Method for identifying white tail and black spot characters of yellow feather chickens and application of method

Abstract

The invention discloses a method for identifying white tail and black spot characters of yellow feather chickens and application of the method. According to the method for identifying the white tail and black spot character of the yellow feather chicken, the genotype of a pre-melanin small body protein gene chr33: 7, 093, 765 locus is detected, and the locus is Ggt; a single nucleotide polymorphism; wherein the AA genotype corresponds to the tail feathers without black spots, the GA genotype shows white tail and black spots in the cocks, and the GG genotype corresponds to black tails in the cocks. The invention provides a specific KASP primer of the site, and the rapid and accurate typing of the site can be realized. According to the method, recessive carriers with normal phenotypes, such as hens carrying GA / GG genotypes, can be recognized in an early stage for precise breeding, and the risk that offspring cocks have black spot characters can be radically eliminated from heredity by eliminating the carriers from a breeding group, so that the economic value of commercial chickens is improved. The method is suitable for the field of poultry molecular marker-assisted selection.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and poultry breeding technology, and more specifically, to a method for identifying the white-tailed black-spotted trait in yellow-feathered chickens and its application in yellow-feathered chicken breeding. Background Technology

[0002] Feather color is a key economic trait in poultry breeding, and its uniformity directly affects the market acceptance and value of commercial chickens. The Wuhua Sanhuang chicken, the only local chicken breed in Meizhou City, Guangdong Province, is characterized by its "three yellows" (yellow feathers, yellow beak, and yellow legs) and pure white tail feathers. During the Third National Survey of Livestock and Poultry Genetic Resources, the Wuhua Sanhuang chicken was identified as one of the newly discovered resources in Guangdong Province and is subject to rescue protection. However, in actual breeding, some roosters exhibit the phenomenon of black spots scattered on their tail feathers (white tail with black spots), disrupting the uniformity of feather appearance and causing economic losses.

[0003] Even more challenging is the fact that this black spot trait exhibits distinctly sex-limited expression (i.e., the trait only appears in roosters): in hens, even those carrying the same genetic material, the phenotype is completely normal (i.e., the tail feathers are pure white). This poses a significant challenge to traditional phenotype-based breeding methods: it is impossible to visually identify hens that are phenotypically normal but genotype carriers (i.e., carrying the black spot susceptibility gene). Once these "recessive carrier" hens are selected into the core breeding population, they continuously pass on the susceptibility gene to their offspring, resulting in a continuous emergence of black-spotted individuals in the roosters of their offspring, making it difficult to completely eliminate the trait through conventional breeding methods.

[0004] Pre-melanosome protein ( PMEL The γ-ray fowl gene is a key gene affecting pigment deposition in avian feathers. Previous studies have focused on the mechanism by which mutations in this gene lead to systemic white feathers (Kerje et al. Genetics, 2004, 168(3):1507–1518; Wang et al. GigaScience, 2025, 14: giae114). However, for PMEL The specific genetic mechanism by which genes cause the "spatially restricted melanin leakage" phenomenon—the appearance of scattered black spots on the white tail feathers of the Wuhua Sanhuang chicken—remains unknown. This lack of clarity in the mechanism hinders the development of efficient molecular markers for this trait.

[0005] Therefore, there is an urgent need in this field for a method that can accurately identify susceptible genotypes for the white-tailed, black-spotted trait in Wuhua Sanhuang chickens at an early stage, especially for precisely identifying hens with normal phenotypes but who are carriers. Developing such a technology is of great significance for achieving precision breeding of Wuhua Sanhuang chickens, completely eliminating the white-tailed, black-spotted trait, and improving the economic benefits of the industry. SUMMARY

[0006] The present application aims to provide a method for identifying the white tail black spot trait of yellow-feathered chicken. PMEL The genotype of the gene chr33:7,093,765 site of the yellow-feathered chicken is detected to identify the white tail black spot trait of the yellow-feathered chicken.

[0007] The present application is realized by the following scheme: A method for identifying the white tail black spot trait of yellow-feathered chicken, detecting the genotype of the gene chr33:7,093,765 site of the yellow-feathered chicken. PMEL The site is a G>A single nucleotide polymorphism; wherein the AA genotype corresponds to no black spot on the tail feather, the GA genotype exhibits white tail black spot in the male chicken, and the GG genotype corresponds to black tail in the male chicken.

[0008] The SNP site selection of the present application is based on the first identification of the gene chr33:7,093,765 site (G>A) being significantly related to the white tail black spot trait of Wuhua Sanhuang chicken through genome-wide association analysis (GWAS). PMEL The genotype of the site is associated with the phenotype as follows: AA genotype: pure white tail feather without black spot.

[0009] GA genotype: heterozygote, exhibiting white tail black spot in the male chicken and being a recessive carrier in the female chicken.

[0010] GG genotype: tail feather is black in the male chicken and is a recessive carrier in the female chicken.

[0011] The population genetics analysis of the site by the inventors further supports its novelty and application potential. The query results of the global chicken reference panel (GCRP) database (http: / / farmrefpanel.com / GCRP / ) show that the G>A variation is not detected in the comprehensive mixed panel (CMP) covering a wide range of diversity; and in the commercial breeding population panel (CBP), the A allele frequency is 0.105, indicating the potential application value in other commercial chicken breeds.

[0012] The genotype of the gene chr33:7,093,765 site is detected by competitive allele-specific PCR. PMEL The genotype of the gene chr33:7,093,765 site is detected by competitive allele-specific PCR.

[0013] KASP primer design: specific KASP primers are designed for the chr33:7,093,765 site, and the sequences are as follows: Upstream primer F1 (SEQ ID NO: 1): 5'- GAAGGTCGGAGTCAACGGATTGGACTTCGGGGACCAGAGCGGCACG-3', wherein the underlined portion is a HEX fluorescent tag sequence; GAAGGTCGGAGTCAACGGATT GGACTTCGGGGACCAGAGCGGCACG-3', wherein the underlined portion is a FAM fluorescent tag sequence; Upstream primer F2 (SEQ ID NO: 2): 5'- GAAGGTGACCAAGTTCATGCTGGACTTCGGGGACCAGAGCGGCACA-3'; GAAGGTGACCAAGTTCATGCT GGACTTCGGGGACCAGAGCGGCACA-3', wherein the underlined portion is a FAM fluorescent tag sequence; Downstream primer R (SEQ ID NO: 3): 5'- GTAGGTGTGGGTGACGGTGGGGCTGCGGG-3'. The second object of the present application is to provide a primer set for identifying the white tail black spot trait of yellow-feathered chicken.

[0014] A primer set for identifying the white tail black spot trait of yellow-feathered chicken, for detecting PMEL the gene at position chr33:7,093,765, comprising: Upstream primer F1: 5'- GAAGGTCGGAGTCAACGGATTGGACTTCGGGGACCAGAGCGGCACG-3'; Upstream primer F2: 5'- GAAGGTGACCAAGTTCATGCTGGACTTCGGGGACCAGAGCGGCACA-3'; Downstream primer R: 5'- GTAGGTGTGGGTGACGGTGGGGCTGCGGG-3'.

[0015] The third object of the present application is to provide the use of the primer set for identifying the white tail black spot trait of yellow-feathered chicken described above in the preparation of a white tail black spot trait detection kit for yellow-feathered chicken.

[0016] The fourth object of the present application is to provide the use of the method described above in the selection of a white tail black spot-free line of yellow-feathered chicken.

[0017] The fifth object of the present application is to provide a breeding method for controlling the sex-limited white tail black spot trait of yellow-feathered chicken.

[0018] Specifically, the breeding method for controlling the sex-limited white tail black spot trait of yellow-feathered chicken uses the method described above to detect the genotype of the hen at the gene at position chr33:7,093,765, and eliminates individuals with genotypes GA or GG and selects individuals with AA genotype for breeding. PMEL

[0019] The sixth object of the present application is to provide a breeding method for yellow-feathered chicken.

[0020] ​A breeding method for yellow-feathered chickens, using the above method to detect the yellow-feathered chickens'... PMEL Genotype chr33:7,093,765. Individuals with GA and GG genotypes were excluded, and individuals with AA genotypes were selected for breeding to obtain yellow-feathered chickens with no black spots on their tail feathers.

[0021] Beneficial effects This invention utilizes competitive allele-specific PCR (KASP) technology to detect promelanosome protein (… PMEL A method for identifying the black spot trait in the white tail feathers of yellow-feathered chickens by using the single nucleotide polymorphism (SNP) at the chr33:7,093,765 site, and its application in the precision breeding of yellow-feathered chickens.

[0022] Precision: This invention reveals for the first time the association between the chr33:7,093,765 locus and the white-tailed black-spotted trait of Wuhua Sanhuang chicken, demonstrating high molecular marker specificity.

[0023] High efficiency: KASP technology has high throughput and low cost, making it suitable for large-scale breeding.

[0024] Application value: It can identify phenotypic recessive carriers (hens) at an early stage, prevent the offspring of black-spotted roosters from being produced, fundamentally eliminate the trait, and improve feather uniformity and market value.

[0025] Extensibility: This method can be extended to the study of pigment deposition in other poultry breeds. Attached Figure Description

[0026] Figure 1 Phenotypic diagram of the tail feathers of the Wuhua Sanhuang rooster; (a) Pure white tail feather phenotype; (b) White tail with black spots phenotype.

[0027] Figure 2 Genome-wide association analysis for the trait of white tail with black spots in chickens; (a) Manhattan plot showing significant association signals on chromosome 33. Dashed lines represent genomic significance thresholds ( P = 3.37 × 10⁻ 7 (a) Arrow indicates the target site chr33:7,093,765. (b) QQ plot under mixed linear model (genome expansion factor λ = 1.007).

[0028] Figure 3 for PME KASP typing results for the L gene chr33:7,093,765 site; Blue, red, and green data points represent the GG, GA, and AA genotypes, respectively. NC represents the negative control. Detailed Implementation

[0029] The following examples illustrate the specific implementation process of the present invention, but the scope of protection of the present invention is not limited thereto.

[0030] Example 1: Phenotypic identification of target traits and preparation of high-quality genomic DNA samples Clearly defining the phenotypic characteristics of the target trait is fundamental before conducting molecular testing. For example... Figure 1 As shown, the pure white tail feathers of the Wuhua Sanhuang rooster are characterized by entirely white tail feathers without any melanin deposition. Figure 1 a), while the white-tailed black-spotted trait is characterized by scattered or patchy black spots on the overall white tail feathers ( Figure 1 (b) This trait is clearly distinguishable at 8 weeks of age and persists until sexual maturity, indicating that it can serve as a reliable phenotypic indicator for early breeding.

[0031] Based on this phenotypic criterion, we clearly selected a research population including 115 individuals with white tails and black spots and 476 individuals with pure white tail feathers, and then extracted their DNA: 1. Sample collection: Collect 0.5 mL of blood via vena cava puncture, store in an EDTA anticoagulant tube, mix well, and store at -80℃ for later use.

[0032] 2. DNA Extraction: Genomic DNA was extracted using the HiPure Universal DNA Kit (Guangzhou Meiji Biotechnology Co., Ltd.). The simplified procedure included: cell lysis of the blood sample, proteinase K digestion, transfer of the lysis buffer to an adsorption column, rinsing to remove impurities, and finally elution with elution buffer to obtain purified genomic DNA.

[0033] 3. DNA Quality Assay: The concentration and purity of DNA were determined using a micro-spectrophotometer, and the integrity and lack of degradation of the DNA were verified by 1% agarose gel electrophoresis. Qualified DNA samples were diluted to a working concentration (50 ng / μL) for subsequent KASP reactions.

[0034] Example 2: Identification of candidate loci through genome-wide association analysis 1. To identify genetic loci significantly associated with the white-tailed, black-spotted trait of Wuhua Sanhuang chickens across the entire genome, a population of 47 35-week-old roosters (23 with white tails and black spots, and 24 with pure white tails) was constructed from the samples prepared in Example 1 for GWAS analysis. Whole-genome resequencing with an average depth of 10.91× was performed on all individuals using the DNBSEQ-T7 platform. Variation detection and genotyping were performed using the standard GATK workflow, and the obtained SNPs underwent rigorous quality control, ultimately yielding 11,870,146 high-quality SNPs for association analysis.

[0035] 2. Genome-wide association analysis (GWAS) was performed using a linear mixture model in GEMMA software. After adjusting for population structure and phylogenetic relationships, association analysis was conducted on the tail feather black spot trait (white tail black spot = 1, pure white tail feathers = 0). Manhattan plot ( Figure 2 The study showed that there was a highly significant association peak (genomic significance threshold) on chromosome 33. P <3.37×10⁻ 7 ), among which, located PMEL The exon region chr33:7,093,765 (G>A) within the gene is completely associated with the trait. P = 3.61 × 10⁻¹ 7 The results indicate that this site is significantly associated with the white-tailed black-spotted trait and is the core molecular marker of this invention.

[0036] Example 3: KASP Primer Set Design and Validation according to PMEL Specific KASP primers were designed based on the flanking sequence of the gene chr33:7,093,765 (G>A). The primer sequences are as follows: Upstream primer F1 (SEQ ID NO:1): 5'- GAAGGTCGGAGTCAACGGATT GGACTTCGGGGACCAGAGCGGCACG-3', where the underlined part is the HEX fluorescent tag sequence; Upstream primer F2 (SEQ ID NO:2): 5'- GAAGGTGACCAAGTTCATGCT GGACTTCGGGGACCAGAGCGGCACA-3', where the underlined part is the FAM fluorescent tag sequence; Downstream primer R (SEQ ID NO:3): 5'-GTAGGTGTGGGTGACGGTGGGGCTGCGGG-3'.

[0037] To verify the effectiveness of the primers, KASP typing was performed using DNA samples with well-defined phenotypes prepared in Example 1 (115 white-tailed black-spotted roosters and 476 pure white-tailed roosters) as well as DNA from Huai Xiang chickens (62 birds) and Hetian chickens (45 birds) as black-tailed reference groups.

[0038] The KASP reaction system and procedure are as follows: the newly synthesized primer is first dissolved and diluted to a working concentration of 50 μM using a TE buffer (pH 8.0), and then the upstream typing primer F1 (SEQ ID NO: 1), the upstream typing primer F2 (SEQ ID NO: 2), and the downstream universal primer R (SEQ ID NO: 3) are mixed in a volume ratio of 1:1:3 to prepare a primer mixture. The total volume of the PCR amplification reaction is 10 μL, which consists of about 50 ng of sample genomic DNA 1 μL, the above-mentioned primer mixture 0.125 μL, 2x KASP premix (FLU-ARMS for KASP 2X PCR mix with ROX) 5 μL, and finally sterile ddH2O to make up to 10 μL.

[0039] The reaction is carried out on a real-time fluorescent quantitative PCR instrument (TIANLONG TL988), and the program is set as follows: first, 94°C pre-denaturation for 10 minutes; then 10 cycles of touchdown PCR, each cycle including 94°C denaturation for 20 seconds, and 61°C to 55°C annealing / extension for 60 seconds (the annealing / extension temperature decreases by 0.6°C for each cycle); then 30 regular cycles, including 94°C denaturation for 20 seconds and 55°C annealing / extension for 60 seconds; finally, the program collects fluorescence signals at 37°C for 1 minute. After amplification, the fluorescence signals are analyzed directly using the instrument's built-in genotyping software to automatically determine the genotype (GG, GA, or AA) of the sample.

[0040] The results are shown in Table 1. Figure 3 As shown in Table 1: at the population level, the black tail reference population is all GG genotype (blue, 107 / 107); the pure white tail feather population is all AA genotype (green, 476 / 476); and the white tail with black spot population is mainly composed of GA genotype (red) (98 / 115), and contains a small amount of GG genotype (blue, 17 / 115). At the individual level, genotypes carrying G alleles (GA or GG) are all associated with black spot susceptibility, while AA genotype is completely corresponding to the non-black spot phenotype. The clustering of the typing results is clear, and the correspondence between genotype and phenotype is clear, fully proving the specificity and accuracy of the primer set and site.

[0041] Example 4: Application in extended population and recessive carrier identification To verify the ability of the method to identify recessive carriers, 315 Wuhua Sanhuang chicken hens with pure white tail feathers were subjected to KASP detection. As a result, 14 G allele carriers (13 GA heterozygotes and 1 GG homozygote) were successfully identified. These hens cannot be distinguished phenotypically, but can be accurately identified by the molecular detection method of the present application.

[0042] To further verify the genetic effect of the above detection results, a cross experiment was designed: 13 GA heterozygous hens and 1 GG homozygous hen were mated with 3 pure white tail feather rooster cocks confirmed as AA genotype by KASP detection. The specific grouping is as follows: 6 GA hens are mated with cock A, 7 GA hens are mated with cock B, and 1 GG hen is mated with cock C. Continuous insemination for 20 days, detailed records are made according to the individual hens and two batches of hatching are carried out. After the chicks hatched, they were marked with wing numbers to identify the pedigree, and were raised under standard conditions until 20 weeks old, and the offspring tail feather phenotype was systematically observed.

[0043] The experimental results are as follows: GA heterozygous hen group: 13 GA heterozygous hens produced a total of 75 offspring (36 cocks and 39 hens) that could be evaluated. Among the offspring cocks, 19 were observed to be pure white tail feathers (AA genotype), and 17 were white tail black spots (GA genotype). Chi-square test (χ²) results showed that the segregation ratio conforms to the Mendelian genetic law of 1:1 (χ² = 0.111, df = 1, P =0.739). All offspring hens (39) showed pure white tail feathers, again confirming the sex-limited expression characteristics of the trait.

[0044] GG homozygous hen case: 1 GG homozygous hen was mated with an AA cock, resulting in 7 offspring (4 cocks and 3 hens). Among the offspring, 4 cocks all showed white tail black spots (genotype GA), and 3 hens all showed pure white tail feathers (genotype GA). This result fully meets the genetic expectations: GG x AA mating, all offspring are theoretically GA genotype. The GA genotype in cocks shows black spots, while the GA genotype in hens is normal due to sex-limited expression.

[0045] The conclusion of this cross experiment is clear: the GA and GG genotype hens identified by the KASP method of the present application are all recessive carriers of the white tail black spot trait, and can pass the susceptible allele to the offspring in a predictable pattern. This fully proves from the genetic level that the molecular typing results of the present application are highly accurate and predictable. Therefore, in breeding, by eliminating these recessive carriers, the transmission of susceptible alleles can be effectively and accurately blocked, fundamentally eliminating the phenomenon of white tail black spots in offspring cocks.

[0046] Example 5: Yellow feather chicken precision breeding process integrated with KASP detection The core application of the present application is to integrate it into the conventional breeding plan to achieve precision breeding. The breeding process is as follows: 1. Large-scale collection of samples: In the core breeding population or candidate parent population, large-scale collection of feather follicle or blood samples.

[0047] 2. High-throughput DNA extraction and genotyping: Extract DNA in batches using an automated workstation or standardized manual operation. The extraction method is shown in Example 1. Use the KASP primer set (SEQ ID NO: 1-3) provided in Example 3 and the optimized reaction system to perform high-throughput PCR amplification and fluorescence detection in, for example, a 384-well plate.

[0048] 3. Genotype determination and selection decision: Target genotype (AA): For both roosters and hens, individuals with AA genotype are preferred as parents. These individuals can stably produce offspring without black spots.

[0049] Genotypes to be eliminated (GA / GG): All individuals with GA or GG genotypes, especially phenotypically normal hens (recessive carriers), should be eliminated from the core breeding population of the white-tailed line.

[0050] 4. Recurrent selection and trait fixation: Continue the above-mentioned molecular-assisted selection on each generation of candidate individuals. After 2-3 generations of selection, the frequency of G alleles in the population can be significantly reduced, and the white-tailed trait without black spots can be completely fixed, thereby improving the uniformity of chicken feathers and market value.

Claims

1. A method for identifying the white-tailed black-spot trait of yellow-feathered chicken, characterized in that, Detecting the genotype of the pre-melanosomal protein gene at the site of chr33:7,093,765, which is a G>A single nucleotide polymorphism; wherein the AA genotype corresponds to tail feather without black spots, the GA genotype shows white tail black spots in male chickens, and the GG genotype corresponds to black tail in male chickens.

2. The method of claim 1, wherein, The genotype of the pre-melanosomal protein gene at the site of chr33:7,093,765 is detected by competitive allele-specific PCR.

3. The method of claim 2, wherein, The primer sequences used in the competitive allele-specific PCR are as follows: upstream primer F1: 5'-GAAGGTCGGAGTCAACGGATTGGACTTCGGGGACCAGAGCGGCACG-3'; upstream primer F2: 5'-GAAGGTGACCAAGTTCATGCTGGACTTCGGGGACCAGAGCGGCACA-3'; downstream primer R: 5'-GTAGGTGTGGGTGACGGTGGGGCTGCGGG-3'.

4. A primer set for identifying the yellow feather white tail black spot trait, characterized in that, For detecting the pre-melanosomal protein gene at the site of chr33:7,093,765, comprising: upstream primer F1: 5'-GAAGGTCGGAGTCAACGGATTGGACTTCGGGGACCAGAGCGGCACG-3'; upstream primer F2: 5'-GAAGGTGACCAAGTTCATGCTGGACTTCGGGGACCAGAGCGGCACA-3'; downstream primer R: 5'-GTAGGTGTGGGTGACGGTGGGGCTGCGGG-3'.

5. Use of the primer set of claim 4 in the preparation of a yellow-feathered chicken white tail black spot trait detection kit.

6. Use of the method of any one of claims 1-3 in the selection of a yellow-feathered chicken white tail without black spot strain.

7. A breeding method for controlling the sex-limited white-tailed black-spot trait of yellow-feathered chickens, characterized by, The genotype of the pre-melanosomal protein gene at the site of chr33:7,093,765 of the hen is detected by the method of any one of claims 1-3, and individuals with genotypes of GA or GG are eliminated, and individuals with AA genotype are selected for breeding.

8. A method of breeding yellow-feathered chickens, characterized by, The genotype of the pre-melanosomal protein gene at the site of chr33:7,093,765 of the yellow-feathered chicken is detected by the method of any one of claims 1-3, and individuals with genotypes of GA and GG are excluded, and individuals with AA genotype are selected for breeding, thereby obtaining yellow-feathered chickens without black spots on the tail feathers.

Images