Construction method and application of CRE enzyme animal model specifically driven and expressed by Nphs1 promoter

Abstract

The invention provides a construction method and application of a CRE enzyme animal model specifically driven and expressed by an Nphs1 promoter. A CRISPR-Cas9 system is utilized to insert an Nphs1 promoter sequence, a CRE gene coding sequence and a PolyA sequence in a donor plasmid into a mouse genome H11 site, so that mouse podocyte specific expression of CRE is realized, and when the mouse podocyte specific expression CRE is hybridized with a mouse model expressing a specific gene (containing an LoxP site), specific knockout of the gene in the podocyte can be realized; therefore, an animal model is provided for researching the function of the specific gene in the podocyte.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of medical biotechnology, and relates to animal model construction, in particular to a construction method of a CRE enzyme animal model specifically driven by an Nphs1 promoter and related application. BACKGROUND

[0002] Nphs1 is a gene encoding the transmembrane protein nephrin of the slit diaphragm of podocytes, and it was found as early as 2010 that it is located on the slit diaphragm between adjacent podocytes of the glomerulus and is one of the marker molecules of glomerular podocytes. The main function of nephrin is to serve as part of the glomerular filtration barrier to help maintain the integrity of the glomerular filtration membrane; in addition, nephrin plays an important role in controlling the cytoskeletal structure, affecting the morphology and activity of podocytes, etc. Appropriate levels of nephrin expression are necessary for normal glomerular function. In 2002, Cooper et al. found that the expression of nephrin was reduced in an animal model of proteinuric kidney disease, although other proteins are involved in the structure of podocytes, especially the slit diaphragm, but nephrin plays a key role in preventing proteins from passing through the glomerular barrier.

[0003] Cre is an enzyme protein derived from bacteriophage P1, which can recognize and catalyze homologous recombination between two LoxP sites, thereby causing DNA deletion, translocation, etc. This property makes it widely used in genetic engineering operations, especially in the establishment of inducible gene knockout mouse models. By mating transgenic mice that express cre enzyme in a tissue-specific manner with genetically engineered mice obtained from the ES cell route, tissue-specific gene knockout mice can be effectively obtained. Therefore, the construction of transgenic mice that express cre in a tissue-specific manner is of great significance for achieving tissue-specific gene knockout in vivo and further studying the function of the target gene in a specific tissue. SUMMARY

[0004] The present application is based on the above research and provides a construction method of a CRE enzyme animal model specifically driven by an Nphs1 promoter and application. The present application uses the promoter sequence of the glomerular podocyte marker molecule Nphs1 to drive the expression of CRE enzyme, and constructs a mouse model that specifically expresses CRE enzyme in podocytes. After being crossed with a mouse model expressing a specific gene containing a LoxP site, the specific knockout of the gene in podocytes can be achieved, providing an animal model for studying the function of the specific gene in podocytes.

[0005] In order to achieve the above purpose, the technical scheme of the present application is as follows:

[0006] The application provides a method for constructing an Nphs1 promoter-specific expression CRE enzyme animal model.

[0007] Preferably, the specific construction steps are as follows:

[0008] (1) Constructing a donor plasmid: sequentially recombining an Nphs1 promoter sequence, a CRE enzyme gene coding sequence and a PolyA sequence on a plasmid to construct a recombined expression plasmid;

[0009] (2) Cutting an H11 site of a mouse genome by using a gene editing technology; preferably, the H11 site is edited by using a CRISPR / Cas9 system, and the nucleic acid sequence of gRNA is as follows: ctgagccaacagtggtagta (SEQ ID NO. 1);

[0010] (3) Inserting the Nphs1 promoter sequence, the CRE enzyme gene coding sequence and the PolyA sequence in the plasmid constructed in step (1) into the H11 site of the mouse genome by homologous recombination;

[0011] (4) transplanting fertilized eggs surviving after injection into pseudopregnant female mice, identifying F0 generation mice after the female mice become pregnant and give birth to offspring, mating the sexually mature positive F0 generation mice with wild-type mice of the same background, identifying the genotype of F1 generation offspring mice, and screening to obtain homozygous mice.

[0012] Preferably, the mouse genotype identification PCR primer sequence is as follows:

[0013] Primer pair 1 (5' arm):

[0014] F: ATGCCCACCAAAGTCATCAGTGTAG (SEQ ID NO. 2),

[0015] R: GGTCTTCAATTACTGGCAATCCC (SEQ ID NO. 3), product size: 1542bp;

[0016] Primer pair 2 (3' arm):

[0017] F: ATCAGCCTCGACTGTGCCTTCTA (SEQ ID NO. 4),

[0018] R: TCACAGAAACCATATGGCGCTCC (SEQ ID NO. 5), product size: 1381bp;

[0019] Primer pair 3 (WT):

[0020] F: AGTCTTTCCCTTGCCTCTGCT (SEQ ID NO. 6),

[0021] R: GGGTCTTCCACCTTTCTTCAG (SEQ ID NO. 7), product size: 825bp.

[0022] The identification is carried out by using the following method:

[0023] Wild type mouse: no band is obtained by carrying out PCR reaction by using primer pair 1 and 2, and a single WT band is obtained by carrying out PCR reaction by using primer pair 3;

[0024] Heterozygote mouse: corresponding size bands are obtained by carrying out PCR reaction by using primer pair 1 and 2, and a single WT band is obtained by carrying out PCR reaction by using primer pair 3;

[0025] Homozygote mouse: corresponding size bands are obtained by carrying out PCR reaction by using primer pair 1 and 2, and no reaction band is obtained by carrying out PCR reaction by using primer pair 3.

[0026] In the second aspect of the present application, a Nphs1 promoter-specific expression CRE enzyme animal model is provided, which is prepared by using the above-mentioned method.

[0027] In the third aspect of the present application, the application of the above-mentioned Nphs1 promoter-specific expression CRE enzyme animal model is provided. Specifically, the application in constructing a specific gene knockout animal model is provided.

[0028] Preferably, the specific knockout of the gene in the podocyte is realized by crossing the constructed animal model with a mouse model expressing a target gene containing a LoxP site.

[0029] In the fourth aspect of the present application, a construction method of a podocyte-specific gene knockout animal model is provided. The specific knockout of the gene in the podocyte is realized by crossing the above-mentioned animal model with a mouse model expressing a target gene containing a LoxP site, and a specific gene knockout animal model is constructed.

[0030] Compared with the prior art, the present application has the following obvious advantages:

[0031] The present application provides a construction method of a Nphs1 promoter-specific expression CRE enzyme animal model. The mouse model constructed by using the method can be stably passed on, and provides a convenient, reliable and economical means for researching the knockout of a specific target gene in the podocyte. BRIEF DESCRIPTION OF DRAWINGS

[0032] Figure 1 The mouse model construction process of the CRE enzyme animal model showing that the Nphsl promoter specifically drives expression;

[0033] Figure 2 PCR identification results of positive F0 generation mice are shown (8, 10, 12-15, 18-20, 22, 23 are heterozygotes, and the rest are WT). DETAILED DESCRIPTION

[0034] The following examples and experimental examples further illustrate the present application and are not to be construed as limiting it. The examples do not include detailed descriptions of conventional methods, which are well known to those skilled in the art and are described in many publications.

[0035] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In addition, any method and material similar or equivalent to those described herein can be used in the practice of the present application, and the preferred methods and materials are described herein by way of example only.

[0036] The animal model construction method is as shown in Figure 1 The specific steps are as follows:

[0037] 1. Construct the donor plasmid, synthesize the Nphsl promoter sequence, CRE enzyme gene coding sequence and PolyA sequence by chemical synthesis, and determine the correctness of the sequence by Sanger sequencing.

[0038] 2. Design a gRNA targeting the H11 site of the mouse genome (the sequence is: ctgagccaacagtggtagta (SEQ ID NO. 1)), and co-inject the CRISPR-Cas9 system and the donor plasmid into the fertilized eggs of wild-type C57BL / 6NGpt mice.

[0039] 3. Take the surviving fertilized eggs after injection and transplant them into pseudopregnant female mice, and wait for them to become pregnant and give birth.

[0040] 4. Identification of F0 generation mice: the F0 generation pups born by the recipient mice are numbered by cutting the tail and cutting the toes on the 5th-7th day, and the genomic DNA is extracted for PCR amplification and sequencing identification (see Figure 2 ), to confirm the genotype.

[0041] 5. Breeding of positive F0 mice: After the positive F0 mice reach sexual maturity, they are mated with wild-type mice of the same background. The F1 pups born are numbered by tail clipping and toe clipping at 5-7 days old, and genomic DNA is extracted for PCR amplification and sequencing identification to confirm the genotype.

[0042] The sequences of the PCR primers for mouse genotype identification (5'-3') are as follows:

[0043] Primer pair 1 (5' arm):

[0044] F: ATGCCCACCAAAGTCATCAGTGTAG (SEQ ID NO. 2),

[0045] R: GGTCTTCAATTACTGGCAATCCC (SEQ ID NO. 3), product size: 1542 bp;

[0046] Primer pair 2 (3' arm):

[0047] F: ATCAGCCTCGACTGTGCCTTCTA (SEQ ID NO. 4),

[0048] R: TCACAGAAACCATATGGCGCTCC (SEQ ID NO. 5), product size: 1381 bp;

[0049] Primer pair 3 (WT):

[0050] F: AGTCTTTCCCTTGCCTCTGCT (SEQ ID NO. 6),

[0051] R: GGGTCTTCCACCTTTCTTCAG (SEQ ID NO. 7), product size: 825 bp.

[0052] The identification is carried out by the following method:

[0053] Wild-type mice: No band is obtained by PCR reaction with primer pairs 1 and 2, and a single WT band is obtained by PCR reaction with primer pair 3;

[0054] Heterozygous mice: Bands of corresponding sizes are obtained by PCR reaction with primer pairs 1 and 2, and a single WT band is obtained by PCR reaction with primer pair 3;

[0055] Homozygous mice: Bands of corresponding sizes are obtained by PCR reaction with primer pairs 1 and 2, and no band is obtained by PCR reaction with primer pair 3.

[0056] In the plasmid, the sequence of the insert (SEQ ID NO. 8) is as follows:

[0057]

[0058] The unexplained parts involved in the present application are the same as or realized by using the prior art. The applicant declares that the present application is illustrated by the above-mentioned embodiments to explain the detailed method of the present application, but the present application is not limited to the above-mentioned detailed method, i.e. it does not mean that the present application must rely on the above-mentioned detailed method to be implemented. It should be understood by those skilled in the art that any improvement of the present application, equivalent replacement of each raw material of the product of the present application, addition of auxiliary ingredients, selection of specific modes, etc. fall within the protection scope and disclosure scope of the present application.

Claims

1. A method for constructing an animal model of CRE enzyme specifically driven by the Nphs1 promoter, characterized in that, It was constructed by inserting the Nphs1 promoter sequence, the CRE enzyme gene coding sequence, and the PolyA sequence into the H11 site of the mouse genome.

2. The construction method according to claim 1, characterized in that, Includes the following steps: (1) Construction of donor plasmid: The Nphs1 promoter sequence, the CRE enzyme gene coding sequence and the PolyA sequence were sequentially recombined into the plasmid to construct the recombinant expression plasmid; (2) The H11 site of the mouse genome was cut using gene editing technology; (3) The Nphs1 promoter sequence, CRE enzyme gene coding sequence and PolyA sequence in the plasmid constructed in step (1) were inserted into the H11 site of the mouse genome by homologous recombination.

3. The construction method according to claim 2, characterized in that, In step (2), the H11 site is edited using the CRISPR / Cas9 system, and the nucleic acid sequence of the gRNA is shown in SEQ ID NO.

1.

4. The construction method according to claim 2, characterized in that, The procedure also includes the following steps: fertilized eggs that survive the injection are transplanted into pseudopregnant female mice, and after the mice become pregnant and give birth, the F0 generation mice are identified. Sexually mature positive F0 generation mice are mated with wild-type mice of the same background, and the genotypes of the F1 generation offspring are identified to select homozygous mice.

5. The construction method according to claim 5, characterized in that, The PCR primer sequences for mouse genotyping are shown in SEQ ID NO.2~7.

6. An animal model of CRE enzyme expression specifically driven by the Nphs1 promoter, characterized in that, It is prepared by the method described in any one of claims 1 to 5.

7. The application of the CRE enzyme animal model specifically driven by the Nphs1 promoter as described in claim 6 in the construction of specific gene knockout animal models.

8. The application according to claim 7, characterized in that, By hybridizing the animal model described in claim 6 with a mouse model expressing the target gene containing the LoxP site, the gene is specifically knocked out in podocytes.

9. A method for constructing an animal model of specific gene knockout in podocytes, characterized in that, By hybridizing the animal model described in claim 6 with a mouse model expressing the target gene containing the LoxP site, the gene is specifically knocked out, thus constructing an animal model with a specific gene knockout.

Images