Application of rice phosphorus transporter gene and encoding protein thereof in improving nutrient utilization efficiency and rice quality
By editing the rice phosphorus transporter gene OsPHT1;1, the problem of excessive protein and phytic acid content in rice was solved, improving nutrient utilization efficiency and eating quality, and achieving efficient rice breeding improvement.
Patent Information
- Application Number
- CN202511457018.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-13
- Publication Date
- 2026-02-06
AI Technical Summary
Existing technologies are insufficient to effectively improve the nutrient utilization efficiency, taste quality, and nutritional quality of rice. In particular, excessively high protein content affects the taste, and high phytic acid content affects the absorption of nutrients.
By using gene editing technology to mutate or inhibit the expression of the rice phosphorus transporter gene OsPHT1;1, the nitrogen and phosphorus content in rice grains can be reduced, as well as the protein and phytic acid content, thereby improving nutrient utilization efficiency and eating quality.
It significantly reduces the content of total protein, glutenin, prolysin, globulin and albumin in rice grains, increases gel consistency, reduces phytic acid content, and improves eating quality and nutritional quality, without affecting seed setting rate and yield.
Smart Images

Figure CN121472291A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology and relates to the genetic engineering application of the rice phosphorus transporter gene OsPHT1;1 and its encoded protein. Background Technology
[0002] Rice, along with wheat and corn, is one of the world's three major food crops. The quality of rice directly affects its economic benefits and, consequently, its acreage. Evaluation indicators for rice grain quality mainly include milling quality, appearance quality, cooking quality, eating quality, nutritional quality, and hygiene quality (Wang et al., 2003; He et al., 2009). As a vital staple food for humans, eating quality and nutritional quality are crucial factors determining the value of rice. Nitrogen fertilizer application significantly affects the eating quality of rice. With increasing nitrogen application, the protein content in rice grains rises significantly, while the eating quality decreases significantly, whereas the amylose content remains largely unchanged (Huang et al., 2020). This indicates that protein, besides amylose, is another important factor affecting the eating quality of rice. Excessive protein content directly or indirectly affects starch gelatinization, while insufficient protein content affects appearance and nutritional quality. Therefore, high-quality rice typically has a protein content below 7%. On the other hand, as the most abundant storage protein, an increase in gluten content can exacerbate the metabolic burden on patients with kidney disease. Therefore, developing low-gluten rice varieties has become an important direction for addressing the nutritional needs of special populations and improving the overall health of the population.
[0003] In addition, phosphorus is also a significant factor affecting the nutritional quality of rice grains. This is because phosphorus mainly exists in the form of phytic acid in the grains, which readily binds with important trace metals such as iron and zinc, thus affecting the absorption of these essential trace elements by humans (Wang Hui et al., 2009). Therefore, in addition to cultivating iron- and zinc-rich varieties, reducing the phytic acid content in the grains is also an important way to improve the absorption of trace elements by the human body. Summary of the Invention
[0004] The purpose of this invention is to provide the application of the rice phosphorus transporter gene OsPHT1;1 and its encoded protein in improving the nutrient utilization efficiency, eating quality and nutritional quality of rice.
[0005] Another object of the present invention is to provide nucleic acids, vectors, and cells encoding the protein.
[0006] Another object of the present invention is to provide a method for obtaining new rice germplasm with high nutrient efficiency, high rice eating quality and nutritional quality.
[0007] The objective of this invention is achieved through the following technical solution:
[0008] Applications of the rice phosphorus transporter gene OsPHT1;1 and its encoded product in improving plant nutrient utilization efficiency, palatability, and nutritional quality. The gene sequence is shown in SEQ ID No. 1.
[0009] As a preferred embodiment of the present invention, the plant is a monocotyledonous plant, preferably any one of rice, wheat, and corn, with rice being particularly preferred.
[0010] As a preferred embodiment of the present invention, mutation or inhibition of the expression of the rice phosphorus transporter gene OsPHT1;1 improves the nutrient utilization efficiency, eating quality, and nutritional quality of rice. The improvement in nutrient utilization efficiency preferably improves the utilization efficiency of nitrogen and phosphorus. The improvement in eating quality preferably reduces the total protein content, gluten content, prolysin content, globulin content, albumin content, and reduction value of rice grains, increases gel consistency, and thus enhances the eating quality of rice. The improvement in nutritional quality preferably reduces the phytic acid content in rice grains, thereby improving the nutritional quality of rice.
[0011] Gene editing vector for rice phosphorus transporter gene OsPHT1;1.
[0012] As a preferred embodiment of the present invention, the gene editing vector contains the double-stranded annealed products obtained by annealing SEQ ID No. 8 and SEQ ID No. 9.
[0013] Applications of recombinant cells containing the aforementioned gene-editing vector in improving plant nutrient utilization efficiency, palatability, and nutritional quality.
[0014] As a preferred embodiment of the present invention, the plant is a monocotyledonous plant, preferably any one of rice, wheat, and corn, with rice being particularly preferred.
[0015] A method for improving nutrient utilization efficiency, eating quality, reducing gluten / prolyl / globulin / albumin content, and reducing phytic acid in rice includes, but is not limited to, mutating or inhibiting the expression of OsPHT1;1 in rice to improve nutrient utilization efficiency, eating quality, reduce gluten / prolyl / globulin / albumin content, and reduce phytic acid; or introducing the ospht1;1 mutant gene into other rice varieties through any one or more operations such as hybridization, backcrossing, or asexual reproduction of ospht1;1 mutant rice plants.
[0016] As a preferred embodiment of the present invention, the method for mutating or inhibiting the expression of rice OsPHT1;1 is selected from gene editing, RNAi, and virus-induced gene silencing.
[0017] As a further preferred embodiment of the present invention, the method for mutating or inhibiting the expression of rice OsPHT1;1 is to introduce the gene editing vector into wild-type rice to obtain a rice mutant with the gene mutation.
[0018] The beneficial effects of this invention are:
[0019] 1. This invention uses specific quantitative primers to study the expression of OsPHT1;1 during the flowering period and found that the gene is almost constitutively expressed, and its expression level is the highest among PHT1 members in roots.
[0020] 2. This invention constructs a transgenic material with the promoter of the OsPHT1;1 gene fused with the GUS reporter gene. GUS staining revealed that OsPHT1;1 is strongly expressed in various regions.
[0021] 3. The mutation OsPHT1;1 significantly reduced the nitrogen and phosphorus content in rice straw and grains, thereby improving the nutrient utilization efficiency of rice.
[0022] 4. The mutation OsPHT1;1 significantly reduced the total protein content, gluten content, prolysin content, globulin content, albumin content, and reduction value of rice grains, while increasing gel consistency, thereby improving the eating quality of rice.
[0023] 5. The mutant OsPHT1;1 significantly reduces the phytic acid content in the grains, which has the potential to improve the effectiveness of micronutrient absorption in the human body, thereby improving the nutritional quality of rice.
[0024] 6. The mutation OsPHT1;1 does not affect rice seed setting rate, thousand-grain weight, or yield per plant. Attached Figure Description
[0025] Figure 1 Analysis of OsPHT1;1 expression patterns. A, OsPHT1;1 expression abundance in different parts of rice during flowering; B, OsPHT1;1 expression abundance in roots during flowering.
[0026] Figure 2 OsPHT1;1 tissue localization analysis. GUS staining of different tissues in ProOsPHT1;1:GUS transgenic plants. A, lateral root region; B, root tip; C, basal node; D, transverse section of Figure A; E, transverse section of Figure B; F, enlarged view of Figure C (red box); G, leaf; H, leaf sheath; I, node I; J, transverse section of Figure G; K, transverse section of Figure H; L, enlarged view of Figure I (red box).
[0027] Figure 3 Molecular identification of ospht1;1 mutant plants.
[0028] Figure 4 The ospht1;1 mutant exhibits high nutrient use efficiency. Nitrogen (A) and phosphorus (C) concentrations in wild-type and mutant cereals and forages at maturity. Physiological use efficiency of nitrogen (B) and phosphorus (D) in wild-type and mutants. Nutrient physiological use efficiency = yield / nutrient concentration.
[0029] Figure 5 The ospht1;1 mutant affects the protein content of rice grains. A, Total protein concentration in wild-type and mutant grains; B, Concentration of four storage proteins in wild-type and mutant grains; C, SDS-PAGE identification of rice storage proteins: pGT is a glutenin precursor, αGT is the acidic subunit of glutenin, βGT is the basic subunit of glutenin, αGlb is a globulin, and Pro is a prolysin.
[0030] Figure 6 Eating quality-related traits in rice from the ospht1;1 mutant. Grain gel consistency (A) and reduction value (B) of wild-type and mutant grains.
[0031] Figure 7 The ospht1;1 mutant affects the phytic acid content in rice grains. Phytic acid content (A) and seed morphology (B) in wild-type and mutant seeds.
[0032] Figure 8 Agronomic parameters of the ospht1;1 mutant at full maturity. Statistical data on wild-type and mutant phenotypes, plant height, tiller number, seed setting rate, thousand-grain weight, and yield per plant. Phenotypic diagrams of wild-type and ospht1;1 mutant (A), plant height (B), tiller number (C), grains per ear (D), thousand-grain weight (E), and yield per plant (F). Detailed Implementation
[0033] Example 1: Study on the expression pattern of OsPHT1;1
[0034] 1) Extraction of total RNA and synthesis of cDNA
[0035] The selected rice variety was Nipponbare (japonica rice). Wild-type Nipponbare rice plants with seven leaves and one bud were planted in fields receiving normal phosphorus supply. Approximately 55 days later, the rice panicles fully emerged from the leaf sheaths and were in full flowering stage. Samples were collected from 16 parts of the plant: glumes, anthers, pistils, unflowered spikelets, pedicels, internode I, flag leaf blade, flag leaf neck, flag leaf sheath, node I, internode II, second-to-last leaf blade, second-to-last leaf neck, second-to-last leaf sheath, node II, and roots. These samples were then flash-frozen in liquid nitrogen. After grinding the samples in liquid nitrogen, total RNA was extracted from the rice using the TRIzol method. RNA concentration was measured using a NanoDrop instrument, and cDNA was synthesized using the ReverTra Ace kit.
[0036] 2) RT-qPCR analysis
[0037] Quantitative analysis was performed using specific primers designed for the 3'-UTR of OsPHT1;1. The primers were PT1-qRT-F:CGCTTCCGTACGAGTGGTAGT (SEQ ID No. 2) and PT1-qRT-R: GGTTCTTTCAAATCCAGGGAAA (SEQ ID No. 3). The internal reference gene used was rice OsActin1, and its quantitative primers were Actin1-qRT-F:GTGGATTGCCAAGGCTGAGT (SEQ ID No. 4) and Actin1-qRT-R: GCATTTCCTGTGCACAATGG (SEQ ID No. 5). Quantitative analysis of OsPHT1;1 was performed using the template from Example 1.
[0038] The results showed that OsPHT1;1 was strongly expressed in all tissues except the anthers, but its expression was strongest in the pedicel, leaves, leaf sheaths, and roots. Furthermore, the expression of PHT1 family genes in roots was detected, and the results showed that the expression of OsPHT1;1 was significantly higher than that of other PHT1 family genes. Figure 1 ).
[0039] Example 2 OsPHT1;1 Tissue Localization Analysis
[0040] 1) Extraction of rice genomic DNA
[0041] A suitable amount (~0.1 g) of leaves from wild-type Nipponbare plants was ground into powder in liquid nitrogen. Then, 500 μl of extraction buffer (0.1 M Tris-HCl, 0.01 M EDTA, 1 M KCl, pH=8.0) was added, and the mixture was heated in a 65 ℃ metal bath for 30 min, inverting and mixing every 10 min. The mixture was then centrifuged at 8000 rpm for 5 min, and the supernatant was transferred to a 1.5 ml centrifuge tube. An equal volume of isopropanol was added, and the mixture was mixed and incubated at -20 ℃ for 30 min. The mixture was centrifuged again at 8000 rpm for 5 min, and the supernatant was discarded. 1 ml of 75% ethanol was added, and the DNA was washed by centrifugation at 8000 rpm for 5 min, and the supernatant was discarded. The DNA precipitate was air-dried, and an appropriate amount of ddH2O was added to dissolve the precipitate.
[0042] 2) Creation of ProPHT1;1:GUS transgenic plants
[0043] The first 2768 bp of the start codon ATG of OsPHT1;1 was selected as the promoter sequence. Xba I and Kpn I were added as restriction enzyme sites to design primers, which were then sent to the company for synthesis. The primer sequences are PT1pro-F:TTTCTAGAGAAAATAGCAGCGAATTTGTT (SEQ ID No. 6) and PT1pro-R:TTGGTACCGGCTTCCCAACTCTTTGAGCT (SEQ ID No. 7). Using Nipponbare wild-type DNA as a template, Phanta... ® Amplification was performed using Max Super-Fidelity DNA Polymerase. Nucleic acid electrophoresis was performed on a 1% agarose gel, and the target band was excised and analyzed using EZNA. ® The amplified promoter fragment and pCAMBIA1300-GN vector were recovered using a gel extraction kit. The amplified promoter fragment and pCAMBIA1300-GN vector were double-digested with Xba I and Kpn I, and then digested with EZNA. ® The fragment was recovered using a Cycle Pure Kit. The fragment was cloned into a linearized vector using T4 ligase (NEB), transformed into *E. coli* DH5α competent cells, and sent to the company for sequencing. The sequenced plasmid was transformed into *Agrobacterium tumefaciens*, and the *Agrobacterium* plasmid was extracted and re-sequencing the transformed *E. coli* DH5α competent cells for verification. *Agrobacterium*-mediated rice transgenic methods were used to transgenerate mature embryos of the *Nipponbare* rice variety. Molecular identification was performed on the obtained transgenic plants; positive plants were identified as transgenic plants with the OsPHT1;1 promoter fused to the GUS reporter gene.
[0044] 3) GUS staining analysis
[0045] Select plump rice seeds and disinfect them with 30% NaClO for 30-45 min. Then, thoroughly wash away any residual NaClO with deionized water and immerse them in deionized water at 28 ℃ in the dark for 1-2 days until they show signs of sprouting. Arrange the sprouted seeds regularly in a nylon net floating in half Kimura nutrient solution. Transplant the seedlings when they reach the three-leaf stage and continue culturing in half Kimura nutrient solution until they reach the six-leaf stage. Collect samples from the roots, basal nodes, leaves, and leaf sheaths, and immerse them in GUS staining solution at 37 ℃ for staining. When the seedlings reach the seven-leaf stage, plant them in a field with normal phosphorus supply. At the flowering stage, collect samples from node I and perform vibratory sectioning. Immerse the tissue samples in GUS staining solution at 37 ℃ for staining. Decolorize the GUS-treated samples with ethanol using a gradient process, and observe the GUS staining under a stereomicroscope and optical microscope.
[0046] The results showed that OsPHT1;1 was strongly expressed in leaves, leaf sheaths, basal nodes, and roots, with its expression mainly occurring in the vascular bundles in leaves and leaf sheaths; in basal nodes / node I, OsPHT1;1 was strongly expressed in the phloem and xylem of both enlarged and conventional vascular bundles. Figure 2 ).
[0047] Example 3: Obtaining the ospht1;1 mutant material
[0048] Suitable sgRNA targets were selected from the exons of the OsPHT1;1 gene. Highly specific sequences were selected by alignment with the rice genome database, and primers were designed as PT1-sp-F: GGCAGTGACGGCGGCCGACACGTT (SEQ ID No. 8) and PT1-sp-R: AAACAACGTGTCGGCCGCCGTCAC (SEQ ID No. 9). 5 μl of each primer was mixed and used for double-stranded PCR synthesis. The PCR program was as follows: 95 ℃, 30 s; 72 ℃, 2 min; 65 ℃, 2 min; 55 ℃, 2 min; 45 ℃, 2 min; 37 ℃, 2 min; 25 ℃, 2 min; 15 ℃, hold. The pOs-sgRNA vector was digested with BsaI and then recovered. The obtained PCR annealing product was diluted 10-fold, and 1 μl of the diluted product was mixed with 50 ng of linearized pOs-sgRNA vector. An equal volume of T4 ligation was added, and the mixture was incubated at 16 °C for half an hour before transformation into competent E. coli cells. Single clones were selected for sequencing. The sequenced plasmid was subjected to a Gateway LR reaction with the expression vector pH-Ubi-Cas9-7, followed by transformation into competent E. coli cells and single clone sequencing. The sequenced plasmid was transformed into Agrobacterium tumefaciens, and after successful back-sequencing, rice transgenic materials were introduced. Specific primers were designed near the target site for sequencing of the obtained transgenic materials. The mutant identification primers were PT1-CR-F: CTGTGCCCCTGCTCTGCTTT (SEQ ID No. 10) and PT1-CR-R: GTTGTCGGAGTAGGACGGCG (SEQ ID No. 11). Finally, two independent mutant lines were selected for physiological experiments. Figure 3 ).
[0049] Example 4: Effect of the ospht1;1 mutant on nutrient use efficiency in rice.
[0050] Wild-type Nipponbare rice and its mutants were planted in normal phosphorus-supplied fields. The plot size was 1.2 m × 0.8 m, with a plant spacing of 20 cm and a row spacing of 20 cm. One plant was planted per hole, and four plots were planted for each strain. When the rice reached maturity, the rice and grass were sampled separately.
[0051] The samples were blanched and dried to constant weight, ground into powder, and thoroughly mixed. An appropriate amount of sample was weighed and digested using the H2SO4-H2O2 method. The nitrogen and phosphorus concentrations of the digested samples were determined using a flow analyzer. The results showed that the nitrogen and phosphorus concentrations of the ospht1;1 mutant were significantly lower in both cereals and forages than in the wild type. Figure 4 A, C). Meanwhile, based on the formula nutrient physiological utilization efficiency = yield / nutrient concentration, we calculated that the nitrogen and phosphorus physiological utilization efficiencies of the mutant were significantly higher than those of the wild type. Figure 4 (B, D). This indicates that modifying OsPHT1;1 has the potential to improve the physiological utilization efficiency of nutrients.
[0052] Example 5: Effects of the ospht1;1 mutant on rice quality
[0053] Wild-type Nipponbare rice and its mutants were planted in normal phosphorus-supplied fields. The plot size was 1.2 m × 0.8 m, with a plant spacing of 20 cm and a row spacing of 20 cm. One plant was planted per hole, and four plots were planted for each strain. Sampling was carried out when the rice reached maturity.
[0054] 1) Effect of OsPHT1;1 on protein content in rice grains
[0055] The total nitrogen concentration of mature rice seeds was determined by the Kjeldahl method, and then the total protein concentration of the seeds was calculated using a coefficient of 5.95.
[0056] For gel electrophoresis, total seed protein was extracted from 50 mg rice flour by adding 1 mL of total protein extraction buffer (125 mM Tris-HCl, pH=6.8, 4 M urea, 4% SDS and 5% β-mercaptoethanol) and incubated overnight at 25°C with shaking. The supernatant after centrifugation at 12000 rpm for 5 minutes was the total protein extract. 5 μL of the supernatant was used to separate the total seed protein on a 15% PAGE gel and visualized by staining with Coomassie blue rapid staining solution.
[0057] For the determination of storage proteins, four protein components (albumin, globulin, prolysin, and glutenin) were extracted sequentially from 100 mg of rice flour using 1 mL ddH2O, 1 mL 0.5 M NaCl, 1 mL 75% ethanol, and 1 mL 0.1 M NaOH. Each extraction was performed with shaking for 2 h, followed by centrifugation at 10,000 rpm for 20 min, and the supernatant was collected. This process was repeated three times, and the supernatants were combined.
[0058] The results showed that the protein content of the pht1;1 mutant was significantly lower than that of the wild type, both in terms of total protein and the four storage proteins (albumin, globulin, prolysin, and glutenin). Figure 5 ).
[0059] 2) Effects of OsPHT1;1 on the eating quality of rice
[0060] Harvest mature grains, dry them at 37℃, and then use a small rice milling machine to obtain polished rice according to the instructions. Grind the rice into powder using a pulverizer and pass it through a 100-mesh sieve. Then place it in an oven to dry at 37℃ for 2 days.
[0061] Weigh 100 mg of rice powder into a glass test tube, add 200 μl of ethanol containing 0.025% bromothymol blue, gently shake to disperse the powder, then add 2 mL of 0.2 M KOH solution and shake well. Next, cover the test tube with a glass bead and heat in boiling water for 8 minutes, ensuring the rice glue height is maintained at 1 / 3-1 / 2. After removing the test tube, cool for 5 minutes, then continue cooling in an ice-water bath for 20 minutes. Finally, place the test tube on a horizontal work surface and let it stand at room temperature for 1 hour before measuring the length of the rice glue.
[0062] 3 g of sieved rice flour was weighed and its RVA characteristic spectrum of rice was determined using a rapid viscosity analyzer.
[0063] The results showed that the gel consistency of the mutant rice was significantly increased and the reduction value was significantly decreased, indicating that the mutant rice had better palatability. Figure 6 ).
[0064] 3) Effects of OsPHT1;1 on the nutritional quality of rice
[0065] The concentration of phytic acid in mature rice grains was determined using a kit. The results showed that the phytic acid concentration in the grains of the pht1;1 mutant was significantly lower than that of the wild type, indicating that this mutant has significant application potential in reducing food phosphorus waste and improving the availability of trace elements. Figure 7 ).
[0066] Example 6: Effects of OsPHT1;1 on major agronomic traits of rice
[0067] The main agronomic traits of wild-type rice and ospht1;1 mutant plants at full maturity were evaluated. Plant height, number of tillers, number of grains per panicle, thousand-grain weight, and yield per plant were selected as evaluation indicators, among which the number of tillers, number of grains per panicle, and thousand-grain weight are the three components of yield.
[0068] The results showed that the ospht1;1 mutant had a significantly increased number of tillers, while plant height, grains per spike, thousand-grain weight, and yield per plant were not significantly different from the wild type. Figure 8 ).
[0069] The above embodiments demonstrate that gene editing of the phosphorus transporter gene OsPHT1;1 in this invention can improve the eating quality and nutritional quality of rice.
[0070] The inventors screened a phosphorus transporter gene, OsPHT1;1, from the monocotyledonous rice (Oryza sativa). The mutation of OsPHT1;1 has little impact on the main agronomic traits of rice, but it can significantly reduce the accumulation of nitrogen and phosphorus nutrients, protein in the grains, and phytic acid. This invention provides important theoretical support for improving crop nutrient utilization efficiency, grain palatability, and nutritional quality.
Claims
1. Rice phosphorus transporter gene OsPHT1;1 Its application in improving plant nutrient utilization efficiency, palatability, and nutritional quality is characterized by, The CDS sequence of this gene is shown in SEQ ID No.
1.
2. The application according to claim 1, characterized in that, The plant in question is a monocotyledonous plant, preferably any one of rice, wheat, or corn, with rice being particularly preferred.
3. The application according to claim 1 or 2, characterized in that, Mutation or suppression of rice phosphorus transporter genes OsPHT1; 1 The expression improves the nutrient utilization efficiency, eating quality, and nutritional quality of rice; the improvement of nutrient utilization efficiency preferably improves the utilization efficiency of nitrogen and phosphorus; the improvement of eating quality preferably reduces the total protein content, gluten content, prolysin content, globulin content, albumin content, and reduction value of rice grains, and increases gel consistency, thereby improving the eating quality of rice; the improvement of nutritional quality preferably reduces the phytic acid content in rice grains, thereby improving the nutritional quality of rice.
4. Rice phosphorus transporter gene OsPHT1;1 Gene editing vectors.
5. The gene editing vector according to claim 4, characterized in that, The gene editing vector contains double-stranded annealed products obtained by annealing SEQ ID No. 8 and SEQ ID No.
9.
6. The application of recombinant cells containing the gene editing vector of claim 4 or 5 in improving plant nutrient utilization efficiency, palatability, and nutritional quality.
7. The application according to claim 6, characterized in that, The plant in question is a monocotyledonous plant, preferably any one of rice, wheat, or corn, with rice being particularly preferred.
8. A method for improving nutrient utilization efficiency, palatability, and reducing the content of gluten / prolyl / globulin / albumin and phytic acid in rice, characterized in that, Including but not limited to mutations or inhibition of rice OsPHT1;1 The expression of these substances aims to improve nutrient utilization efficiency and palatability in rice, reduce the content of gluten / prolysin / globulin / albumin, and decrease phytic acid; or to... ospht1;1 Mutant rice plants are propagated by hybridization, backcrossing, or asexual reproduction using one or more methods to introduce the mutated gene. ospht1;1 Import other rice varieties.
9. The method according to claim 8, characterized in that, Mutation or inhibition of rice OsPHT1;1 The expression methods are selected from gene editing, RNAi, and virus-induced gene silencing.
10. The method according to claim 9, characterized in that, Mutation or inhibition of rice OsPHT1;1 The method of expression is to introduce the gene editing vector of claim 4 or 5 into wild-type rice to obtain a rice mutant with the gene mutation.