Tea tree cold-resistant gene editing and molecular marker assisted breeding method

Abstract

The invention discloses a tea tree cold-resistant gene editing and molecular marker-assisted breeding method, and relates to the field of genetic engineering breeding and molecular breeding, and the method comprises the following steps: designing a CAPS molecular marker specific primer according to an SNP site Chr7: 221281848, carrying out PCR amplification on DNA of a tea tree, carrying out enzyme digestion on a PCR amplification product by using TaqI to detect the genotype, and selecting a CC genotype tea tree to induce callus; the method comprises the following steps: inserting a CsWRKY19 gene into a pBI121 vector to obtain a CsWRKY19 gene overexpression vector; transferring the overexpression vector into an agrobacterium competent cell, and infecting the callus; screening, proliferating and differentiating the infected calluses, carrying out PCR (Polymerase Chain Reaction) screening to obtain positive seedlings, and culturing to obtain cold-resistant tea tree plants; according to the breeding method, the technical bottlenecks of long period, low efficiency and poor accuracy in cold-resistant breeding of the tea trees are broken through through a double-track collaborative breeding strategy of gene editing enhancement and molecular marker screening.

Description

TECHNICAL FIELD

[0001] The present application relates to genetic engineering breeding and molecular breeding technology, and in particular to a tea tree cold resistance gene editing and molecular marker assisted breeding method. BACKGROUND

[0002] Tea tree is a perennial evergreen economic crop that likes warm and fears cold, and its optimum growth temperature is between 20-25℃. Low temperature stress, especially the "reverse spring cold" in spring and frost in winter, is the main environmental factor that limits tea yield and quality and restricts the expansion of tea tree planting range to the north. Low temperature can cause a series of physiological injuries to tea trees, including cell membrane system damage, increased membrane permeability leading to electrolyte exosmosis, decreased photosynthetic efficiency (such as PSII maximum photochemical efficiency Fv / Fm), large accumulation of reactive oxygen species (ROS) causing oxidative stress, and metabolic balance disruption, etc.

[0003] In the prior art, whether it is system selection or hybrid breeding, the core screening basis is field phenotypic identification, that is, the cold resistance of tea trees is evaluated by directly observing their frost damage performance (such as leaf discoloration and wilting degree) after natural low temperature or artificial simulated low temperature, which has a long cycle, is greatly affected by the environment, is highly subjective, and cannot be selected early, resulting in a huge waste of land, manpower and time resources. SUMMARY

[0004] The purpose of the present application is to provide a tea tree cold resistance gene editing and molecular marker assisted breeding method to solve the problems of long cycle, great environmental influence, strong subjectivity and inability to select early in the prior art.

[0005] In order to achieve the above purpose, the present application provides the following technical scheme: a tea tree cold resistance gene editing and molecular marker assisted breeding method, comprising the following steps:

[0006] S1, first extract the genomic DNA of tea tree, design CAPS molecular marker specific primers according to the SNP site Chr7:221281848 of CsERF1 gene, perform PCR amplification, use specific endonuclease TaqI to cut the PCR amplification product, detect the enzyme cutting product by agarose gel electrophoresis, judge the genotype of CsERF1 gene according to the enzyme cutting map, and select tea trees with cold resistance genotype to induce callus;

[0007] S2, insert the CsWRKY19 gene into the multiple cloning site MCS of the pBI121 vector, complete the gene insertion through restriction enzyme digestion and ligation reaction, and construct a CsWRKY19 gene overexpression vector;

[0008] S3, the constructed CsWRKY19 gene overexpression vector is transferred into the agrobacterium competent cells, and then the tea tree callus obtained in S1 is infected to obtain the infected tea tree callus;

[0009] S4, the infected tea tree callus is placed on the culture medium for callus screening, proliferation and differentiation culture to obtain the differentiated seedlings;

[0010] S5, the differentiated seedlings are moved into the culture tank for culture, and PCR identification screening is performed to obtain positive seedlings;

[0011] S6, the positive seedlings are transplanted in the field and the cold resistance is identified to obtain the cold-resistant tea tree plants.

[0012] Further, the Chr7:221281848 in S1 is located at the 221281848th position of the 7th chromosome of the tea tree, and the polymorphism is C / T; the cold-resistant genotype in S1 is the CC genotype.

[0013] Further, the pBI121 vector in S2 has a CaMV35S promoter, a NOS terminator and a hygromycin phosphotransferase selection marker gene.

[0014] Further, the restriction enzyme used in S2 is EcoR I and BamH I.

[0015] Further, the enzyme used in the ligation reaction in S2 is T4 DNA ligase.

[0016] Further, the culture medium used for callus screening in S4 is added with kanamycin and hygromycin, the concentration of the kanamycin in the culture medium is 100-150 mg / L, and the concentration of the hygromycin in the culture medium is 2-5 mg / L.

[0017] Further, the culture medium used for proliferation in S4 is added with 2,4-dichlorophenoxyacetic acid and 6-benzylaminopurine, the concentration of the 2,4-dichlorophenoxyacetic acid in the culture medium is 0.5-1.0 mg / L, and the concentration of the 6-benzylaminopurine in the culture medium is 0.5-1.0 mg / L.

[0018] Further, the culture medium used for differentiation culture in S4 is added with a cytokinin and an auxin.

[0019] Further, the cytokinin is 6-benzylaminopurine, and the auxin is indole acetic acid or indole butyric acid.

[0020] Further, the concentration of 6-benzylaminopurine in the culture medium is 1.0-2.0 mg / L; the concentration of indoleacetic acid in the culture medium is 0.1-0.5 mg / L; and the concentration of indolebutyric acid in the culture medium is 0.5-1.0 mg / L.

[0021] Compared with existing technologies, the present invention provides a method for cold-resistant gene editing and molecular marker-assisted breeding of tea trees. Through a dual-track synergistic breeding strategy of gene editing enhancement and molecular marker screening, it breaks through the technical bottlenecks of long cycle, low efficiency, and poor accuracy in cold-resistant tea tree breeding. The breeding cycle is shortened, and molecular markers can be accurately screened at the seedling stage, greatly saving resources. The selection accuracy is greatly improved, overcoming the drawbacks of traditional phenotypic selection being affected by environmental interference. Precise editing preserves the high-quality agronomic traits of the original variety to the maximum extent, avoiding the chain of burdens in hybridization breeding. It can directly improve high-quality but cold-resistant main varieties, quickly cultivate new cold-resistant lines, and break through germplasm limitations.

[0022] This breeding method provides a new, efficient, and controllable paradigm for stress-resistant breeding of tea trees, and has broad application prospects. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in this invention. For those skilled in the art, other drawings can be obtained based on these drawings.

[0024] Figure 1 This is a schematic diagram of the blade relative conductivity detection results provided in an embodiment of the present invention;

[0025] Figure 2 This is a schematic diagram of the results of malondialdehyde (MDA) content determination in leaves provided in an embodiment of the present invention;

[0026] Figure 3 A schematic diagram illustrating the results of leaf soluble sugar content determination provided in an embodiment of the present invention;

[0027] Figure 4 This is a schematic diagram of the leaf proline content determination results provided in an embodiment of the present invention;

[0028] Figure 5 This is a schematic diagram of the plant height measurement results of cold-resistant tea trees provided in an embodiment of the present invention;

[0029] Figure 6 This is a schematic diagram of the leaf area measurement results of cold-resistant tea plant provided in an embodiment of the present invention;

[0030] Figure 7This is a schematic diagram illustrating the results of measuring the fresh and dry weight of cold-resistant tea plants according to an embodiment of the present invention.

[0031] Figure 8 This is a schematic diagram illustrating the gene expression analysis results of cold-resistant tea plants provided in an embodiment of the present invention. Detailed Implementation

[0032] To enable those skilled in the art to better understand the technical solution of the present invention, the present invention will be further described in detail below with reference to the accompanying drawings.

[0033] Example 1:

[0034] A method for cold-resistance gene editing and molecular marker-assisted breeding in tea trees includes the following steps:

[0035] S1. First, genomic DNA was extracted from tea plants. Based on the SNP site Chr7:221281848 of the CsERF1 gene, CAPS molecular marker-specific primers were designed for PCR amplification. The PCR amplification products were digested with the specific restriction enzyme TaqI. The digestion products were detected by agarose gel electrophoresis. The genotype of the CsERF1 gene was determined based on the restriction pattern. Tea plants with the CC genotype were selected to induce callus tissue. Chr7:221281848 is located at position 221281848 on chromosome 7 of tea plants, and its polymorphism is C / T.

[0036] CAPS molecular marker-specific primers are PCR (polymerase chain reaction) primers designed for CAPS (cut-and-amplify polymorphic sequence) molecular marker analysis. These primers can specifically bind to the vicinity of a specific SNP (single nucleotide polymorphism) site in the target gene (CsERF1 gene), thereby amplifying the DNA fragment containing that SNP site through PCR.

[0037] Specific primers are primers whose nucleotide sequences are highly matched to the target DNA sequence, binding only to the target sequence and not to non-target sequences. This specificity ensures the accuracy and efficiency of PCR amplification.

[0038] CAPS molecular markers are a molecular marker method based on PCR and restriction endonuclease digestion techniques. It utilizes changes in restriction endonuclease recognition sites caused by specific SNP sites in the genome. Genomic fragments containing the mutated sites are amplified using specific primers, and then the PCR amplification products are digested with endonucleases. Due to the presence of the SNP sites, amplified fragments of some genotypes will be cleaved by the enzymes, while others will not, thus producing polymorphic bands used to distinguish different genotypes.

[0039] In cold-resistant tea breeding, the CsERF1 gene was identified through sequence system analysis, and it was found that the SNP site on this gene is significantly associated with the cold resistance of tea plants. To utilize this SNP site for CAPS molecular marker analysis, specific primers were designed that can specifically bind to both sides of the DNA sequence containing the SNP site. DNA fragments containing the SNP site were obtained through PCR amplification, and the PCR products were then digested with the specific restriction enzyme TaqI. Based on the restriction enzyme pattern, the genotype of the CsERF1 gene (CC, CT, or TT) can be determined, thereby screening for cold-resistant tea plants.

[0040] Using CAPS molecular marker-specific primers for breeding screening is highly efficient, rapid, and precise. It allows for accurate genotyping during the seedling stage, significantly improving breeding efficiency and shortening the breeding cycle. This method avoids the drawbacks of traditional phenotypic selection being affected by environmental interference, thus improving the accuracy of selection.

[0041] Genomic DNA of tea plants was extracted using a kit, and PCR amplification was performed using the tea plant DNA as a template. The PCR amplification reaction system consisted of: 1 μL upstream primer, 1 μL downstream primer, 1 μL template DNA, 10 μL 2×Rapid Taq Master Mix, and 7 μL ddH2O.

[0042] Upstream primer (5'-3'): TTAGAATCCAAGCTCCTCCTAGACT;

[0043] Downstream primer (5'-3'): AGTACACCAATGAGTGTGGTGAAG.

[0044] The PCR amplification reaction conditions were as follows: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 40 s, for a total of 35 cycles; 72℃ extension for 5 min; and storage at 4℃.

[0045] The enzyme digestion system was as follows: 3 μL of PCR amplification product, 0.5 μL of TaqI, 1 μL of 10X FastDigest Green Buffer, and 5.5 μL of ddH2O. Digestion was performed at 65℃ for 35 min. After digestion, the product was detected by 1% agarose gel electrophoresis. After electrophoresis, the gel was placed under UV light or a gel imaging system was used to observe the DNA bands.

[0046] CC genotype: If the sample shows only one undigested band (approximately 539 bp in size), it is identified as CC genotype (wild-type homozygous). This genotype is significantly associated with the cold resistance of tea trees.

[0047] CT genotype: If the sample shows three bands (539bp, 383bp and 156bp respectively), it is identified as CT genotype (heterozygote), which has moderate cold resistance.

[0048] TT genotype: If the sample shows only two bands that have been digested by enzymes (383bp and 156bp in size, respectively), it is judged to be the TT genotype (mutant homozygote), which has weak cold resistance.

[0049] Tea callus induction essentially involves allowing the somatic cells of explants (leaves, stem segments, embryos, etc.) to dedifferentiate and regain their meristematic capacity under the stimulation of plant hormones (auxins and cytokinins), forming a cluster of undifferentiated thin-walled cells with division potential. This is an existing technology and will not be elaborated on further here.

[0050] S2. The CsWRKY19 gene was inserted into the multiple cloning site MCS of the pBI121 vector. The gene insertion was completed by restriction enzyme digestion and ligation reaction to construct the CsWRKY19 gene overexpression vector.

[0051] Based on the sequences of the CsWRKY19 gene and the pBI121 vector, the CsWRKY19 gene has EcoRI and BamHI restriction sites designed at both ends, and the MCS region of the pBI121 vector also contains these two restriction sites. Therefore, the CsWRKY19 gene and the pBI121 vector were digested with restriction enzymes respectively.

[0052] The total volume of the enzyme digestion reaction system was 50 μL, including 1 μg of CsWRKY19 gene or pBI121 vector DNA, 5 μL of 10× restriction enzyme buffer, 1 μL of EcoRI (10 U / μL), 1 μL of BamHI (10 U / μL), and finally ddH2O to make up to 50 μL.

[0053] The enzyme digestion reaction was carried out at 37°C for 1-2 hours. After digestion, the digestion effect was detected by agarose gel electrophoresis to confirm that both the CsWRKY19 gene and the pBI121 vector were successfully digested. The digested CsWRKY19 gene and pBI121 vector were then ligated.

[0054] The total volume of the ligation reaction system was 20 μL, including 1 μL of CsWRKY19 gene DNA after enzyme digestion, 1 μL of pBI121 vector DNA after enzyme digestion (the molar ratio of gene to vector was 3:1-10:1), 2 μL of 10×T4 DNA ligase buffer, 1 μL of T4 DNA ligase (10 U / μL), and finally, ddH2O was added to bring the volume to 20 μL.

[0055] The ligation reaction was carried out overnight at 16°C. After the ligation reaction was completed, the cells were transformed into competent E. coli (DH5α) cells and positive clones were screened. The plasmid was extracted and sequenced to verify that the CsWRKY19 gene was correctly inserted into the MCS of the pBI121 vector, thus constructing the CsWRKY19 gene overexpression vector.

[0056] S3. The constructed CsWRKY19 gene overexpression vector was transformed into Agrobacterium competent cells, and then the tea callus obtained in S1 was infected to obtain infected tea callus.

[0057] The constructed CsWRKY19 gene overexpression vector was transformed into Agrobacterium competent cells: 100 μL of Agrobacterium competent cells were taken, and 1-2 μL of the overexpression vector plasmid DNA was added. The mixture was gently mixed and placed on ice for 5 minutes. Then, it was transferred to a 42°C water bath for heat shock for 90 seconds, immediately returned to ice to cool for 2-3 minutes, and 800 μL of LB liquid medium (antibiotic-free) was added. The cells were then incubated at 37°C on a shaker for 1 hour. 100 μL of the incubated Agrobacterium culture was spread on LB solid medium containing the appropriate antibiotic (kanamycin) and cultured at 37°C for 2-3 days. Positive Agrobacterium clones were then selected.

[0058] The selected positive Agrobacterium clones were cultured in LB liquid medium containing antibiotics until OD. 600 For a growth period of 0.6-0.8 (logarithmic growth phase), the tea tree callus tissue was cut into appropriate sizes (0.5cm × 0.5cm) under aseptic conditions and soaked in Agrobacterium positivity solution for 10-15 minutes to allow Agrobacterium positivity to fully infect the callus tissue.

[0059] After infection, the callus tissue was blotted with sterile filter paper to remove excess bacterial solution, and then placed on MS medium containing antibiotics (kanamycin, concentration of 50-100 mg / L) for co-culture. The co-culture conditions were 25°C and in the dark for 2-3 days to allow Agrobacterium to fully contact the callus tissue and achieve gene transformation.

[0060] S4. The infected tea tree callus tissue was placed on a culture medium for callus screening, proliferation and differentiation culture to obtain differentiated seedlings.

[0061] After co-culture, the callus tissue was transferred to MS medium containing a high concentration of antibiotics (kanamycin 100-150 mg / L) and screening agent (hygromycin, concentration 2-5 mg / L) for screening culture. The screening conditions were 25℃, 16 hours of light / 8 hours of dark, and the medium was changed every 2-3 weeks to screen out the positive callus tissue that had been successfully transformed.

[0062] When constructing the CsWRKY19 gene overexpression vector, the pBI121 vector contains a resistance gene (antibiotic resistance gene). This resistance gene serves as a molecular marker for screening successfully transformed positive callus tissue. Infected tea plant callus tissue was transferred to MS medium containing a high concentration of antibiotics (kanamycin 100-150 mg / L) and a selection agent (hygromycin, concentration 2-5 mg / L) for selection culture. This medium, called the selection medium, primarily functions to select successfully transformed positive callus tissue through antibiotic selection pressure.

[0063] Callus tissue was placed at 25°C for 16 hours of light followed by 8 hours of darkness, with the culture medium changed every 2-3 weeks. Untransformed cells, lacking the resistance gene, could not survive on the antibiotic-containing medium and gradually died. Successfully transformed cells, containing the resistance gene, could grow and multiply normally on the antibiotic-containing medium. This method allows for the selection of successfully transformed positive callus tissue.

[0064] The screening principle of molecular marker-based resistance genes is based on differences in gene expression. Resistance genes are normally expressed in successfully transformed cells, producing resistance proteins that enable the cells to resist antibiotic toxicity. Untransformed cells, lacking resistance genes, cannot produce resistance proteins and therefore cannot survive on antibiotic-containing culture media. This selective pressure allows for the effective screening of successfully transformed positive callus tissue.

[0065] After a period of culture, the growth of the callus tissue is observed. Only those callus tissues that can grow normally are considered successfully transformed positive callus tissues. These positive callus tissues can be further transferred to proliferation medium for proliferation culture.

[0066] The selected positive callus tissues were transferred to proliferation medium for further culture. The proliferation medium can be prepared by adding appropriate amounts of auxin (2,4-dichlorophenoxyacetic acid, concentration 0.5-1.0 mg / L) and cytokinin (6-benzylaminopurine, concentration 0.5-1.0 mg / L) to MS medium. The culture conditions were 25℃, 16 hours of light / 8 hours of dark, with the medium changed every 2-3 weeks to promote continuous callus proliferation.

[0067] Once the callus tissue has proliferated to a point where it can differentiate, it is transferred to a differentiation medium for further differentiation culture. This medium can be MS medium supplemented with an appropriate amount of cytokinin (6-benzylaminopurine, 1.0-2.0 mg / L) and a low concentration of auxin (indoleacetic acid, 0.1-0.5 mg / L). The culture conditions are 25°C, 16 hours of light / 8 hours of darkness, to induce callus tissue differentiation into shoots. After the shoots reach a certain length (1-2 cm), they are cut off and transferred to a rooting medium for rooting culture. This medium can be MS medium supplemented with an appropriate amount of auxin (indolebutyric acid, 0.5-1.0 mg / L). The culture conditions are 25°C, 16 hours of light / 8 hours of darkness, to induce the shoots to root and form complete seedlings.

[0068] S5. The differentiated seedlings were transferred to a culture tank for culture, and positive seedlings were obtained by PCR identification and screening.

[0069] Seedling Cultivation: After differentiation, the seedlings are transferred to cultivation tanks for acclimatization. During acclimatization, the light intensity and ventilation are gradually increased, while the air humidity is reduced, allowing the seedlings to gradually adapt to the external environment. Acclimatization generally takes 2-3 weeks. When the seedlings are robust, with dark green leaves and well-developed root systems, they can be transplanted into soil for further cultivation. The cultivation tanks must be strictly sterilized beforehand to ensure a sterile environment. An appropriate amount of sterile water or nutrient solution can be added to the cultivation tank. The roots of the seedlings are placed in the nutrient solution, the cultivation tank is covered, and it is placed in a light incubator for cultivation. The cultivation conditions are 25℃, 16 hours of light / 8 hours of darkness. The growth of the seedlings is observed regularly, and nutrient solution is replenished as needed.

[0070] PCR identification: Genomic DNA was extracted from seedlings and used as a PCR template. Specific primers were designed based on the CsWRKY19 gene sequence, ensuring high specificity and amplification efficiency. The PCR reaction system consisted of a total volume of 20 μL, 2 μL of 10×PCR buffer, 2 μL of dNTPs (2.5 mM), 0.5 μL of upstream primer (10 μM), 0.5 μL of downstream primer (10 μM), 0.2 μL of Taq polymerase (5 U / μL), 1-2 μL of template DNA, and finally, ddH2O was added to bring the volume to 20 μL.

[0071] PCR reaction conditions: 94℃ pre-denaturation for 5 minutes; 94℃ denaturation for 30 seconds, 55-60℃ annealing for 30 seconds (adjust according to primer Tm value), 72℃ extension for 1 minute, 30-35 cycles; 72℃ final extension for 10 minutes. PCR products were detected by agarose gel electrophoresis to observe for specific bands, thus determining whether the seedlings were successfully transformed with the CsWRKY19 gene.

[0072] S6. The positive seedlings were transplanted to the field and their cold resistance was assessed to obtain cold-resistant tea plantlets that had been selectively edited.

[0073] Positive seedlings with the CC genotype were transplanted under aseptic conditions into pots containing a substrate of vermiculite and perlite, and placed in a greenhouse for acclimatization cultivation. Vermiculite and perlite were selected as the substrate in a 1:1 volume ratio. After mixing the vermiculite and perlite evenly, they were disinfected with a 0.1% potassium permanganate solution, soaked for 30 minutes, then rinsed 3-5 times with clean water and drained. Vermiculite and perlite have good air permeability and water retention, suitable for the growth of tea seedlings; plastic pots with a diameter of 10-15cm and drainage holes at the bottom were used to ensure good drainage.

[0074] During the acclimatization process, light intensity and temperature variations were gradually increased while humidity was reduced to allow the seedlings to adapt to the natural environment. The initial temperature was set at around 25℃ and gradually increased to 30℃ to simulate temperature changes in the natural environment; the initial light intensity was 1500-2000 lx and gradually increased to 5000-6000 lx, with the daily light duration gradually increasing from 12 hours to 14-16 hours; the initial humidity was maintained at 70%-80% and gradually decreased to 50%-60%, regulated by controlling the ventilation and misting systems in the greenhouse; once the seedlings were robust, they were transplanted to the field for planting, and the growth and cold resistance of the plants were regularly observed to ultimately obtain targeted, cold-resistant tea tree plants.

[0075] Example 2:

[0076] Please see Figures 1 to 4 This embodiment provides a technical solution based on Embodiment 1: determination of physiological indicators of cold-resistant tea plant.

[0077] The cold resistance of new tea varieties was assessed by measuring their physiological indicators under low-temperature stress: relative conductivity, malondialdehyde (MDA) content, soluble sugar content, and proline content.

[0078] Ten wild-type tea trees and ten selectively edited cold-resistant tea trees were selected and labeled WT and T1, respectively. These plants were cultured to maturity under the same environmental conditions. Then, the WT and T1 plants were placed in a low-temperature environment of 4°C for 24 hours, 48 ​​hours, and 72 hours, respectively, with three replicates for each treatment.

[0079] Relative conductivity determination: The relative conductivity of the leaf was determined using the conductivity method. The leaf was cut into small pieces and soaked in deionized water for 2 hours to determine the initial conductivity (C1). Then, the leaf was boiled for 10 minutes, cooled, and the final conductivity (C2) was determined. The formula for calculating the relative conductivity is:

[0080] .

[0081] Malondialdehyde (MDA) content determination: The MDA content was determined using the thiobarbituric acid method. MDA was extracted from the leaves after grinding, and its content was determined by colorimetry.

[0082] Soluble sugar content determination: The soluble sugar content was determined using the anthrone colorimetric method. The leaf extract was reacted with anthrone reagent, and the content was determined by colorimetry.

[0083] Proline content determination: The proline content was determined using the acidic ninhydrin method. The leaf extract was reacted with ninhydrin reagent, and the content was determined by colorimetric method.

[0084] In summary, all experimental data were analyzed by t-test. "*" indicates P≤0.05, and "**" indicates P≤0.01.

[0085] Please see Figure 1 The relative conductivity of T1 plants should be significantly lower than that of WT plants, indicating that T1 plants have better cell membrane stability under low-temperature stress; please refer to Figure 2 The MDA content of T1 plants should be significantly lower than that of WT plants, indicating that T1 plants experience less oxidative damage to their cell membranes under low-temperature stress; please refer to [link to relevant documentation]. Figure 3 The soluble sugar content of T1 plants should be significantly higher than that of WT plants, indicating that T1 plants can accumulate more soluble sugars under low temperature stress, thus enhancing the cell's osmotic regulation capacity; please refer to Figure 4 The proline content of T1 plants should be significantly higher than that of WT plants, indicating that T1 plants can accumulate more proline under low temperature stress and enhance the cell's osmotic regulation ability.

[0086] Example 3:

[0087] Please see Figures 5 to 7 This embodiment provides a technical solution based on Embodiment 1: Measurement of growth indicators of cold-resistant tea tree plants:

[0088] 1. Plant height measurement:

[0089] Ten plants of uniform growth were selected from both the experimental group T1 (directively edited cold-resistant tea plantlets) and the control group WT (wild-type tea plants), and their initial plant height was marked and recorded. The plants from the experimental and control groups were placed in low-temperature environments of 4℃ and -5℃, respectively, for 48 hours. After treatment, the plants were moved back to a normal temperature (25℃) environment for 7 days of recovery culture.

[0090] Use a measuring tape to measure the plant height from the base to the top, accurate to the millimeter; measure once a day and record the change in plant height over 7 days. All experimental data are analyzed by t-test, where "*" indicates P≤0.05 and "**" indicates P≤0.01.

[0091] Please see Figure 5 The average plant height of the experimental group T1 and the average plant height of the control group WT were both 30.0 cm. After treatment at 4℃ for 48 hours and recovery culture for 7 days, the average plant height of the experimental group T1 was 32.5 cm and the average plant height of the control group WT was 28.0 cm. After treatment at -5℃ for 48 hours and recovery culture for 7 days, the average plant height of the experimental group T1 was 31.0 cm and the average plant height of the control group WT was 25.0 cm.

[0092] After low-temperature treatment, the plant height recovery of the experimental group T1 tea trees was significantly better than that of the control group WT, indicating that the experimental group T1 has better growth recovery ability.

[0093] 2. Leaf area measurement:

[0094] Ten leaves of uniform growth were selected from both the experimental group T1 and the control group WT, and their initial leaf areas were marked and recorded. The experimental group T1 and the control group WT were placed in low-temperature environments of 4℃ and -5℃, respectively, for 48 hours. After treatment, the plants were moved back to a normal temperature (25℃) environment for 7 days of recovery culture. The leaf area was directly measured using a leaf area meter (CI-203 portable leaf area meter), accurate to square centimeters, once a day, and the changes in leaf area over 7 days were recorded. All experimental data were analyzed by t-test, where "*" indicates P≤0.05 and "**" indicates P≤0.01.

[0095] Please see Figure 6 The initial average leaf area of ​​both the experimental group T1 and the control group WT was 15.0 cm². 2 After treatment at 4℃ for 48 hours, followed by a 7-day recovery period, the average leaf area of ​​the experimental group was 16.5 cm². 2 The average leaf area of ​​the control group was 13.0 cm². 2 After treatment at -5℃ for 48 hours, followed by a 7-day recovery period, the average leaf area of ​​the experimental group was 15.0 cm². 2 The average leaf area of ​​the control group was 11.0 cm². 2 .

[0096] After low-temperature treatment, the leaf area recovery of the tea trees in the experimental group was significantly better than that in the control group, indicating that the experimental group had better growth recovery ability.

[0097] 3. Determination of fresh weight and dry weight:

[0098] Ten plants of uniform growth were selected from both the experimental and control groups, and their initial fresh weight was recorded. The plants from the experimental and control groups were placed in low-temperature environments of 4℃ and -5℃, respectively, for 48 hours. After treatment, the plants were moved back to the normal temperature (25℃) environment for 7 days of recovery culture.

[0099] Fresh weight determination: The fresh weight of the plants was measured using an electronic balance, accurate to 0.01 g. Dry weight determination: The plants were placed in an oven and dried at 70℃ until constant weight, and the dry weight was measured, accurate to 0.01 g. Measurements were taken once a day, and the changes in fresh and dry weight over 7 days were recorded. All experimental data were analyzed by t-test, where "*" indicates P≤0.05 and "**" indicates P≤0.01.

[0100] Please see Figure 7 The average initial fresh weight of both the experimental group and the control group was 50.0 g. After treatment at 4℃ for 48 hours and recovery culture for 7 days, the average fresh weight of the experimental group was 55.0 g and the average fresh weight of the control group was 48.0 g. After treatment at -5℃ for 48 hours and recovery culture for 7 days, the average fresh weight of the experimental group was 52.0 g and the average fresh weight of the control group was 45.0 g.

[0101] The average initial dry weight of both the experimental and control groups was 5.0 g. After treatment at 4℃ for 48 hours and recovery culture for 7 days, the average dry weight of the experimental group was 5.5 g and the average dry weight of the control group was 4.8 g. After treatment at -5℃ for 48 hours and recovery culture for 7 days, the average dry weight of the experimental group was 5.2 g and the average dry weight of the control group was 4.5 g.

[0102] After low-temperature treatment, the experimental group of tea trees showed significantly better recovery in both fresh and dry weight than the control group, indicating that the experimental group had better growth recovery capabilities.

[0103] Example 4:

[0104] Please see Figure 8 This embodiment provides a technical solution based on Embodiment 1: gene expression analysis of cold-resistant tea plantations.

[0105] The CsCBF1 and CsCOR1 genes play important roles in the cold resistance mechanism of tea plants. CsCBF1, as a transcription factor, enhances the cold resistance of plants by regulating the expression of downstream cold-response genes; while the extracellular protein encoded by CsCOR1 acts as a signaling molecule, initiating a series of antifreeze and dormancy responses, thereby enhancing the cold resistance of tea plants. Research on these two genes is of great significance for understanding the cold resistance mechanism of tea plants and for breeding cold-resistant tea varieties.

[0106] Leaves were taken from the same location on plants in both the experimental and control groups, with three biological replicates for each group and three leaves taken from each replicate. The leaves were quickly frozen in liquid nitrogen and then stored at -80°C.

[0107] Total RNA was extracted following the instructions of the RNA extraction kit. Care was taken to avoid RNA degradation during extraction, and all procedures were performed under RNase-free conditions. The concentration and purity (A260 / A280 ratio) of the extracted RNA were determined using a NanoDrop spectrophotometer, and RNA integrity was assessed by agarose gel electrophoresis.

[0108] The total volume of the cDNA synthesis reaction system was 20 μL, including 1 μg of total RNA, 4 μL of 5×RT buffer, 2 μL of 10 mM dNTPs, 1 μL of primers (10 μM), 1 μL of SuperScript IV reverse transcriptase, and RNase-free ddH2O to bring the total volume to 20 μL. The reaction conditions were 25℃ for 10 minutes, 50℃ for 10 minutes, 85℃ for 5 minutes, and storage at 4℃.

[0109] The synthesized cDNA was diluted 10-fold with RNase-free ddH2O and used for subsequent qRT-PCR reactions.

[0110] The primer sequences for the qRT-PCR reaction are as follows:

[0111]

[0112] The total volume of the qRT-PCR reaction system was 20 μL, including 10 μL of 2×PowerUp SYBR Green Master Mix, 0.4 μL of upstream primer (10 μM), 0.4 μL of downstream primer (10 μM), 2 μL of diluted cDNA, and RNase-free ddH2O to bring the total volume to 20 μL. The reaction conditions were: 95℃ pre-denaturation for 2 minutes, 95℃ denaturation for 15 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 30 seconds, for 40 cycles.

[0113] Fluorescence signals were collected using a qRT-PCR instrument, and the Ct value (threshold cycle number) was analyzed using software to calculate the relative expression level.

[0114] Export Ct values ​​from the qRT-PCR instrument software, calculate the average Ct value for each gene in each sample, and use 2... -△△Ct The relative expression level, ΔΔCt, is calculated using the following method:

[0115] △Ct = Ct (target gene) - Ct (internal reference gene GAPDH);

[0116] △△Ct = △Ct (experimental group) - △Ct (control group);

[0117] All experimental data were analyzed by t-test. "*" indicates P≤0.05, and "**" indicates P≤0.01.

[0118] Please see Figure 8 After treatment at 4℃ for 24 hours, the CsWRKY19 gene expression level in the experimental group was 2.5 times that in the control group; after treatment at -5℃ for 24 hours, the CsWRKY19 gene expression level in the experimental group was 3.0 times that in the control group.

[0119] After treatment at 4℃ for 24 hours, the CsCBF1 gene expression level in the experimental group was 1.8 times that in the control group; after treatment at -5℃ for 24 hours, the CsCBF1 gene expression level in the experimental group was 2.2 times that in the control group.

[0120] After treatment at 4℃ for 24 hours, the CsCOR1 gene expression level in the experimental group was 2.0 times that in the control group; after treatment at -5℃ for 24 hours, the CsCOR1 gene expression level in the experimental group was 2.5 times that in the control group.

[0121] In summary, overexpression of the CsWRKY19 gene significantly increased the expression level of cold resistance-related genes in tea plants under low temperature stress, thereby enhancing the cold resistance of tea plants.

[0122] The foregoing has only described certain exemplary embodiments of the present invention by way of illustration. Undoubtedly, those skilled in the art can modify the described embodiments in various ways without departing from the spirit and scope of the present invention. Therefore, the foregoing drawings and descriptions are illustrative in nature and should not be construed as limiting the scope of protection of the claims of the present invention.

Claims

1. A method for cold-resistance gene editing and molecular marker-assisted breeding in tea trees, characterized in that, Includes the following steps: S1. First, extract genomic DNA from tea plants. Design CAPS molecular marker-specific primers based on the SNP site Chr7:221281848 of the CsERF1 gene and perform PCR amplification. Digest the PCR amplification products with the specific restriction enzyme TaqI. Detect the digestion products by agarose gel electrophoresis. Determine the genotype of the CsERF1 gene based on the restriction pattern and select tea plants with cold-resistant genotypes to induce callus tissue. S2. The CsWRKY19 gene was inserted into the multiple cloning site MCS of the pBI121 vector. The gene insertion was completed by restriction enzyme digestion and ligation reaction to construct the CsWRKY19 gene overexpression vector. S3. The constructed CsWRKY19 gene overexpression vector was transformed into Agrobacterium competent cells, and then the tea callus obtained in S1 was infected to obtain infected tea callus. S4. The infected tea tree callus tissue was placed on a culture medium for callus screening, proliferation and differentiation culture to obtain differentiated seedlings. S5. The differentiated seedlings were transferred into culture tanks for culture, and positive seedlings were obtained by PCR identification and screening. S6. The positive seedlings were transplanted to the field and their cold resistance was assessed to obtain cold-resistant tea plantlets that were selectively edited.

2. The method for editing cold-resistance genes and using molecular markers to assist breeding in tea cultivation according to claim 1, characterized in that, Chr7:221281848 described in S1 is located at position 221281848 on chromosome 7 of the tea plant, and its polymorphism is C / T; the cold-resistant genotype described in S1 is the CC genotype.

3. The method for editing cold-resistance genes and using molecular markers to assist breeding in tea cultivation according to claim 1, characterized in that, The pBI121 vector described in S2 contains a CaMV35S promoter, a NOS terminator, and a hygromycin phosphotransferase selectable marker gene.

4. The method for editing cold-resistance genes and using molecular markers to assist breeding in tea cultivation according to claim 1, characterized in that, The restriction enzymes used in S2 are EcoRI and BamHI.

5. The method for editing cold-resistance genes and using molecular markers to assist breeding in tea cultivation according to claim 1, characterized in that, The enzyme used in the ligation reaction described in S2 is T4 DNA ligase.

6. The method for editing cold-resistance genes and using molecular markers to assist breeding in tea cultivation according to claim 1, characterized in that, The callus screening medium described in S4 contains kanamycin and hygromycin, wherein the concentration of kanamycin in the medium is 100-150 mg / L and the concentration of hygromycin in the medium is 2-5 mg / L.

7. The method for editing cold-resistance genes and using molecular markers to assist breeding in tea cultivation according to claim 1, characterized in that, The culture medium used for proliferation described in S4 is supplemented with 2,4-dichlorophenoxyacetic acid and 6-benzylaminopurine, wherein the concentration of 2,4-dichlorophenoxyacetic acid in the culture medium is 0.5-1.0 mg / L, and the concentration of 6-benzylaminopurine in the culture medium is 0.5-1.0 mg / L.

8. The method for editing cold-resistance genes and using molecular markers to assist breeding in tea cultivation according to claim 1, characterized in that, The culture medium used for the differentiation culture described in S4 is supplemented with cytokinins and auxins.

9. The method for editing cold-resistance genes and using molecular markers to assist breeding in tea cultivation according to claim 8, characterized in that, The cytokinin is 6-benzylaminopurine, and the auxin is indoleacetic acid or indolebutyric acid.

10. The method for editing cold-resistance genes and using molecular markers to assist breeding in tea cultivation according to claim 9, characterized in that, The concentration of 6-benzylaminopurine in the culture medium is 1.0-2.0 mg / L; the concentration of indoleacetic acid in the culture medium is 0.1-0.5 mg / L; and the concentration of indolebutyric acid in the culture medium is 0.5-1.0 mg / L.

Images