Application of soybean GmSR34 gene in regulation and control of soybean salt tolerance

Abstract

The invention discloses an application of a soybean GmSR34 gene in regulation and control of soybean salt tolerance. The soybean GmSR34 gene is a GmSR34-1 gene with a nucleotide sequence as shown in SEQ ID NO: 1 and / or a GmSR34-2 gene with a nucleotide sequence as shown in SEQ ID NO: 2. According to the present invention, the GmSR34-1 gene and / or the GmSR34-2 gene of the soybean plant are / is knocked out, such that the salt tolerance of the obtained mutant strain is significantly higher than the salt tolerance of the wild soybean plant, such that the GmSR34 gene negatively regulates the salt tolerance of the soybean; the discovery of new functions of the soybean GmSR34 gene provides new gene targets and resources for genetic breeding of salt-tolerant soybean varieties.

Description

Technical Field

[0001] This invention belongs to the field of crop genetics and breeding technology. Specifically, this invention relates to the application of the soybean GmSR34 gene in regulating soybean salt tolerance. Background Technology

[0002] Salt stress can reduce soybean yield by more than 30%. Currently, research on soybean salt tolerance mechanisms has shifted from analyzing single physiological indicators to elucidating multi-dimensional molecular mechanisms such as osmotic regulation, antioxidant regulation, hormone regulation, epigenetic regulation, microbial interaction, and ion homeostasis regulation.

[0003] The CONSTANS-like 1a (GmCOL1a) gene promotes proline synthase gene expression by binding to the Δ1-pyrroline-5-carboxylic acid synthase GmP5CS promoter, accumulating proline and mitigating oxidative damage caused by salt stress. The NF-Y family transcription factor GmNF-YC14 interacts with GmNF-YB2 and GmNF-YA16 in soybean plants to form a complete and active NF-Y transcriptional complex. This complex regulates the ABA signaling pathway mediated by the ABA receptor PYRABACTIN RESISTANCE 1 (PYR1) / PYR1-like (PYL) gene, thereby enhancing plant salt tolerance. GmNFYA competitively binds to the flowering regulator FVE with the histone deacetylase HDA13, releasing HDA13. This helps maintain the acetylation state of nearby histone H3K9, activating downstream salt-tolerant gene expression and improving soybean salt tolerance. The plant growth-promoting rhizosphere bacterium Streptomyces lasalocidi JCM 3373T regulates root architecture by secreting indole-3-carboxaldehyde, thereby improving the salt tolerance of soybeans.

[0004] Soybean salt tolerance is the result of the synergistic effects of multiple genes and pathways. A deeper understanding of these mechanisms will provide important theoretical basis for soybean salt-tolerant breeding. High Cl... - Chloride concentration limits soybean growth and yield; the chloride channel protein GmCLC1 may be a chloride / proton reverse transporter in soybeans. The peptide transporter family protein GmNPF7.5 mediates chloride / proton reversal in soybeans. - Absorption affects salt tolerance; its phosphorylation modification can specifically inhibit Cl. - Transport activity, reducing Cl under salt stress conditions - Accumulation increases salt tolerance. Na + / H + The antitransporter GmNHX1 is located in the vacuolar membrane and can transport Na+. + The cytoplasm is separated from the vacuoles, thereby improving the salt tolerance of soybeans. Na + / H +The antitransporter GmNHX2 is located on the plasma membrane or organelle membrane and can transport Na+. + They are released from the cytoplasm into the extracellular space or separated within the vacuoles. Cations / H + Exchange proteins GmCAX1 and GmCHX1 / GmSALT3 / GmNcl regulate Na + and K + The accumulation of these substances enhances the salt tolerance of soybeans. The cation diffusion promoting protein GmCDF regulates Na+... + and K + The dynamic balance of these factors negatively regulates soybean salt tolerance. Soybean high-affinity potassium transporters GmHKT1 and GmHKT1;4 regulate Na+ ion transport. + and K + Accumulation of potassium enhances salt tolerance. The potassium ion transporter GmAKT1 regulates potassium levels. + Absorption and maintenance of Na + and K + The dynamic balance of salt stress enhances the salt tolerance of soybeans. Furthermore, the CBL-CIPK pathway primarily activates RbohF via calmodulin CBL and its interacting protein family CIPK, stimulating the production of reactive oxygen species (ROS). Therefore, soybeans can sense salt stress signals through potential receptor proteins and transmit them into the cell. These signals are then amplified stepwise through phosphorylation and dephosphorylation, enhancing the activity of related transcription factors and promoting the binding of transcription factors (DREB3a, DREB3b, ERD15b, and HSFB2b, etc.) to their corresponding cis-elements, thereby regulating gene expression at the transcriptional level.

[0005] The response of the soybean GmSR34 gene to salt stress has not yet been reported. Summary of the Invention

[0006] Based on this, the purpose of this invention is to provide the application of the soybean GmSR34 gene in regulating soybean salt tolerance.

[0007] The specific technical solutions for achieving the above-mentioned objectives are as follows.

[0008] In a first aspect, the present invention provides the application of the soybean GmSR34 gene in regulating soybean salt tolerance or in the genetic breeding of salt-tolerant soybean varieties, wherein the soybean GmSR34 gene is the GmSR34-1 gene with the nucleotide sequence shown in SEQ ID NO:1 and / or the GmSR34-2 gene with the nucleotide sequence shown in SEQ ID NO:2.

[0009] In a second aspect, the present invention provides the application of a mutant of the soybean GmSR34 gene in improving the salt tolerance of soybeans or in the genetic breeding of salt-tolerant soybean varieties, wherein the nucleotide sequence of the mutant is shown in SEQ ID NO:5 and / or SEQ ID NO:7.

[0010] In a third aspect, the present invention provides the application of a soybean GmSR34 gene knockout vector in improving soybean salt tolerance or in the genetic breeding of salt-tolerant soybean varieties, wherein the soybean GmSR34 gene is the GmSR34-1 gene with a nucleotide sequence as shown in SEQ ID NO:1 and the GmSR34-2 gene with a nucleotide sequence as shown in SEQ ID NO:2.

[0011] In a fourth aspect, the present invention provides the application of engineered bacteria transforming a soybean GmSR34 gene knockout vector in improving soybean salt tolerance or in the genetic breeding of salt-tolerant soybean varieties, wherein the soybean GmSR34 gene is the GmSR34-1 gene with a nucleotide sequence as shown in SEQ ID NO:1 and / or the GmSR34-2 gene with a nucleotide sequence as shown in SEQ ID NO:2.

[0012] A fifth aspect of the present invention provides a method for improving the salt tolerance of soybeans, comprising the following steps: knocking out the soybean GmSR34 gene in soybean plants, wherein the soybean GmSR34 gene is the GmSR34-1 gene with the nucleotide sequence as shown in SEQ ID NO:1 and / or the GmSR34-2 gene with the nucleotide sequence as shown in SEQ ID NO:2.

[0013] The inventors of this invention discovered that by knocking out the GmSR34-1 gene and / or its homolog GmSR34-2 gene in the Huachun 6 (HC6) soybean variety, resulting in partial base deletion of the GmSR34-1 and / or GmSR34-2 genes and loss of GmSR34 function, the resulting single mutant lines gmsr34-1 and gmsr34-2, as well as the double mutant line gmsr34-1 / gmsr34-2, showed significantly higher salt tolerance than wild soybean plants. Therefore, the GmSR34 gene negatively regulates the salt tolerance of soybeans. This discovery of the novel function of the soybean GmSR34 gene provides new gene targets and resources for the genetic breeding of salt-tolerant soybean varieties. Attached Figure Description

[0014] Figure 1 This is the identification result of colony PCR in Example 1 of the present invention.

[0015] Figure 2 This is a schematic diagram of the CRISRP vector gmSR34-JRH0640 constructed in Embodiment 1 of the present invention.

[0016] Figure 3 The diagram shows the mutant sites of gmsr34-1 and gmsr34-2 in Example 2 of this invention. Black blocks represent exons, black lines represent introns, and red vertical lines represent CRISRP target sites. The sequences below the diagram are those of wild type and mutant.

[0017] Figure 4 The results show the salt phenotypes of HC6, gmsr34-1, gmsr34-2, and gmsr34-1 / gmsr34-2 in Example 3 of this invention.

[0018] Figure 5 The survival rates of HC6, gmsr34-1, gmsr34-2, and gmsr34-1 / gmsr34-2 after 21 days of salt stress treatment in Example 3 of this invention are statistical results.

[0019] Figure 6 The Na content of HC6, gmsr34-1, gmsr34-2, and gmsr34-1 / gmsr34-2 after 21 days of salt stress treatment in Example 3 of this invention. + / K + result. Detailed Implementation

[0020] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0021] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used in this invention includes any and all combinations of one or more of the associated listed items.

[0022] Unless otherwise specified, all examples were performed under standard experimental conditions, such as those described in Sambrook et al., Molecular Cloning: a Laboratory Manual (Sambrook J & Russell DW, 2013), or as recommended by the manufacturer.

[0023] In some embodiments of the present invention, the application of the soybean GmSR34 gene in regulating soybean salt tolerance is disclosed, wherein the soybean GmSR34 gene is the GmSR34-1 gene with the nucleotide sequence as shown in SEQ ID NO:1 and / or the GmSR34-2 gene with the nucleotide sequence as shown in SEQ ID NO:2.

[0024] In other embodiments of the present invention, the application of the soybean GmSR34 gene in the genetic breeding of salt-tolerant soybean varieties is disclosed, wherein the soybean GmSR34 gene is the GmSR34-1 gene with the nucleotide sequence as shown in SEQ ID NO:1 and / or the GmSR34-2 gene with the nucleotide sequence as shown in SEQ ID NO:2.

[0025] In other embodiments of the present invention, the application of mutants of the soybean GmSR34 gene in improving the salt tolerance of soybeans is disclosed, the nucleotide sequences of which are shown in SEQ ID NO:5 and / or SEQ ID NO:7.

[0026] In other embodiments of the present invention, the application of a soybean GmSR34 gene knockout vector in improving soybean salt tolerance is disclosed, wherein the soybean GmSR34 gene is the GmSR34-1 gene with a nucleotide sequence as shown in SEQ ID NO:1 and / or the GmSR34-2 gene with a nucleotide sequence as shown in SEQ ID NO:2.

[0027] In one embodiment, the soybean GmSR34 gene knockout vector is constructed by the following method:

[0028] S1. Using the P485 plasmid containing the core sequence shown in SEQ ID NO:13 as a template, the first round of PCR reaction was carried out using SEQ ID NO:9 and SEQ ID NO:10, SEQ ID NO:11 and SEQ ID NO:12 as primers, respectively;

[0029] S2. Using the product of the first round of PCR reaction as a template, and SEQ ID NO:11 and SEQ ID NO:10 as primers, perform the second round of PCR reaction;

[0030] S3. The product of the second round of PCR reaction is ligated to the enzyme-digested CRISPR vector via homologous recombination to obtain the final product.

[0031] In one embodiment, the CRISPR vector is vector JRH0640.

[0032] In other embodiments of the present invention, the application of a soybean GmSR34 gene knockout vector in the genetic breeding of salt-tolerant soybean varieties is disclosed, wherein the soybean GmSR34 gene is the GmSR34-1 gene with a nucleotide sequence as shown in SEQ ID NO:1 and / or the GmSR34-2 gene with a nucleotide sequence as shown in SEQ ID NO:2.

[0033] In other embodiments of the present invention, the application of engineered bacteria transforming soybean GmSR34 gene knockout vectors in improving soybean salt tolerance is disclosed, wherein the soybean GmSR34 gene is the GmSR34-1 gene with nucleotide sequence as shown in SEQ ID NO:1 and / or the GmSR34-2 gene with nucleotide sequence as shown in SEQ ID NO:2.

[0034] In some other embodiments of the present invention, a method for improving the salt tolerance of soybeans is disclosed, comprising the following steps: knocking out the soybean GmSR34 gene of soybean plants, wherein the soybean GmSR34 gene is the GmSR34-1 gene with the nucleotide sequence as shown in SEQ ID NO:1 and / or the GmSR34-2 gene with the nucleotide sequence as shown in SEQ ID NO:2.

[0035] In one embodiment, the knockout is achieved through the following steps: the engineered bacteria that transform the soybean GmSR34 gene knockout vector infect the soybean cotyledon nodes, followed by soybean tissue culture to obtain tissue culture seedlings, and then transgenic lines are obtained.

[0036] The soybean GmSR34 gene comprises two homologous genes, GmSR34-1 and GmSR34-2. GmSR34-1 is located on chromosome 3 (Chr03:41918551..41924367) in the soybean genome, and its CDS sequence is shown in SEQ ID NO:1. The amino acid sequence of the encoded protein is shown in SEQ ID NO:3. GmSR34-2 is located on chromosome 19 (Glyma.19G211100| Chr19:).

[0037] 46512163..46518049, its CDS sequence is shown in SEQ ID NO:2, and the amino acid sequence of the encoded protein is shown in SEQ ID NO:4. This invention utilizes CRISPR / Cas9 technology to directly edit the GmSR34 gene of soybean cotyledonary nodes. The edited GmSR34 mutant gmsr34-1 (nucleotide sequence shown in SEQ ID NO:5, mutated amino acid sequence shown in SEQ ID NO:6) has two bases deleted from 190-191 bp of the GmSR34-1 CDS, and gmsr34-2 (nucleotide sequence shown in SEQ ID NO:7, mutated amino acid sequence shown in SEQ ID NO:8) has two bases deleted from 192-193 bp of the GmSR34-2 CDS. Figure 3 ). gmsr34-1 / gmsr34-2 have a 2-base deletion at 190-191 bp in GmSR34-1 CDS and a 2-base deletion at 192-193 bp in GmSR34-2 CDS.

[0038] The specific wild-type GmSR34 gene and the edited gmsr34-1 and gmsr34-2 sequences are as follows:

[0039] GmSR34-1(>G.max Wm82.a2.v1|Glyma.03G214400.1 CDS,SEQ ID NO:1)ATGAGTAGACGCTCGAGCAGAACTGTCTACGTTGGGAATCTACCTGGTGATATCCGTGAAAGAGAAGTTGAAGATTTGTTTCTGAAGTATGGACACATAACACACATTGACCTAAAGGTTCCCCCAAGACCACCTGGTTATGCATTTGTAGAGTTTGAAGATGCTCAAGATGCTGAGGATGCAATTCGTGGTCGTGATGGCTATGATTTTGATGGGCACCGGTTACGGGTGGAGCCTGCCCATGGTGGACGTGGTCATTCATCCTCAAGAGATCGATACAATAGTCACAGCAATGGCCGAGGTGGACGTGGGGTGTCTAGGCGCTCTGAATATCGTGTTCTAGTCTCTGGATTGCCCTCTTCGGCATCCTGGCAGGATCTTAAGGATCACATGCGTAAGGCAGGGGATGTTTGTTTTTCTCAAGTTTTTCATGATGGAAGGGGTACTACCGGTATTGTGGATTACACAAATTATGATGATATGAAATATGCTATCAAGAAGCTTGATGACTCTGAGTTCCGGAATGCATTTTCCAAGGGATATGTTCGGGTGAGAGAATATGATTCAAGGCGGGATTCCTCTAGAAGTCCTAGTCGTGGCCCATCTCATTCTAGAGGAAGGAGCTATAGCCGCAGTCGTAGCCGTAGCCGTAGTTACAGTCGGGACCGGAGCCAAAGCAAATCTCCAAAGGGTAAGTCTTCACAGCGTTCACCTGCTAAATCTCCATCAAGATCTCCCTCTCGTTCAAGATCAAGGTCCCGATCGTTATCAGGATATGGAAACTTGCAGCGTACTGGAAATTGGAAATTAGGATCTTGGTGGGATTTGGTTCAATTGTCTGCAACTCATTTTGTTGTGGAGATCACGGTCCAGGTCCAGGTCCCCATTGCCTCCGCG TAA

[0040] GmSR34-1(>G.max Wm82.a2.v1|Glyma.03G214400.1 Protein,SEQ ID NO:3)

[0041] MSRRSSRTVYVGNLPGDIREREVEDLFLKYGHITHIDLKVPPRPPGYAFVEFEDAQDAEDAIRGRDGYDFDGHRLRVEPAHGGRGHSSSRDRYNSHSNGRGGRGVSRRSEYRVLVSGLPSSASWQDLKDHMRKAGDVCFSQVFHDGRGTTGIVDYTNYDDMKYAIKKLDDSEFRNAFSKGYVRVREYDSRRDSSRSPSRGPSHSRGRSYSRSRSRSRSYSRDRSQSKSPKGKSSQRSPAKSPSRSPSRSRSRSRSLSGYGNLQRTGNWKLGSWWDLVQLSATHFVVEITVQVQVPIASA*

[0042] GmSR34-2(>G.max Wm82.a2.v1|Glyma.19G211100.1 CDS,SEQ ID NO:2)

[0043] ATGAGTAGACGCTCGAGCAGAACTGTCTACGTTGGGAATCTACCCGGTGATATCCGTGAAAGAGAAGTTGAAGATTTGTTTCTGAAGTACGGACACATAACACACATCGACCTAAAGGTTCCCCCAAGACCACCTGGTTATGCATTTGTAGAGTTTGAAGATGCTCAAGATGCTGAGGATGCAATTCGTGGTCGTGATGGCTATGATTTTGATGGCCACCGGTTACGGGTGGAGCCTGCCCATGGTGGGCGTGGTCATTCATCCTCAAAAGATCGGCACAATAGTCACAGCAATGGCCGAGGTGGACGTGGGGTATCTAGGCGCTCTGAATATCGTGTTCTAGTCACTGGATTGCCCTCTTCGGCATCCTGGCAGGATCTTAAGGATCACATGCGCAAGGCAGGGGATGTTTGCTTTTCTCAAGTTTTTCATGATGGAAGGGGTACTACCGGTATTGTGGATTACACAAATTATGATGATATGAAATATGCTATTAAGAAGCTTGATGACTCTGAGTTCCGGAATGCATTTTCCAAGGGATATGTTCGGGTGAGGGAATATGATTCAAGGCGGGATTCTTCTAGAAGTCCTAGTCATGGCCCATCTCATTCTAGAGGAAGGAGCTATAGCCGCAGTCGTAGCCGTAGCCATAGTTACAGTCGGGACCGGAGCCAAAGCAAATCTCCAAAAGGAAAGTCTTCACAGCGTTCACCTGCTAAATCTCCAAAAGGAAAGTCTTCACAGCGTTCACCTGCTAAATCTCCATCAAGATCTCCCTCTCGTTCTCGCTCAAGGTCAAGGTCCCGTTCGTTATCAGGATATGGAAACTTGCAGCATACTGGAAATTGGAAATTAGGATCTTGGTGGGATTTGGTTCAATTGTCTGCAACTCATTTTGTTGTGGAGATTGGGAACCAAGGAGATCATGGATTGCCATTTTAG

[0044] GmSR34-2(>G.max Wm82.a2.v1|Glyma.19G211100.1 Protein,SEQ ID NO:4)

[0045] MSRRSSRTVYVGNLPGDIREREVEDLFLKYGHITHIDLKVPPRPPGYAFVEFEDAQDAEDAIRGRDGYDFDGHRLRVEPAHGGRGHSSSKDRHNSHSNGRGGRGVSRRSEYRVLVTGLPSSASWQDLKDHMRKAGDVCFSQVFHDGRGTTGIVDYTNYDDMKYAIKKLDDSEFRNAFSKGYVRVREYDSRRDSSRSPSHGPSHSRGRSYSRSRSRSHSYSRDRSQSKSPKGKSSQRSPAKSPKGKSSQRSPAKSPSRSPSRSRSRSRSRSLSGYGNLQHTGNWKLGSWWDLVQLSATHFVVEIGNQGDHGLPF*

[0046] gmsr34-1(CDS,SEQ ID NO:5)

[0047] ATGAGTAGACGCTCGAGCAGAACTGTCTACGTTGGGAATCTACCTGGTGATATCCGTGAAAGAGAAGTTGAAGATTTGTTTCTGAAGTATGGACACATAACACACATTGACCTAAAGGTTCCCCCAAGACCACCTGGTTATGCATTTGTAGAGTTTGAAGATGCTCAAGATGCTGAGGATGCAATTCGTGGT TGATGGCTATGATTTTGATGGGCACCGGTTACGGGTGGAGCCTGCCCATGGTGGACGTGGTCATTCATCCTCAAGAGATCGATACAATAGTCACAGCAATGGCCGAGGTGGACGTGGGGTGTCTAGGCGCTCTGAATATCGTGTTCTAGTCTCTGGATTGCCCTCTTCGGCATCCTGGCAGGATCTTAAGGATCACATGCGTAAGGCAGGGGATGTTTGTTTTTCTCAAGTTTTTCATGATGGAAGGGGTACTACCGGTATTGTGGATTACACAAATTATGATGATATGAAATATGCTATCAAGAAGCTTGATGACTCTGAGTTCCGGAATGCATTTTCCAAGGGATATGTTCGGGTGAGAGAATATGATTCAAGGCGGGATTCCTCTAGAAGTCCTAGTCGTGGCCCATCTCATTCTAGAGGAAGGAGCTATAGCCGCAGTCGTAGCCGTAGCCGTAGTTACAGTCGGGACCGGAGCCAAAGCAAATCTCCAAAGGGTAAGTCTTCACAGCGTTCACCTGCTAAATCTCCATCAAGATCTCCCTCTCGTTCAAGATCAAGGTCCCGATCGTTATCAGGATATGGAAACTTGCAGCGTACTGGAAATTGGAAATTAGGATCTTGGTGGGATTTGGTTCAATTGTCTGCAACTCATTTTGTTGTGGAGATCACGGTCCAGGTCCAGGTCCCCATTGCCTCCGCGTAA (The underlined codons are stop codons)

[0048] gmsr34-1 (Protein, SEQ ID NO:6)

[0049] MSRRSSRTVYVGNLPGDIREREVEDLFLKYGHITHIDLKVPPRPPGYAFVEFEDAQDAEDAIRG*

[0050] gmsr34-2 (CDS, SEQ ID NO:7)

[0051] ATGAGTAGACGCTCGAGCAGAACTGTCTACGTTGGGAATCTACCCGGTGATATCCGTGAAAGAGAAGTTGAAGATTTGTTTCTGAAGTACGGACACATAACACACATCGACCTAAAGGTTCCCCCAAGACCACCTGGTTATGCATTTGTAGAGTTTGAAGATGCTCAAGATGCTGAGGATGCAATTCGTGGG TGA TGGCTATGATTTTGATGGCCACCGGTTACGGGTGGAGCCTGCCCATGGTGGGCGTGGTCATTCATCCTCAAAAGATCGGCACAATAGTCACAGCAATGGCCGAGGTGGACGTGGGGTATCTAGGCGCTCTGAATATCGTGTTCTAGTCACTGGATTGCCCTCTTCGGCATCCTGGCAGGATCTTAAGGATCACATGCGCAAGGCAGGGGATGTTTGCTTTTCTCAAGTTTTTCATGATGGAAGGGGTACTACCGGTATTGTGGATTACACAAATTATGATGATATGAAATATGCTATTAAGAAGCTTGATGACTCTGAGTTCCGGAATGCATTTTCCAAGGGATATGTTCGGGTGAGGGAATATGATTCAAGGCGGGATTCTTCTAGAAGTCCTAGTCATGGCCCATCTCATTCTAGAGGAAGGAGCTATAGCCGCAGTCGTAGCCGTAGCCATAGTTACAGTCGGGACCGGAGCCAAAGCAAATCTCCAAAAGGAAAGTCTTCACAGCGTTCACCTGCTAAATCTCCAAAAGGAAAGTCTTCACAGCGTTCACCTGCTAAATCTCCATCAAGATCTCCCTCTCGTTCTCGCTCAAGGTCAAGGTCCCGTTCGTTATCAGGATATGGAAACTTGCAGCATACTGGAAATTGGAAATTAGGATCTTGGTGGGATTTGGTTCAATTGTCTGCAACTCATTTTGTTGTGGAGATTGGGAACCAAGGAGATCATGGATTGCCATTTTAG (The underlined part is the stop codon)

[0052] gmsr34-2 (Protein, SEQ ID NO:8)

[0053] MSRRSSRTVYVGNLPGDIREREVEDLFLKYGHITHIDLKVPPRPPGYAFVEFEDAQDAEDAIRG*

[0054] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0055] Example 1: Construction of the GmSR34-CRISRP vector

[0056] Includes the following steps:

[0057] 1. Constructing a CRISRP vector

[0058] (1) Using the Phanta Max Super-Fidelity DNA Polymerase kit, the first round of PCR reaction was performed with GmSR34-crispr1 (SEQ ID NO:9) and sgRNA-Xba1-R (SEQ ID NO:10), U6-Xbal-F (SEQ ID NO:11) and U6-R (SEQ ID NO:12) as primers and P485 plasmid (SEQ ID NO:13) as template.

[0059] The reaction system consisted of: 10 μL of 2*mix, 0.4 μL each of forward and reverse primers, 1 μL of dNTP, 1 μL of template, and 7.2 μL of ddH2O.

[0060] The reaction program was: 95℃ for 5 min, 35 cycles (95℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s), 72℃ for 5 min.

[0061] GmSR34-crispr1 (SEQ ID NO:9)AATGTGCCACCACATGGATTGATGCAATTCGTGGTCGTGAGTTTTAGAGCTAGAAATAGCAA

[0062] sgRNA-Xba1-R (SEQ ID NO:10)GGCAACGCGTTCTAGAAAAAAAAGCACCGACTCGGTGCCAC

[0063] U6-Xbal-F (SEQ ID NO:11)GGAAGCTTAGGCCTTCTAGAAAAATAAATGGTAAAATGTC

[0064] U6-R (SEQ ID NO:12)CAATCCATGTGGTGGCACAT

[0065] P485 plasmid core sequence (SEQ ID NO:13) AAAATAAATGGTAAAATGTCAAATCAAAACTAGGCTGCAGTATGCAGAGCAGAGTCATGATGATACTACTTACTACACCGATTCTTGTGTGCAGAAAAATATGTTAAAATAATTGAATCTTTCTCTAGCCAAATTTGACAACAATGTACACCGTTCATATTGAGAGACGATGCTTCTTGTTTGCTTTCGGTGGAAGCTGCA TATACTCAACATTACTCCTTCAGCGAGTTTTCCAACTGAGTCCCACATTGCCCAGACCTAACACGGTATTCTTGTTTATAATGAAATGTGCCACCACATGGATTGTTCTAATCTGAAGTGGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT

[0066] (2) Using the recovered product from the first round of PCR as a template, and using U6-Xbal-F (SEQ ID NO:11) and sgRNA-Xba1-R (SEQ ID NO:10) as primers, a second round of PCR reaction was carried out. The reaction system was the same as above, and the reaction program was: 95℃ for 5 min, 35 cycles (95℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s), 72℃ for 5 min.

[0067] (3) The vector JRH0640 was digested with XbaI enzyme, and the second round PCR product was ligated into the vector JRH0640 by homologous recombination to obtain the CRISRP vector gmSR34-JRH0640 (structure as shown in Figure 1). Figure 2 (As shown). Colony identification was performed by primer 35NOS FP (SEQ ID NO:14) and JRH0640 RP (SEQ ID NO:15) (product was 1066 bp) and sequencing was performed (results are shown in Figure 1). Figure 1 (As shown).

[0068] 35NOS FP (SEQ ID NO:14):TTAACATGTAATGCATGACG

[0069] JRH0640 RP (SEQ ID NO:15):CTGCAAGGCGATTAAGTTG

[0070] Example 2: Creation of the gmsr34 mutant

[0071] Includes the following steps:

[0072] 1. The CRISRP vector gmSR34-JRH0640 constructed in Example 1 was transformed into Agrobacterium EHA105 by electroporation. Using HC6 as background material (WT), soybean transgenic positive plants were obtained by soybean cotyledon node transformation. Whether gene mutations occurred in GmSR34-1 and GmSR34-2 were identified by SR34-1 FP (SEQ ID NO:16) and SR34-1 RP (SEQ ID NO:17), SR34-2 FP (SEQ ID NO:18) and SR34-2 RP (SEQ ID NO:19), respectively.

[0073] SR34-1 FP (SEQ ID NO:16): CACGACGCTCTTCCGATCTAGTCGTATATGATTAATGACT

[0074] SR34-1 RP (SEQ ID NO:17):GCATTTCACTGCTAACATGGCA

[0075] SR34-2 FP (SEQ ID NO:18): CACGACGCTCTTCCGATCTTGTATGTACCATGTGATTAAT

[0076] SR34-2 RP (SEQ ID NO:19): ACATTTCACTGCTAACGCAGCG

[0077] 2. Two single mutants, sr34-1 and sr34-2, were obtained from the T0 generation transgenic plants by first-generation sequencing analysis (results are shown below). Figure 3 As shown in the figure, homozygous mutants of gmsr34-1 and gmsr34-2 with the background of CRISRP vector gmSR34-JRH0640 were harvested at the T1 generation. F1 generation seeds of gmsr34-1 / gmsr34-2 double mutant were obtained by hybridization. T2 and F2 generation seeds were identified, and homozygous lines with stable inheritance were selected for further propagation. T3 and F3 generation seeds were used for phenotypic experiments.

[0078] Example 3: Salt tolerance phenotype of gmsr34 mutant

[0079] Includes the following steps:

[0080] 1. Prepare the soil for use with salt phenotype

[0081] Mix vermiculite and peat moss in a 1:1 ratio and then pass the mixture through a 10-mesh sieve.

[0082] 2. Fill the pot

[0083] Divide the mixed soil into 0.85 kg portions per pot.

[0084] 3. Sowing

[0085] Eight seeds were planted in each pot, with six pots of each of the following varieties: HC6, gmsr34-1, gmsr34-2, and gmsr34-1 / gmsr34-2. Three pots were used as the control group, and three pots were used as the experimental group.

[0086] 4. Watering

[0087] The control group was watered with water that did not contain NaCl, while the experimental group was watered with an aqueous solution containing 100 mM NaCl for the first 7 days and an aqueous solution containing 150 mM NaCl for the next 14 days.

[0088] 5. Take photos

[0089] In the control group, after 7 days of normal growth, the tallest and shortest plants were removed, and the middle 3 soybean plants were photographed; in the experimental group, photos were taken at 7 and 21 days of growth.

[0090] The results are as follows Figure 4 As shown in the figure, the experimental results indicate that gmsr34-1, gmsr34-2, and gmsr34-1 / gmsr34-2 can all improve the salt tolerance of soybeans.

[0091] 6. Sampling and statistical analysis of survival rate

[0092] Survival rates of wild-type and mutant strains were calculated after 21 days of salt treatment. The results are as follows: Figure 5 As shown in the figure. The results showed that the survival rates of gmsr34-1, gmsr34-2, and gmsr34-1 / gmsr34-2 were significantly higher than those of HC6.

[0093] 7. Detect the content of sodium and potassium ions.

[0094] Leaves treated with salt for 21 days were collected, and the sodium and potassium ion contents of HC6, gmsr34-1, gmsr34-2, and gmsr34-1 / gmsr34-2 were determined by flame spectrophotometry. The Na+ content was calculated. + / K + The result is as follows Figure 6 As shown. The results show the Na content of gmsr34-1, gmsr34-2, and gmsr34-1 / gmsr34-2. + / K+ Significantly lower than HC6, and the Na content of gmsr34-1 and gmsr34-1 / gmsr34-2 was also lower. + / K + The value is significantly lower than that of gmsr34-2, indicating that GmSR34-1 is upstream of GmSR34-2.

[0095] The results of this embodiment show that mutations in GmSR34-1 and / or GmSR34-2 can significantly improve the salt tolerance of soybeans.

[0096] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0097] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. Application of soybean GmSR34 gene in regulating soybean salt tolerance, wherein the soybean GmSR34 gene is the GmSR34-1 gene with nucleotide sequence as shown in SEQ ID NO:1 and / or the GmSR34-2 gene with nucleotide sequence as shown in SEQ ID NO:

2.

2. Application of the soybean GmSR34 gene in the genetic breeding of salt-tolerant soybean varieties, wherein the soybean GmSR34 gene is the GmSR34-1 gene with the nucleotide sequence as shown in SEQ ID NO:1 and / or the GmSR34-2 gene with the nucleotide sequence as shown in SEQ ID NO:

2.

3. Application of mutants of the soybean GmSR34 gene in improving the salt tolerance of soybean, wherein the nucleotide sequence of the mutant is shown in SEQ ID NO:5 and / or SEQ ID NO:

7.

4. Application of soybean GmSR34 gene knockout vector in improving soybean salt tolerance, wherein the soybean GmSR34 gene is the GmSR34-1 gene with nucleotide sequence as shown in SEQ ID NO:1 and / or the GmSR34-2 gene with nucleotide sequence as shown in SEQ ID NO:

2.

5. The application according to claim 4, characterized in that, The soybean GmSR34 gene knockout vector was constructed using the following method: S1. Using the P485 plasmid shown in SEQ ID NO:13 as a template, and using SEQ ID NO:9 and SEQ ID NO:10, SEQ ID NO:11 and SEQ ID NO:12 as primers, the first round of PCR reaction was performed; S2. Using the product of the first round of PCR reaction as a template, and SEQ ID NO:11 and SEQ ID NO:10 as primers, perform the second round of PCR reaction; S3. The product of the second round of PCR reaction is ligated to the enzyme-digested CRISPR vector via homologous recombination to obtain the final product.

6. The application according to claim 5, characterized in that, The CRISPR vector is vector JRH0640.

7. Application of soybean GmSR34 gene knockout vector in the genetic breeding of salt-tolerant soybean varieties, wherein the soybean GmSR34 gene is the GmSR34-1 gene with nucleotide sequence as shown in SEQ ID NO:1 and / or the GmSR34-2 gene with nucleotide sequence as shown in SEQ ID NO:

2.

8. Application of engineered bacteria transforming soybean GmSR34 gene knockout vector in improving soybean salt tolerance, wherein the soybean GmSR34 gene is the GmSR34-1 gene with nucleotide sequence as shown in SEQ ID NO:1 and / or the GmSR34-2 gene with nucleotide sequence as shown in SEQ ID NO:

2.

9. A method for improving the salt tolerance of soybeans, characterized in that, It includes the following steps: The soybean GmSR34 gene is knocked out in soybean plants. The soybean GmSR34 gene is the GmSR34-1 gene with the nucleotide sequence shown in SEQ ID NO:1 and / or the GmSR34-2 gene with the nucleotide sequence shown in SEQ ID NO:

2.

10. The method for improving the salt tolerance of soybeans according to claim 9, characterized in that, The knockout is achieved through the following steps: the engineered bacteria that transform the soybean GmSR34 gene knockout vector infect the soybean cotyledon nodes, and then soybean tissue culture is performed to obtain tissue culture seedlings, and then transgenic lines are obtained.

Images