Identification method of duck plasma cholinesterase abundance and application of related molecular marker of duck plasma cholinesterase abundance

Abstract

The invention discloses an identification method of duck plasma cholinesterase abundance and application of a related molecular marker thereof, and relates to the technical field of biology, a primer pair is used for amplifying a DNA fragment containing a 3516189th base polymorphic site from the 5'terminal on a No.9 chromosome of a duck reference genome IASAASPekinDuckT2T; the duck reference genome IAASAASPekinDuckT2T is a duck reference genome sequence in a GenBank database, and the duck reference genome sequence is a duck reference genome sequence in the GenBank database; the duck is a medium and new white feather meat duck, the primer pair is composed of a DNA molecule shown in SEQ ID No.2 and a DNA molecule shown in SEQ ID No.3, and the plasma cholinesterase abundance of the CC genotype duck and the CT genotype duck is remarkably higher than the plasma cholinesterase abundance (Plt; 0.05) of the TT genotype duck. The genotype of the duck is judged by detecting the genome DNA of the duck, early screening of the duck plasma cholinesterase abundance character is achieved, feed waste can be reduced, and the breeding cost can be reduced.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a method for identifying the abundance of cholinesterase in duck plasma and the application of related molecular markers. Background Technology

[0002] With the continuous increase in the total consumption of meat ducks, how to improve the growth performance of meat ducks, maintain the health of duck flocks, and meet the growing market demand has become an important industry issue.

[0003] Cholinesterase maintains normal nerve signal transmission and coordinated muscle contraction by precisely regulating the hydrolysis efficiency of acetylcholine. Cholinesterase catalyzes the breakdown of acetylcholine into choline and acetic acid, terminating excitatory signals in the synaptic cleft. Its abundance is an important marker for assessing autonomic nervous function and neuromuscular junction metabolic homeostasis. Risk factors for metabolic syndrome are positively correlated with cholinesterase abundance; excessive hydrolysis of acetylcholine by high cholinesterase levels leads to excessive production of fatty acid precursor metabolites, promoting metabolic disorders. In ducks, studies have shown a positive correlation between plasma cholinesterase abundance and flock activity, interfering with health and production performance, and impacting economic benefits. Screening key SNPs affecting duck plasma cholinesterase abundance using genetic breeding techniques and applying them to marker-assisted selection can accelerate the genetic improvement of traits such as carcass and health, possessing significant scientific and practical value. Therefore, we propose a method for identifying duck plasma cholinesterase abundance and the application of related molecular markers. Summary of the Invention

[0004] The purpose of this invention is to provide a method for identifying the abundance of cholinesterase in duck plasma and the application of related molecular markers, so as to solve the problems mentioned in the background art.

[0005] To achieve the above objectives, the present invention provides the following technical solution: a method for identifying the abundance of cholinesterase in duck plasma and the application of related molecular markers, wherein the primer pair is used to amplify a DNA fragment containing the polymorphic site at position 3516189 from the 5' end on chromosome 9 of the duck reference genome IASCAAS_PekinDuck_T2T; the duck reference genome IASCAAS_PekinDuck_T2T is a duck reference genome sequence in the GenBank database; the duck is the Sino-New Zealand white-feathered meat duck.

[0006] Furthermore, the primer pair consists of the DNA molecule shown in SEQ ID No. 2 and the DNA molecule shown in SEQ ID No. 3.

[0007] Furthermore, the plasma cholinesterase abundance in CC and CT genotype ducks was significantly higher than that in TT genotype ducks (P < 0.05).

[0008] The ducks with the TT genotype are those whose bases on chromosome 9 of the duck reference genome IASCAAS_PekinDuck_T2T are T, located at position 3516189 from the 5' end.

[0009] The ducks with the CT genotype are those whose bases at position 3516189 from the 5' end of chromosome 9 of the duck reference genome IASCAAS_PekinDuck_T2T are C and T.

[0010] The CC genotype ducks are those whose base position 3516189 from the 5' end on chromosome 9 of the duck reference genome IASCAAS_PekinDuck_T2T is C.

[0011] The duck reference genome IASCAAS_PekinDuck_T2T is a duck reference genome sequence from the GenBank database; the duck is the Sino-New Zealand white-feathered meat duck.

[0012] Furthermore, the method for determining the TT, CT, or CC genotypes is as follows: Using duck genomic DNA as a template, PCR amplification is performed using the primer pair described in claim 1 or 2 to obtain PCR amplification products; if the base at position 224 from the 5' end of the PCR amplification product is T, then the duck's genotype is TT; if the base at position 224 from the 5' end of the PCR amplification product is C and T, then the duck's genotype is CT; if the base at position 224 from the 5' end of the PCR amplification product is C, then the duck's genotype is CC.

[0013] Furthermore, this method involves selective breeding of ducks with the CC genotype;

[0014] The CC genotype ducks are those whose base position 3516189 from the 5' end on chromosome 9 of the duck reference genome IASCAAS_PekinDuck_T2T is C.

[0015] The duck reference genome IASCAAS_PekinDuck_T2T is a duck reference genome sequence from the GenBank database; the duck is the Sino-New Zealand white-feathered meat duck.

[0016] Furthermore, the method for determining the CC genotype is as follows: using duck genomic DNA as a template, PCR amplification is performed using the primer pair described in claim 1 or 2 as primers to obtain PCR amplification products; if the base at position 224 from the 5' end of the PCR amplification product is C, then the genotype of the duck is CC genotype.

[0017] Furthermore, this method involves selective breeding of ducks with the TT genotype;

[0018] The ducks with the TT genotype are those whose bases on chromosome 9 of the duck reference genome IASCAAS_PekinDuck_T2T are T, located at position 3516189 from the 5' end.

[0019] The duck reference genome IASCAAS_PekinDuck_T2T is a duck reference genome sequence from the GenBank database; the duck is the Sino-New Zealand white-feathered meat duck.

[0020] Furthermore, the method for determining the TT genotype is as follows: using duck genomic DNA as a template, PCR amplification is performed using the primer pair described in claim 1 or 2 as primers to obtain PCR amplification products; if the base at position 224 from the 5' end of the PCR amplification product is T, then the genotype of the duck is the TT genotype.

[0021] Furthermore, a related molecular marker application is characterized by being applied to the aforementioned method for identifying the abundance of cholinesterase in duck plasma.

[0022] This invention provides a method for identifying the abundance of cholinesterase in duck plasma and the application of related molecular markers, which has the following beneficial effects: by detecting the genomic DNA of ducks to determine their genotype, early screening of the abundance trait of cholinesterase in duck plasma can be achieved, reducing feed waste and lowering breeding costs.

[0023] The molecular marker of this invention is highly correlated with plasma cholinesterase abundance. Different genotypes of ducks show significant differences in plasma cholinesterase abundance. Using this marker for assisted selection can significantly improve the selection accuracy of the duck plasma cholinesterase abundance trait.

[0024] The primer pairs used for the test are highly specific, the PCR amplification conditions are mild, the sequencing or genotyping methods are mature, and automated batch testing can be achieved. The testing cost is low, making it suitable for screening large-scale breeding populations.

[0025] It is not only applicable to Sino-Singapore white-feathered meat ducks, but can also be extended to other duck breeds, providing a universal technical means for the genetic improvement of the abundance of cholinesterase in duck plasma, and has extremely high industrial application value. Attached Figure Description

[0026] Figure 1 This is a graph showing the genome-wide association analysis results of duck plasma cholinesterase abundance in this invention;

[0027] Figure 2 This is a graph showing the abundance of cholinesterase in the plasma of ducks with different genotypes of chromosome 9 g.3516189T>C.

[0028] Figure 3This is a sequence sequencing result of the sequence near the g.3516189T>C polymorphism site on chromosome 9 of the reference gene IASCAAS_PekinDuck_T2T in individual ducks with CC, CT, and TT genotypes in this invention.

[0029] Figure 4 This is a graph showing the differences in cholinesterase abundance in 36 ducks with different genotypes according to the present invention.

[0030] Figure 5 This is a graph showing the correlation between cholinesterase abundance and slaughter traits in 1610 ducks in this invention.

[0031] Figure 6 This is a phenotypic diagram showing the differences in slaughter traits among three different genotypes of ducks according to the present invention. Detailed Implementation

[0032] Please see Figures 1 to 6 This invention provides a technical solution: a method for identifying the abundance of cholinesterase in duck plasma and the application of related molecular markers, the specific implementation of which is as follows:

[0033] The experimental animals used in this invention all came from the Sino-Singapore White-feathered Meat Duck L-strain breeding population established by the Waterfowl Breeding and Nutrition Innovation Team of the Beijing Institute of Animal Husbandry and Veterinary Medicine, Chinese Academy of Agricultural Sciences.

[0034] This experiment selected 2,636 individuals from this resource population, fed the same diet, and allowed free access to food and water throughout the process.

[0035] At 40 days of age, 5 mL of wing vein blood was collected from experimental ducks using EDTA anticoagulant blood collection tubes. The collected blood was divided into two portions. 4 mL of the plasma was centrifuged at 3000 rpm for 10 min, and the supernatant was collected. The abundance of cholinesterase in the plasma was measured using a Maccura kit and a Hitachi 7080 automated biochemical analyzer. The remaining 1 mL of blood was used to extract whole-genome DNA using a Tiangen blood genomic DNA extraction kit (Cat. No. DP348). The DNA concentration and quality of each sample were accurately determined using a Nanodrop 2000 / 2000C nucleic acid and protein analyzer. The qualified DNA samples were sent to Shijiazhuang Borui Technology Co., Ltd. for genome resequencing. The sequencing depth for each individual was 10×. The data was quality controlled using PLINK software. A total of 16,650,547 SNPs from 1649 ducks were obtained for genome-wide association analysis of cholinesterase abundance.

[0036] Association analysis between SNPs and cholinesterase abundance phenotypes was performed using a mixed linear model in GCTA software, with sex and batch number as fixed effects. The significance threshold for the association between SNPs and cholinesterase abundance traits was 5 x 10⁻⁶. -8 The GWAS analysis results are as follows: Figure 1As shown, the horizontal axis represents chromosome number, and the vertical axis represents -log10 (P-value). The results indicate that SNPs significantly correlated with cholinesterase abundance exist on chromosome 9. Figure 1 The most significant SNP was at nucleotide 3516189 on chromosome 9, a T / C mutation, named g.3516189T>C. g.3516189T>C was significantly correlated with duck plasma cholinesterase abundance (P = 2.64 × 10⁻⁶). -60 Significant phenotypic differences were observed in plasma cholinesterase abundance among different genotypes within the population. The abundance of cholinesterase in ducks with the CC genotype was significantly higher than that in ducks with the TT genotype. Figure 2 The above indicates that this molecular marker significantly affects the abundance of cholinesterase in ducks, and can be used for marker-assisted selection to increase or decrease the abundance of cholinesterase in the plasma of this population, thereby accelerating the breeding process of this trait.

[0037] Determination of the polymorphism of duck SNP site g.3516189T>C;

[0038] (1) Primer design and synthesis

[0039] Based on the IASCAAS_PekinDuck_T2T sequence of the duck reference genome, the following primers were designed and synthesized:

[0040] U (upstream primer): 5'- GCCCTGCTCTTTTGTACTGC-3' (SEQ ID No. 2);

[0041] D (downstream primer): 5'-TGGCTTCGTGTCACATTGGA-3' (SEQ ID No. 3).

[0042] Primer amplification sequences of SEQ ID No. 2 and SEQ ID No. 3 SEQ ID No.1 is as follows: GCCCTGCTATCATACCGTATTTCTTTCTCATTTTTATTTGTCTCATTAAAATGCTAACTTATATAATTGCCTCATTCCTATAAATTTGCAAGGCAATAAATGGAATTAGAAAGCTTTTGCTCACATGCCTCAGAAACACTTAAATTATATAAAAATATACGCACATCAGACATGCCTCTCATGCACCTAAAGTGATATGTAGCCACATYCAATTAAT GCACTGTAAGCTGCTAAAGCTCCAAAATGTAGTAAAAATGCAGAGCACAAAGGAAAAACAAAGCAGCCTCTTTAAAAAGCTGTGCATATCATTGGTGAGGGCTGGTTTGCATTAGTGCCTTTCAGTTCTTTGACTGATTTGTTTCTTAGGTGTAACAGCTGCCTACAGGTTGTACCTACATAAGCGAATCCAATGTGACACGAAGCCAGAACATTGCAGTAGGTTGCGTCTTGTACTAAT

[0043] (2) PCR amplification

[0044] Using genomic DNA from blood samples collected at 40 days of age as a template, PCR amplification was performed using U and D primers to obtain amplification products, which were named products 1, 2, and 3, respectively. These products differed by only one base. Figure 3 ).

[0045] PCR amplification system: 100ng genomic DNA, 10µL Green Taq Mix, 20μm each of forward and reverse primers, and ddH2O to bring the system to 20µL.

[0046] PCR amplification program: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 62℃ annealing for 15 seconds, 72℃ extension for 60 seconds, for a total of 35 cycles; final extension at 72℃ for 5 minutes.

[0047] Based on the type of the PCR amplification product at position 224 from the 5' end, the product genotypes are classified into CC, CT, and TT.

[0048] Example 1: Identifying the genotype of individual ducks and predicting their plasma cholinesterase abundance

[0049] Sample collection: 36 Sino-Singapore white-feathered meat ducks (14 days old, not yet slaughtered) were selected for testing. 2 mL of venous blood was collected from the wings of each duck using EDTA anticoagulant blood collection tubes and stored at -20℃ for later use.

[0050] Genomic DNA was extracted, and qualified DNA was amplified by PCR.

[0051] Using the extracted genomic DNA from 36 ducks as templates, PCR amplification was performed using the primer pairs (SEQ ID No. 2 and SEQ ID No. 3) of the present invention.

[0052] The PCR amplification products were sent to Sanger sequencing at Sangon Biotech (Shanghai) Co., Ltd. The sequencing results were analyzed using Chromas software, with a focus on the type of the 224th base from the 5' end of the amplification product to determine the genotype of each duck.

[0053] Numbers 1-12: Position 224 is T → genotype TT;

[0054] Numbers 13-24: Position 224 is C / T → genotype CT;

[0055] Numbers 25-36: Position 224 is C → genotype CC.

[0056] Based on genotype prediction, the plasma cholinesterase abundance in CC and CT genotype ducks was higher than that in TT genotype ducks. After 36 ducks reached 42 days of age, 5 mL of wing vein blood was collected from each duck, and plasma was obtained by centrifugation at 3000 rpm for 15 min. Plasma cholinesterase abundance was measured using a Mike cholinesterase abundance assay kit and a Hitachi 7080 biochemical analyzer.

[0057] Numbers 1-12: The actual average cholinesterase abundance is 2404.75 U / L;

[0058] Numbers 13-24: The actual average cholinesterase abundance is 2730.42 U / L;

[0059] Numbers 25-36: The actual average cholinesterase abundance is 3216.25 U / L.

[0060] Based on actual plasma cholinesterase abundance, it is known that the plasma cholinesterase abundance in CC and CT genotype ducks is higher than that in TT genotype ducks. Figure 4 The above verification results are consistent with the predictions.

[0061] The verification results show that the method of the present invention can accurately predict the abundance of cholinesterase in duck plasma.

[0062] Example 2: Using cholinesterase abundance-related molecular markers to assist in the selection of slaughter traits

[0063] Samples were collected from 1,980 Sino-Singapore white-feathered meat ducks under the same conditions. Blood was collected at 40 days of age, plasma was obtained by centrifugation and cholinesterase abundance was detected, and blood DNA was extracted. PCR amplification was performed using U and D primers to obtain amplified products, which were then sent to the company for sequencing to determine the genotype of each duck.

[0064] Number 1-422: Position 224 is T → genotype TT;

[0065] Number 423-1183: The 224th position is C / T → genotype CT;

[0066] Number 1184-1980: Position 224 is C → genotype CC.

[0067] All animals were slaughtered at 42 days old, and the slaughtering process was strictly carried out in accordance with NY / T 3741-2020 "Operating Procedures for Livestock and Poultry Slaughtering (Duck)" and the phenotypes of each animal were recorded.

[0068] Analysis of the correlation between cholinesterase abundance and various slaughter phenotypes ( Figure 5 The study found a strong negative correlation between feed intake and cholinesterase abundance (-0.654); breast skin weight, breast and leg muscle weight, wing root weight, neck and breast skin weight percentage, breast and leg weight percentage, breast and muscle weight with skin, neck skin weight, 42-day body weight, wing weight, leg weight, breast skin weight percentage, breast muscle weight, chest width, feed conversion ratio, neck skin weight percentage, carcass weight, semi-eviscerated weight, and breast muscle percentage were moderately negatively correlated with cholinesterase abundance (-0.591 ~ -0.405); abdominal fat weight, wing segment weight, abdominal fat percentage, pectoralis minor muscle weight, heart weight, skeleton weight, leg weight percentage, wing root weight percentage, gizzard weight, neck weight, chest circumference, intestine weight, head weight, intestine weight percentage, wing weight percentage, 14-day body weight, leg weight, liver weight, pectoralis minor muscle percentage, and heart weight percentage were weakly negatively correlated with cholinesterase abundance (-0.357 ~ -0.045); head weight percentage, leg weight percentage, neck weight percentage, wing segment weight percentage, bone weight percentage, liver weight percentage, keel length, dressing percentage, gizzard weight percentage, semi-eviscerated weight percentage and cholinesterase abundance were weakly positively correlated (0.071-0.389).

[0069] There were significant differences between CC and TT genotype ducks in traits such as feed intake, wing root weight, wing weight, breast muscle weight with skin, leg weight, breast skin weight, breast skin weight percentage, breast and leg weight percentage, and feed conversion ratio (P < 0.05). Figure 6 ).

[0070] By using the molecular marker-assisted selection of this invention, traits such as feed intake, wing root weight, wing weight, breast muscle weight with skin, leg weight, breast skin weight, breast skin weight ratio, breast and leg weight ratio, and feed conversion ratio can be improved.

[0071] It should be noted that, in this document, the terms “comprising,” “including,” or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0072] This article uses specific examples to illustrate the principles and implementation methods of the present invention. The above examples are only for the purpose of helping to understand the method and core ideas of the present invention. The above descriptions are only preferred embodiments of the present invention. It should be noted that due to the limitations of textual expression, while there are objectively infinite specific structures, those skilled in the art can make several improvements, modifications, or changes without departing from the principles of the present invention, and can also combine the above technical features in an appropriate manner. These improvements, modifications, changes, or combinations, or the direct application of the inventive concept and technical solution to other situations without modification, should all be considered within the scope of protection of the present invention.

Claims

1. A method for identifying the abundance of cholinesterase in duck plasma and the use of its related molecular marker, characterized in that, The primer pair was used to amplify a DNA fragment containing the polymorphic site at position 3516189 from the 5' end on chromosome 9 of the duck reference genome IASCAAS_PekinDuck_T2T; the duck reference genome IASCAAS_PekinDuck_T2T is a duck reference genome sequence in the GenBank database; the duck is the Sino-New Zealand white-feathered meat duck.

2. The method for identifying the abundance of cholinesterase in duck plasma according to claim 1 and the application of the related molecular marker, characterized in that, The primer pair consists of the DNA molecule shown in SEQ ID No. 2 and the DNA molecule shown in SEQ ID No.

3.

3. The method for identifying the abundance of cholinesterase in duck plasma according to claim 2, and the application of the related molecular marker thereof, characterized in that, The abundance of plasma cholinesterase in CC and CT genotype ducks was significantly higher than that in TT genotype ducks (P < 0.05). The ducks with the TT genotype are those whose bases on chromosome 9 of the duck reference genome IASCAAS_PekinDuck_T2T are T, located at position 3516189 from the 5' end. The ducks with the CT genotype are those whose bases at position 3516189 from the 5' end of chromosome 9 of the duck reference genome IASCAAS_PekinDuck_T2T are C and T. The CC genotype ducks are those whose base position 3516189 from the 5' end on chromosome 9 of the duck reference genome IASCAAS_PekinDuck_T2T is C. The duck reference genome IASCAAS_PekinDuck_T2T is a duck reference genome sequence from the GenBank database; the duck is the Sino-New Zealand white-feathered meat duck.

4. The method for identifying the abundance of cholinesterase in duck plasma according to claim 1 and the application of the related molecular marker thereof, characterized in that, The method for determining the TT, CT, or CC genotypes is as follows: Using duck genomic DNA as a template, PCR amplification is performed using the primer pair described in claim 1 or 2 to obtain PCR amplification products; if the base at position 224 from the 5' end of the PCR amplification product is T, then the duck's genotype is TT; if the base at position 224 from the 5' end of the PCR amplification product is C and T, then the duck's genotype is CT; if the base at position 224 from the 5' end of the PCR amplification product is C, then the duck's genotype is CC.

5. The method for identifying the abundance of cholinesterase in duck plasma according to claim 4, and the application of the related molecular marker thereof, characterized in that, This method involves selective breeding of ducks with the CC genotype; The CC genotype ducks are those whose base position 3516189 from the 5' end on chromosome 9 of the duck reference genome IASCAAS_PekinDuck_T2T is C. The duck reference genome IASCAAS_PekinDuck_T2T is a duck reference genome sequence from the GenBank database; the duck is the Sino-New Zealand white-feathered meat duck.

6. The method for identifying the abundance of cholinesterase in duck plasma according to claim 4, and the application of the related molecular marker thereof, characterized in that, The method for determining the CC genotype is as follows: using duck genomic DNA as a template, PCR amplification is performed using the primer pair described in claim 1 or 2 as primers to obtain PCR amplification products; if the base at position 224 from the 5' end of the PCR amplification product is C, then the genotype of the duck is CC genotype.

7. The method for identifying the abundance of cholinesterase in duck plasma according to claim 6 and the application of the related molecular marker, characterized in that, This method involves selective breeding of ducks with the TT genotype; The ducks with the TT genotype are those whose bases on chromosome 9 of the duck reference genome IASCAAS_PekinDuck_T2T are T, located at position 3516189 from the 5' end. The duck reference genome IASCAAS_PekinDuck_T2T is a duck reference genome sequence from the GenBank database; the duck is the Sino-New Zealand white-feathered meat duck.

8. The method for identifying the abundance of cholinesterase in duck plasma according to claim 6 and the application of related molecular markers, characterized in that, The method for determining the TT genotype is as follows: using duck genomic DNA as a template, PCR amplification is performed using the primer pair described in claim 1 or 2 as primers to obtain PCR amplification products; if the base at position 224 from the 5' end of the PCR amplification product is T, then the genotype of the duck is the TT genotype.

9. An application of a related molecular marker, characterized in that: Applied to the method for identifying the abundance of cholinesterase in duck plasma as described in any one of claims 1-8.

Images