexpression plasmid pRI101-AN-GFP- was obtained by inserting the gene between the NdeI and KpnI sites of pRI101-AN-GFP. SanAPX11 .
[0012] Provide a method described above SanAPX11 The application of the gene, the protein, or the recombinant expression vector is used to improve plant stress resistance.
[0013] Preferably, the stress resistance is at least one of drought resistance, oxidative stress resistance, and salt stress resistance.
[0014] Compared with the prior art, the advantages of the present invention are as follows: Provides a rice grass ascorbate peroxidase SanAPX11 Genes and their applications SanAPX11 After genes are transferred into cells in the form of plant expression vectors, they are expressed in plant cells, which can increase the plant's resistance to stress, specifically resistance to drought stress, oxidative stress, and salt stress. Attached Figure Description
[0015] Figure 1 Rice grass SanAPX11 Results of gene cloning testing; Figure 2 Map of the overexpression vector pRI101-AN-GFP; Figure 3 The recombinant overexpression plasmid pRI101-AN-GFP- SanAPX11 Atlas; Figure 4 The pTRV2 silencing vector map; Figure 5 For recombinant silencing plasmid pTRV2- SanAPX11 Atlas; Figure 6 Physiological and biochemical indicators of tobacco leaves from wild-type, transiently silenced, and transiently overexpressed groups. Detailed Implementation
[0016] The present invention will be further illustrated below by describing the embodiments in detail, but this is not intended to limit the invention and is only for illustrative purposes.
[0017] Example 1: Spartina alterniflora ascorbate peroxidase SanAPX11 Cloning of genes (1) Total RNA extraction and RNA quality detection from Spartina alterniflora Total RNA was extracted from Spartina alterniflora using a plant RNA extraction kit, specifically including the following steps: 1. Take 50-100mg of fresh Spartina alterniflora leaves and put them into a 1.5mL centrifuge tube. Add steel balls to the tube and grind it at 12000rpm and -20℃ for 1min in a cryogenic high-throughput tissue homogenizer. Melt the RNase-free water in a 75℃ water bath beforehand. 2. Add 1000 mL of lysis buffer to the sample, centrifuge at 4°C and 12000 rpm for 10 min; after centrifugation, transfer 500 μL of supernatant to a new centrifuge tube, add 250 μL of anhydrous ethanol, and mix well by pipetting. 3. Transfer the above mixture and precipitate to a plant RNA adsorption column and centrifuge at 12,000 rpm for 2 minutes. Repeat the above steps once after centrifugation. 4. Add 350 μL of protein removal solution RW1 to the plant RNA adsorption column, incubate at room temperature for 1 min, then centrifuge at 12000 rpm for 1 min and discard the waste liquid. 5. Pipette 45 μL of a mixture of DNase buffer and 5 μL of RNase-free DNase I into the center of the plant RNA adsorption column membrane and let it stand for 15 min. 6. Add 350 μL of protein removal solution RW1 to the plant RNA adsorption column, centrifuge at 12000 rpm for 1 min, and discard the waste liquid. 7. Add 500 μL of wash buffer RW, centrifuge at 12000 rpm for 1 min, discard the waste liquid, repeat the above steps once, then remove the plant RNA adsorption column and centrifuge at 12000 rpm for 1 min. 8. Take out the plant RNA adsorption column and put it into a 1.5 mL centrifuge tube. Take out the RNase-free water that has been placed in a 75℃ water bath in advance, add 31 μL to the plant RNA adsorption column, let it stand at room temperature for 1 min, then centrifuge at 12000 rpm for 1 min, and repeat once more. 9. Take 0.5 μL of total RNA from rice grass and test its concentration using an ultra-micro nucleic acid and protein analyzer, then store it in a -80℃ refrigerator.
[0018] (2) cDNA synthesis Reverse transcription is performed using a reverse transcription kit, and the specific steps include the following: 1. Add the following components to the ice: 2. Immediately after mixing, invert the tube and place it in the PCR instrument. Set the PCR instrument program as follows: 37℃, 2 min; 55℃, 15min; 85℃, 5 min; 4℃, ∞; then store in a -20℃ refrigerator.
[0019] (3) Spartina alterniflora SanAPX11 Cloning of genes PCR using Taq enzyme specifically includes the following steps: 1. Cloning using designed specific primers 2. Place it in the PCR instrument, and set the PCR instrument program as follows: 95℃, 3 min; 95℃, 30s; 62℃, 30s; 72℃, 40s, 34 cycles; At 4℃, infinity; agarose gel electrophoresis was performed for detection (results are as follows). Figure 1 (As shown), then store in a -20℃ refrigerator.
[0020] (4) Ligation of the target gene and the vector use pEASY ® Connecting the T&B Zero Cloning Kit involves the following steps: Connection system (5μL): 3μL PCR Product 1μL Cloning Vector 1μL ddH2O The mixed system was incubated in a 37°C water bath for 15 minutes to obtain the desired result. pEASY ®-T&B Zero- SanAPX11 Recombinant plasmid.
[0021] (5) Transformation of recombinant plasmids Add the recombinant plasmid to 50 μL Trans In l-T1 competent cells, incubate on ice for 25 min. After the ice bath, remove the cells and heat-shock them at 42°C for 30 s, then immediately place them on ice. Add 200 μL of LB liquid medium on ice and incubate at 37°C for 1 h at 200 rpm. Spread 200 μL of the bacterial culture onto LB solid medium containing 50 μg / μL kanamycin and incubate overnight at 37°C.
[0022] (6) Sequencing Successfully cultured single clones were selected and placed in 3 mL of LB liquid medium (containing 50 μg / μL kanamycin), and cultured overnight at 37°C at 200 rpm. 300 μL of the cultured medium was then sequenced. The nucleotide sequence of the sequencing results is shown in SEQ ID NO.1.
[0023] Example 2: Spartina alterniflora SanAPX11 Construction of plant gene expression vectors (1) Construction and validation of overexpression vectors 1. Based on the overexpression vector pRI101-AN-GFP ( Figure 2 The upstream primer pRI101-AN-GFP-SanAPX11-F (CATATGGCGAAGAACTACCCGT) and the downstream primer pRI101-AN-GFP-SanAPX11-R (GGTACCTTACGCATCACCAAACCCCA) containing homologous sequences of the pRI101-AN-GFP vector were designed at the NdeI and KpnI restriction sites, respectively, to create a recombinant plasmid. pEASY ®-T&B Zero- SanAPX11 Using a template, amplify vectors containing homologous sequences of the pRI101-AN-GFP vector at both ends. SanAPX11 Target segment.
[0024] 2. The overexpression vector pRI101-AN-GFP was digested with NdeI and Kpn, and the recombinant overexpression vector pRI101-AN-GFP was constructed using the Visclone Universal OneStep Cloning Kit. SanAPX11 The recombinant plasmid was transformed into E. coli using the heat shock method. Trans l-T1 competent cells were plated on LB agar plates containing 50 μg / μL kanamycin and incubated overnight at 37°C. Positive clones were sequenced. Sequencing results were compared using Snapgene software. Cells with correct sequencing results were preserved and cultured to extract plasmids (recombinant plasmid map shown in...). Figure 3 ).
[0025] (2) Construction and verification of silencing carriers The operation method is the same as above, the silencing vector is pTRV2, pTRV2- SanAPX11 The restriction enzyme sites are BamHI and KpnI, and the upstream and downstream primers are (F: GGATCCGAACCCGGCGGAGCTGG; R: GGTACCCCAGAGAGGGCAACAATGT) (see the silencing vector map). Figure 4 The recombinant plasmid map can be found in [link to map]. Figure 5 ).
[0026] Example 3: Transient expression experiment and analysis in tobacco (1) SanAPX11 Instantaneous expression of tobacco Transformation of correctly sequenced overexpression and silencing plasmids into GV1301 Agrobacterium competent cells was performed using a freeze-thaw method. The specific procedures were as follows: ① Remove Agrobacterium competent cells from a -80℃ freezer and thaw them on ice until they reached an ice-water mixture; ② Add 1 μg of the recombinant plasmid to the competent cells according to the desired concentration, then incubate on ice for 5 min, freeze in liquid nitrogen for 5 min, incubate in a water bath at 37℃ for 5 min, and finally incubate on ice for 5 min; ③ Add 800 μL of antibiotic-free LB to the competent cells and incubate at 200 rpm in a shaker at 28℃ for 2-3 h; ④ Subsequently, remove the competent cells from the shaker and centrifuge at 5000 rpm at room temperature for 1 min. In a clean bench, aspirate excess supernatant, retain 200-300 μL to resuspend the bacterial cells, and evenly spread the bacterial solution on LB solid medium containing 50 μg / μL kanamycin and rifampin. After the bacterial solution is dried, seal the culture dish and incubate upside down in a 28℃ incubator for 2-3 days. After single colonies grow, add 1 mL of antibiotic-free LB liquid medium, 1 μL of kanamycin, and 1 μL of rifampin to a 2 mL centrifuge tube. Pick a round and plump single colony and transfer it to the centrifuge tube. Incubate at 28℃ and 200 rpm for 12-16 h. Perform bacterial PCR on the turbid bacterial solution. Select primers that connect homologous arms. After the bands are correct, preserve the bacteria.
[0027] Take the stored TRV2- from the refrigerator. SanAPX11 Agrobacterium and pRI101-AN-GFP- SanAPX11To activate the culture, add 5 mL of LB liquid medium, 5 μL of kanamycin, 5 μL of rifampin, and 100 μL of bacterial suspension to a 10 mL centrifuge tube, and incubate at 28°C and 200 rpm for 12-16 hours. Once the bacterial suspension becomes turbid, transfer 500 μL of the suspension to a sterile Erlenmeyer flask. Add 50 mL of LB liquid medium, 50 μL of kanamycin, and 50 μL of rifampin to the Erlenmeyer flask, and incubate at 28°C and 200 rpm for 12-16 hours until OD (dose dispersibility) is reached. 600 It ranges from 0.8 to 1.0.
[0028] Add 10 mL of distilled water to a beaker, then dissolve 2.333 g of MES in the beaker. The concentration of the mother solution is now 1 mol / L. Pipette 1.5 mL of this solution into a 250 mL blue-capped bottle. In another beaker, add 2.033 g of MgCl2 and dilute to 10 mL with distilled water. The concentration is now 1 mol / L. Pipette 1.5 mL of this solution into the same 250 mL blue-capped bottle. Dilute to 150 mL with distilled water. The concentration of the working solution is now 10 mmol / L.
[0029] In a clean bench, pour the turbid bacterial culture into sterile centrifuge tubes and centrifuge at 5000 rpm for 10 min at room temperature to collect the bacterial cells. Resuspend the bacterial cells in the prepared resuspension solution and measure the OD. 600 Gradually add resuspension solution until the OD value is reached. 600 The value was 0.8. Add 200 μmol / L of acetylsuccinone (stock solution concentration was 50 mmol / L) to the prepared bacterial culture, and let the infection solution stand at room temperature in the dark for 2-3 hours.
[0030] The infection solution, which had been left to stand in the dark for 3 hours, was removed and placed in a clean bench. The TRV1 and TRV2 recombinant vector infection solutions were mixed at a 1:1 ratio. Using a syringe, the TRV1 and TRV2 recombinant vector infection solutions, along with the pRI101-AN-GFP infection solution, were injected into the underside of tobacco leaves through a puncture. The leaves were protected from light for 12 hours after injection before normal culture. Two days after infection, tobacco plants with uniform growth were subjected to salt stress treatment. Every other day, 100 mL of 300 mmol / L NaCl solution was injected into the flowerpots, ensuring the solution did not directly contact the tobacco. The control treatment involved watering the plants with 100 mL of water every other day. Samples were taken after 7 days.
[0031] (2) Determination of physiological and biochemical indicators of salt stress resistance After 7 days of treatment, tobacco samples were taken for the determination of proline, soluble sugar, MDA, and soluble protein content. The determination methods were based on the second edition of "Experimental Guide to Plant Physiology" (China Agricultural University Press, edited by Fan Jinjuan and Ruan Yanye). The test results are as follows Figure 6As shown, under normal growth conditions, the MDA and proline content in the leaves of the transiently silenced group were significantly higher than those of the wild type, while the wild type was significantly higher than that of the transiently overexpressed group. Soluble sugar content under normal conditions was significantly higher in the transiently silenced group than in the other two groups, while there was no significant difference between the wild type and the transiently overexpressed group.
[0032] Under salt stress, the MDA, proline, and soluble sugar contents of all three treatments showed a significant trend of transient silencing > wild type > transient overexpression group. Furthermore, regardless of normal growth or salt stress conditions, the soluble protein content was significantly higher in the transient overexpression group than in the wild type, and significantly higher in the wild type than in the transient silencing group.
[0033] The results show that APX Genes play an important regulatory role in tobacco's response to salt stress. Transient silencing. APX This leads to a significant increase in the content of MDA, proline, and soluble sugars in plants, indicating a reduction in... APX Activity exacerbates oxidative damage and enhances stress signals. And... APX Transient overexpression of these markers significantly reduced the three stress-related indicators mentioned above, indicating that... APX Enhancement can effectively reduce oxidative stress and maintain protein homeostasis.
[0034] The fact that soluble proteins did not exhibit the characteristics of the other three indicators mentioned above may be due to the transient overexpression injection. APX On the one hand, this increases the content of soluble protein, and on the other hand, it reduces oxidative stress, resulting in less protein oxidative damage. The wild type itself... APX It can play a certain role in reducing oxidative stress, while the transient silencing group suffered the most severe oxidative damage and the most protein damage. Therefore, the transient overexpression group was significantly higher than the wild type, and the wild type was significantly higher than the transient silencing group.
[0035] In summary, APX The expression level of [a specific substance] directly affects the antioxidant capacity and stress tolerance of tobacco, mainly manifested as silencing. APX It will enhance membrane lipid peroxidation and osmotic regulation responses, and overexpression APX This can reduce salt stress damage and improve plant resistance.
Claims
1. Spartina alterniflora ascorbate peroxidase SanAPX11 Genes, characterized by, The SanAPX11 The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
2. The Spartina alterniflora ascorbate peroxidase according to claim 1 SanAPX11 Gene-encoded proteins are characterized by, The amino acid sequence of the protein is shown in SEQ ID NO.
2.
3. For cloning the Spartina alterniflora ascorbate peroxidase of claim 1 SanAPX11 A primer pair for a gene, characterized in that, The sequences of the primer pair are as follows: F:ATGGCGAAGAACTACCCG R: TTACGCATCACCAAACCC.
4. Contains the ascorbate peroxidase from Spartina alterniflora as described in claim 1. SanAPX11 Recombinant gene expression vectors.
5. The recombinant expression vector according to claim 4, characterized in that, Specifically, the aforementioned SanAPX11 The silencing plasmid pTRV2- was obtained by inserting the gene between the BamHI and KpnI sites of pTRV2. SanAPX11 and will SanAPX11 The overexpression plasmid pRI101-AN-GFP- was obtained by inserting the gene between the NdeI and KpnI sites of pRI101-AN-GFP. SanAPX11 .
6. The method according to claim 1 SanAPX11 The application of the gene or the protein of claim 2 or the recombinant expression vector of claim 4, characterized in that, Used to improve plant stress resistance.
7. The application according to claim 6, characterized in that, The stress resistance is at least one of drought stress, oxidative stress, and salt stress.