Alkaline lipase mutant and application thereof

Abstract

The invention relates to the technical field of genetic engineering and protein engineering modification, in particular to an alkaline lipase mutant and application thereof in pulping and papermaking. Compared with wild alkaline lipase, after the mutant containing T112S single-point mutation is treated for 3 minutes at 75 DEG C, the enzyme activity residual rate reaches up to 63.61%, the heat resistance is remarkably enhanced, and wide application of the mutant in the industrial fields of pulping, papermaking and the like is facilitated.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and protein engineering, specifically to an alkaline lipase mutant and its applications. Background Technology

[0002] Lipases (EC 3.1.1.3) are a class of hydrolases that catalyze the hydrolysis of triglycerides to produce glycerol and fatty acids. Based on their optimal pH range, lipases can be classified into acidic, neutral, and alkaline lipases. Alkaline lipases typically refer to those exhibiting high catalytic activity and stability within their optimal pH range of 8.0-11.0. Due to their unique alkalinity adaptability and substrate specificity, alkaline lipases play an irreplaceable role in industrial biocatalysis and are widely used in various industries such as oil processing, detergents, textiles, papermaking, and food.

[0003] In the pulp and paper industry, alkaline lipases are mainly used for resin obstacle control and waste paper deinking. Resins (mainly triglycerides and wax esters) in wood raw materials easily form sticky deposits during alkaline pulping, severely affecting paper quality and production efficiency. Alkaline lipases can hydrolyze these resins into water-soluble glycerol and fatty acids, thus effectively controlling resin obstacles. In waste paper recycling, alkaline lipases can work synergistically with traditional deinking agents to efficiently hydrolyze vegetable oil-based binders in ink carriers, promoting ink-fiber separation and improving the brightness and cleanliness of recycled pulp. However, the main problems in this application are: the papermaking process is complex, and the pulp contains various inhibitors such as surfactants, metal ions, and high concentrations of inorganic salts, which strongly interfere with the activity and stability of alkaline lipases; at the same time, existing enzyme preparations suffer rapid activity loss in alkaline pulping environments at higher temperatures (>70°C), making it difficult to meet the requirements of fast and efficient modern paper machine production processes.

[0004] Although alkaline lipases have shown great application potential in various industrial sectors, their insufficient activity and stability under harsh industrial environments (especially high temperature, strong alkali, and complex inhibitor coexistence systems) have become a key common technical obstacle limiting their wider and more economical application. Therefore, developing a novel alkaline lipase or its efficient application process with excellent stability and strong environmental tolerance is of urgent practical significance for improving the technological level of papermaking and related industries, reducing production costs, and achieving green and sustainable development. Summary of the Invention

[0005] This invention addresses the problems of existing technologies by providing a high-temperature resistant alkaline lipase mutant and its applications. The mutant exhibits significantly improved heat resistance compared to the wild type, which is beneficial for its widespread application in industrial fields such as pulp and paper making.

[0006] One aspect of this invention relates to an alkaline lipase mutant, which is obtained by mutating the 112th amino acid of the alkaline lipase with the amino acid sequence SEQ ID NO:1 to Ser.

[0007] The present invention also relates to DNA molecules encoding the above-mentioned alkaline lipase mutant.

[0008] The present invention also relates to recombinant expression plasmids comprising the above-described DNA molecules.

[0009] The present invention also relates to a host cell comprising the above-described recombinant expression plasmid.

[0010] When the above plasmids were transferred into host cells, the heat resistance of the recombinant alkaline lipase mutant was significantly improved.

[0011] In some embodiments of the present invention, the host cell is Pichia pastoris (Pichia pastoris). Pichia pastoris ).

[0012] The present invention also provides the application of the above-mentioned alkaline lipase mutant in pulping and papermaking.

[0013] Based on wild-type alkaline lipase, this invention provides a mutant containing a single-point mutation of T112S. After treatment at 75°C for 3 minutes, the enzyme activity residual rate is as high as 63.61%, and the heat resistance is significantly enhanced. It can maintain high-efficiency catalytic activity in the high-temperature alkaline environment of industries such as pulp and paper making, which is beneficial to reducing industrial energy consumption and costs, and has broad application prospects. Detailed Implementation

[0014] This invention discloses an alkaline lipase mutant, its preparation method and application, the DNA molecule encoding the alkaline lipase mutant, the vector, and the host cell. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired result. The method and application of this invention have been described through preferred embodiments. Those skilled in the art can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0015] This invention utilizes conventional techniques and methods used in the fields of genetic engineering and molecular biology, such as those described in *MOLECULAR CLONING: A LABORATORY MANUAL, 3rd Ed.* (Sambrook, 2001) and *CURRENTPROTOCOLS IN MOLECULAR BIOLOGY* (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can utilize other conventional methods, experimental protocols, and reagents based on the technical solutions described in this invention, without being limited to the specific embodiments of this invention.

[0016] For example, the following experimental materials and reagents may be used in this invention: Strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, vector pPIC9k, Amp, and G418 were purchased from Invitrogen.

[0017] Enzymes and kits: PCR enzymes and ligases were purchased from Takara, restriction endonucleases from Fermentas, plasmid extraction kits and gel purification and recovery kits from Omega, and GeneMorph II random mutagenesis kits from Beijing Bomais Biotechnology Co., Ltd.

[0018] Culture medium formulation: Escherichia coli culture medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0; Yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose; Yeast selection medium (MD medium): 2% peptone, 2% agarose; BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4 × 10⁻⁶ -5 1% Biotin, 1% Glycerin; BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4 × 10⁻⁶ -5 % Biotin, 0.5% Methanol; LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0; LB-AMP plates: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0.

[0019] The present invention will be further illustrated below with reference to the embodiments: Example 1: Construction of expression plasmid The bacteria derived from Burkholderia cepacia ( Burkholderia cepacia The wild-type alkaline lipase gene (amino acid sequence SEQ ID NO: 1, encoding nucleotide sequence SEQ ID NO: 2) of *Pichia pastoris* underwent codon optimization based on codon preference, with the addition of 6 bases GAATTC (EcoR I restriction site) before its start codon ATG and GCGGCCGC (Not I restriction site) after its stop codon TAA. The optimized nucleotide sequence was synthesized by Shanghai Jierui Biotechnology Co., Ltd.

[0020] The alkaline lipase gene was digested with restriction endonucleases EcoRI and Not I (Fermentas); simultaneously, plasmid pPIC9K was digested with the same restriction endonucleases. The digestion products were purified using a gel purification kit, and the two digestion products were ligated using T4 DNA ligase (Fermentas). The ligation products were transformed into DH5α *E. coli* (Invitrogen), and selection was performed using ampicillin. To ensure accuracy, several clones were sequenced (Invitrogen).

[0021] Plasmids were purified from correctly sequenced E. coli clones using a plasmid mini-preparation kit (Omega) to obtain expression plasmids.

[0022] Example 2 Screening of thermostable alkaline lipase mutants To further improve the heat resistance of wild-type alkaline lipase, the applicant conducted extensive mutation screening on the enzyme using directed evolution technology.

[0023] 1.1 Design of PCR primers PSL-F1 and PSL-R1: PSL-F1: GGC GAATTC ATGGCTTCCAGAGATGGTCA (The underlined part is the EcoRI restriction enzyme recognition site). PSL-R1: ATA GCGGCCGC TTAGGCACATCTAGCTGCTCT (The underlined part is the NotI restriction enzyme recognition site).

[0024] Using the wild-type alkaline lipase gene (SEQ ID NO: 2) as a template, PCR amplification was performed using the above primers with the GeneMorph II random mutagenesis PCR kit. The PCR product was recovered from the gel, digested with EcoRI and NotI, and ligated into the pET21a vector digested with the same enzymes. The ligation product was then transformed into Escherichia coli BL21(DE3), plated on LB-Amp plates, and incubated upside down at 37°C. After the transformants appeared, they were picked one by one into a 96-well plate with a toothpick. 150 μL of LB-Amp medium containing 0.1 mM IPTG was added to each well. The plate was incubated at 37°C and 220 rpm for about 6 h. After centrifugation and discarding the supernatant, the cells were resuspended in buffer and repeatedly freeze-thawed to break up the cell walls, obtaining E. coli cell lysate containing alkaline lipase.

[0025] 20 μL of lysis buffer was transferred to two new 96-well plates, one of which was incubated at 75 °C for 3 min. 80 μL of substrate solution (prepared fresh by slowly mixing solution A and solution B in a 1:9 ratio; solution A: accurately weigh 18 mg of p-nitrophenol palmitate and dissolve in 30 mL of isopropanol; solution B: 50 mmol / L phosphate buffer, pH 8.0) was added to each plate. After incubation at 37 °C for 10 min, 80 μL of anhydrous ethanol was added to terminate the reaction, and the absorbance was measured at 410 nm.

[0026] Experimental results showed that some mutations had no effect on the thermostability of wild-type alkaline lipase, while others even worsened its thermostability, which did not meet the requirements. Ultimately, the applicant screened a mutation site that could significantly improve the thermostability of wild-type alkaline lipase without affecting its original enzymatic properties: T112S.

[0027] Based on the above-mentioned wild-type alkaline lipase, this invention provides a mutant containing a single T112S mutation site.

[0028] Example 3: Expression of alkaline lipase mutant in Pichia pastoris 3.1 Expression plasmid construction Based on the codon preference of Pichia pastoris, the gene sequences of wild-type alkaline lipase and its mutants were optimized and synthesized by Shanghai Jereh Biotechnology Co., Ltd., with EcoRI and NotI restriction sites added at the 5' and 3' ends of the synthesized sequences, respectively.

[0029] Following the method described in Example 1, the gene sequences of the synthesized wild-type alkaline lipase and its mutants were digested with EcoRI and NotI, respectively, and then ligated with the pPIC-9K vector digested with the same enzymes overnight at 16°C. The ligation was then performed on E. coli DH5α, plated on LB-Amp plates, and incubated upside down at 37°C. After the transformants appeared, colony PCR was performed (reaction system: single clones picked from the template, rTaq DNA polymerase 0.5 μL, 10× Buffer 2.0 μL, dNTPs (2.5 mM) 2.0 μL, 5' AOX primer (10 mM): 0.5 μL, 3' AOX primer: 0.5 μL, ddH2O 14.5 μL, reaction program: 95°C pre-denaturation for 5 min, 30 cycles: 94°C for 30 sec, 55°C for 30 sec, 72°C for 2 min, 72°C for 10 min). The positive clone was verified, and the correct recombinant expression plasmid was obtained after sequencing.

[0030] 3.2 Construction of Pichia pastoris engineered strains 3.2.1 Preparation of competent yeast cells Pichia pastoris strain GS115 was activated on YPD plates and cultured at 30℃ for 48 h. Activated GS115 single clones were then inoculated into 6 mL of YPD liquid medium and cultured at 30℃ and 220 rpm for approximately 12 h. The culture was then transferred to Erlenmeyer flasks containing 30 mL of YPD liquid medium and cultured at 30℃ and 220 rpm for approximately 5 h. Cell density was measured using a UV spectrophotometer. Once the OD600 value was within the range of 1.1–1.3, 4 mL of cells were collected by centrifugation at 4℃ and 9000 rpm for 2 min and transferred to sterile EP tubes. The supernatant was gently discarded, and the remaining supernatant was blotted dry with sterile filter paper. The cells were resuspended in 1 mL of pre-cooled sterile water and centrifuged at 4℃ and 9000 rpm for 2 min. The supernatant was gently discarded, and the cells were washed once more with 1 mL of sterile water and centrifuged again at 4℃ and 9000 rpm for 2 min. Centrifuge at 9000 rpm for 2 min at 4°C, gently discard the supernatant, and resuspend the bacterial cells in 1 mL of pre-cooled sorbitol (1 mol / L); centrifuge at 9000 rpm for 2 min at 4°C, gently discard the supernatant, and gently resuspend the bacterial cells in 100-150 μL of pre-cooled sorbitol (1 mol / L).

[0031] 3.2.2 Conversion and Screening The recombinant expression plasmids constructed in 3.1 were linearized with Sac I. After purification and recovery of the linearized fragments, they were transformed into Pichia pastoris GS115 by electroporation. Recombinant Pichia pastoris strains were screened on MD plates, and multi-copy transformants were then screened on YPD plates (0.5 mg / mL-8 mg / mL) containing different concentrations of genimycin.

[0032] The obtained transformants were transferred to BMGY medium and cultured at 30°C and 250 rpm with shaking for 1 day; then transferred to BMMY medium and cultured at 30°C and 250 rpm with shaking; 0.5% methanol was added daily for 4 days to induce expression; the cells were removed by centrifugation at 9000 rpm for 10 min, yielding fermentation supernatants containing wild-type alkaline lipase and its single-point mutant, respectively. The lipase activity in the fermentation supernatants was detected according to the following method.

[0033] Methods for determining lipase activity (1) Definition of lipase activity unit One unit of enzyme activity is defined as the amount of 1 g of solid enzyme (or 1 mL of liquid enzyme) that hydrolyzes the substrate to produce 1 μmol of titratable fatty acid in 1 minute under certain temperature and pH conditions. This is expressed as U / g (or U / mL).

[0034] (2) Method for determining lipase activity Take two 100mL Erlenmeyer flasks. Add 4.00mL of substrate solution and 5.00mL of phosphate buffer to the blank flask (A) and the sample flask (B), respectively. Then add 15.00mL of 95% ethanol to flask A and preheat in a water bath at 40℃±0.2℃ for 5min. Then add 1.00mL of the enzyme solution to be tested to each of flasks A and B, mix well immediately, and start timing. After reacting for 15min, immediately add 15.00mL of 95% ethanol to flask B to stop the reaction and remove the flask. Add two drops of phenolphthalein indicator to both the blank and sample solutions and titrate with sodium hydroxide standard solution until a faint red color appears and remains for 30s without fading. Record the volume of sodium hydroxide standard solution consumed.

[0035] The formula for calculating lipase activity is: X1 = [(V1–V2)×C×50×n] / 0.05×1 / 15.

[0036] Where: X1——enzyme activity of the sample, U / g (or U / mL); V1—Volume of sodium hydroxide standard solution consumed during sample titration, in mL; V2—Volume of sodium hydroxide standard solution consumed during blank titration, in mL; c — Concentration of the sodium hydroxide standard solution, in mol / L; 1.00 mL of 50-0.05 mol / L sodium hydroxide solution is equivalent to 50 μmol of fatty acid; n—Enzyme solution dilution factor; 0.05 — Conversion factor for sodium hydroxide standard solution concentration; 1 / 15 — Reaction time 15 min, calculated as 1 min; The experimental results are expressed to the nearest integer.

[0037] The absolute difference between two independent measurements obtained under repeated conditions shall not exceed 2% of the arithmetic mean.

[0038] (3) Results of enzyme activity assay Enzyme activity was detected using the above method. The results showed that the enzyme activity of the fermentation supernatant of the recombinant Pichia pastoris strain expressing wild-type alkaline lipase and its mutant was 200-240 U / mL.

[0039] Example 4: Heat resistance analysis of alkaline lipase mutants The fermentation supernatant of the recombinant Pichia pastoris strain expressing wild-type alkaline lipase and its mutants was diluted to approximately 20 U / mL with phosphate buffer at pH 8.0. After treatment at 75℃ for 3 min, the residual enzyme activity was measured. The enzyme activity of the untreated sample was taken as 100%, and the residual enzyme activity rate was calculated. The specific results are shown in Table 1.

[0040] Table 1. Heat resistance analysis of alkaline lipase mutants alkaline lipase Residual enzyme activity after treatment at 75℃ for 3 minutes wild type 36.06% T112S single-point mutant 63.61% As shown in Table 1, the T112S single-point mutant provided by this invention, after being treated at 75°C for 3 minutes, exhibited an enzyme activity residual rate as high as 63.61%, and its heat resistance was significantly higher than that of wild-type alkaline lipase, achieving unexpected technical results.

[0041] In summary, the alkaline lipase mutant provided by this invention has strong heat resistance and can maintain high catalytic activity in the high-temperature alkaline environment of industries such as pulp and paper making, which is conducive to reducing industrial energy consumption and costs, and provides a more stable and reliable technical solution for green biomass processing.

Claims

1. An alkaline lipase mutant, characterized in that, The mutant is obtained by mutating the 112th amino acid of alkaline lipase with the amino acid sequence SEQ ID NO:1 from Thr to Ser.

2. A DNA molecule encoding the alkaline lipase mutant of claim 1.

3. A recombinant expression plasmid comprising the DNA molecule of claim 2.

4. A host cell comprising the recombinant expression plasmid of claim 3.

5. The host cell as described in claim 4, characterized in that, The host cell is Pichia pastoris ( Pichia pastoris ).

6. The application of the alkaline lipase mutant of claim 1 in pulping and papermaking.