Biomarker ROR [beta] and application thereof in BD-related diseases
By overexpressing RORβ in the mouse pancreas, we revealed its regulatory mechanism on insulin secretion and hippocampal neuronal excitability in BD. RORβ has become a target for the diagnosis and treatment of BD, and regulating insulin activity can improve BD behavior, thus solving the problem of unclear pathogenesis of BD.
Patent Information
- Application Number
- CN202411080514.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-07
- Publication Date
- 2026-02-10
AI Technical Summary
The existing technology does not have a clear understanding of the pathogenesis of bipolar disorder (BD) and the peripheral mechanisms that coexist with metabolic disorders, especially the physiological significance of insulin dysfunction in the brain and RORβ in BD has not been explained in detail.
By overexpressing RORβ in the mouse pancreas using CRISPR activation technology, and combining electrophysiological, chemogenetic, and optogenetic methods, we observed the effects of RORβ on insulin secretion and hippocampal neuronal excitability, revealing the pancreas-hippocampal feedback loop mechanism and discovering that RORβ regulates insulin secretion in circadian rhythm abnormalities.
RORβ has become a diagnostic and therapeutic target for BD-related diseases. By regulating the expression and function of RORβ, it can improve behavioral abnormalities in BD patients, reverse abnormal pancreatic-brain feedback mechanisms, regulate insulin secretion, and improve behavioral phenotypes.
Smart Images

Figure CN121496048A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, specifically to a biomarker RORβ and its application in BD-related diseases. Background Technology
[0002] Bipolar disorder (BD) is a mental illness characterized by alternating episodes of mania and depression. Approximately 40% of BD patients also exhibit symptoms of diabetes or insulin metabolic syndrome. Clinical studies have shown that BD patients with concurrent metabolic disorders may have a slower disease course, faster mood cycles, and a more sluggish response to mood stabilizers. Impaired insulin secretion in β cells is one of the causes and initial characteristics of type 2 diabetes mellitus (T2DM) or metabolic syndrome. Therefore, research suggests that insulin deficiency may exist in the brains of BD patients. However, past research on the pathogenesis of BD has focused on biological changes within the brain, including studies based on animal and patient-derived induced pluripotent stem cell (iPSC) models. Although clinical studies have proposed several hypotheses linking metabolism to BD, including insulin deficiency, glucose oxidation, neuroinflammation, and genetic linkage, such as the T2DM-related gene TCF7L2 (Miola, A., et al. The genetics of bipolar disorder with obesity and type 2 diabetes. Journal of affective disorders). 313,222-231(2022)), but little is known about the relatively well-defined pathogenesis of BD and the peripheral mechanisms of bipolar behavior and metabolic disorders.
[0003] Insulin receptors (InsRs) are widely distributed across multiple brain regions, including the olfactory bulb, hypothalamus, hippocampus, cerebellum, amygdala, and cerebral cortex, making the brain highly sensitive to insulin levels. In the hippocampus, insulin dysfunction can lead to neuronal atrophy, thus being associated with hippocampal cognitive impairment, neurodegeneration, and Alzheimer's disease. Recently, it has been proposed that hippocampal neurons, in addition to the pancreatic islets, can also secrete insulin and regulate hippocampal function through the central insulin pathway. Therefore, both peripheral and central insulin secretion may be involved in the physiological function of the hippocampus. However, the effects of hippocampal neuronal excitability on pancreatic islets and insulin secretion in the brain remain unknown.
[0004] The RORβ gene encodes a transcription factor called retinoic acid-related orphan receptor β, a subfamily containing three closely related members α / β / γ. These members play a crucial role in the transactivation of clock genes Bmal1, clock, and Cry1 via the RevErb / ROR response element (RRE). RORβ is highly expressed in sensory organs, the pancreas, and the central nervous system (CNS) and is thought to play important roles in brain and retinal development. In the human and mouse cortex, RORβ is enriched in layer IV neurons, making it a potential layer IV-specific cellular marker gene. Clinically, mutations in RORβ have been found to be potentially associated with susceptibility to bipolar disorder (BD) and epilepsy (McGrath, CL, et al. Evidence for genetic association of RORβ with bipolar disorder. BMC psychiatry 9, 70 (2009)). Animals with loss of RORβ function exhibit circadian rhythm or gait abnormalities. Although RORα expression is highest in the pancreas, RORβ and RORγ are more likely to be involved in islet-related disease processes (Taneera, J., et al. RORB and RORC associate with human islet dysfunction and inhibit insulin secretion in INS-1 cells. Islets 11, 10-20 (2019)). However, the physiological significance of RORβ in the periphery and its relationship with BD have not been fully elucidated. Summary of the Invention
[0005] In this invention, we investigated the role of pancreatic RORβ and insulin secretion defects in neuropsychiatric disorders. We observed elevated RORβ expression in the plasma of BD patients and in iPSC-differentiated islet organoids, but no upregulation was observed in patient forebrain organoids or post-mortem forebrain tissue samples, and the islet organoids exhibited RORβ-dependent insulin secretion defects. Using CRISPR activation (CRISPRa) technology, we specifically overexpressed RORβ in mouse pancreas and observed abnormal fluctuations in mouse behavior with diurnal rhythms. Combining in vivo and in vitro electrophysiological, chemogenetic, and optogenetic methods, we found that during the diurnal phase, RORβ overexpression inhibited insulin secretion from the islets, leading to hippocampal neuronal hyperexcitability and further resulting in primary depressive-like behavior. Furthermore, diurnal hippocampal hyperexcitability had a delayed but persistent effect on promoting diurnal pancreatic secretion, ultimately leading to excessive insulin secretion and a reversal of hippocampal excitability and behavioral phenotypes in mice: namely, decreased hippocampal neuronal excitability and manic-like behavior. In summary, our findings reflect a pancreas-hippocampal feedback loop mechanism through which metabolic and circadian rhythm factors may synergistically cause abnormal behavioral fluctuations in patients with neuropsychiatric disorders. This makes RORβ a potential target for diagnosing BD-related diseases, screening drugs for BD-related diseases, and treating and / or preventing BD-related diseases.
[0006] In view of the above, the present invention provides the following technical solution:
[0007] On one hand, the present invention provides the use of a biomarker in the preparation of diagnostic products for bipolar disorder (BD) related diseases, drugs for the treatment and / or prevention of BD related diseases, and in the screening of drugs for the treatment and / or prevention of BD related diseases, wherein the biomarker includes the transcription factor of retinoic acid-related orphan receptor β (RORβ).
[0008] Preferably, the biomarker is a detection target of the diagnostic product or a therapeutic, preventive, and / or screening target of the drug.
[0009] On the other hand, the present invention provides a detection reagent for a biomarker, wherein the biomarker includes RORβ.
[0010] Preferably, the detection reagent includes a detection reagent for biomarker gene or protein levels.
[0011] More preferably, the gene-level detection reagent includes qualitative, semi-quantitative, and / or quantitative detection reagents for the DNA and / or mRNA of biomarkers; even more preferably, the detection reagent includes primers and / or probes for biomarkers.
[0012] More preferably, the probe comprises a suitable probe molecule designed and synthesized or selected according to the sequence structure of the DNA and / or mRNA of the biomarker using known and universal methods, to specifically capture, amplify, and sequence the target fragment in order to detect the biomarker in the sample.
[0013] In one specific embodiment, the nucleotide sequence of the RORβ primer includes:
[0014] F:5'-CAATGGGCAGTTAGCACCAG-3' (SEQ ID No. 1);
[0015] R: 5'-TGCTTCCCTGGACTTGCTTT-3' (SEQ ID No. 2).
[0016] More preferably, the detection reagent for the protein level includes antibodies, antibody fragments, high-affinity polymers, etc., that specifically bind to the full length of the protein or fragments thereof of the biomarker.
[0017] On the other hand, the present invention provides an application of a biomarker detection reagent in the preparation of diagnostic products for bipolar disorder-related diseases, wherein the biomarker includes RORβ.
[0018] Preferably, the diagnostic product may be a diagnostic kit, a diagnostic chip, and / or a diagnostic system.
[0019] Furthermore, the diagnosis includes: detecting biomarkers in the test sample; and comparing the detection results of biomarkers in the test sample with those in a healthy population.
[0020] Furthermore, if the detection result of the biomarker RORβ in the test sample is higher than that in the healthy group, a diagnosis of bipolar disorder-related disease is made. Preferably, the test sample is derived from body fluids, tissues, and / or organs, including body fluids, tissues, and / or organs of the peripheral system other than the central nervous system, or body fluids, tissues, and / or organs of the central nervous system. More preferably, the body fluids, tissues, and / or organs of the peripheral system include, but are not limited to, blood, urine, saliva, tears, or pancreas, etc., and the body fluids, tissues, and / or organs of the central nervous system include, but are not limited to, cerebrospinal fluid, forebrain, hippocampus, etc.; even more preferably, the biomarker is derived from blood.
[0021] Furthermore, the test results can assist in the diagnosis of clinical symptoms and / or other test results.
[0022] Preferably, the detection reagent includes a detection reagent for any of the above-mentioned biomarkers.
[0023] Preferably, the BD-related diseases include BD, or BD combined with metabolic diseases; more preferably, the metabolic diseases include insulin metabolism diseases, such as diabetes, obesity, etc.
[0024] On the other hand, the present invention provides a diagnostic product, which includes any of the above-mentioned detection reagents.
[0025] Preferably, the diagnostic product is used to diagnose bipolar disorder-related diseases.
[0026] Preferably, the diagnostic product may be a diagnostic kit, a diagnostic chip, and / or a diagnostic system.
[0027] Preferably, the diagnostic products include reagents from probe sets, primer sets, protein chips, gene chips, or high-throughput sequencing platforms.
[0028] Preferably, the gene chip or protein chip includes the probe set.
[0029] Preferably, the chip further includes a solid support. More preferably, the solid support is selected from one or more combinations of nitrocellulose membrane, nylon membrane, polystyrene, glass sheet, silicon wafer, or polypropylene membrane.
[0030] Preferably, the method for fixing the probe on the solid support is selected from in-situ synthesis, spotting, or other fixation methods.
[0031] In this process, probes from the chip are fixed onto the solid-phase support. Preferably, the probe sequence is densely and orderly arranged and fixed within a pre-defined area of the solid-phase support to form a miniature detection device.
[0032] Preferably, the diagnostic products include diagnostic kits that utilize any of the above-mentioned detection reagents to form PCR, qRT-PCR, qPCR, RNA-seq analysis kits, ELISA kits, immunoblotting detection kits, immunohistochemistry detection kits, immunochromatographic detection kits, electrochemiluminescence detection kits, or flow cytometry analysis kits.
[0033] Furthermore, the kit also includes a container, a positive control, a negative control, a buffer, an adjuvant, a solvent, and / or an instruction manual that describes how to use the kit for detection and how to interpret the results.
[0034] Preferably, the diagnostic product includes a diagnostic system, the diagnostic system comprising:
[0035] (1) Detection unit: The detection unit is used to detect biomarkers, including RORβ;
[0036] (2) Result judgment unit: The result judgment unit is used to output the risk of having BD-related diseases based on the detection results of the biomarkers obtained by the detection unit.
[0037] Preferably, the detection unit includes the use of any of the above-mentioned detection reagents or diagnostic kits to detect biomarkers.
[0038] Preferably, the result judgment unit includes an input unit, an analysis unit, and an output unit;
[0039] More preferably, the input unit is used to input the detection result of the biomarker;
[0040] More preferably, the analysis unit is used to analyze the risk of having BD-related diseases based on the results of the biomarkers;
[0041] More preferably, the output unit is used to output the analysis results of the analysis unit.
[0042] On the other hand, the present invention provides a method for detecting biomarkers, the method comprising contacting a biomarker in a sample to be tested with a detection reagent to obtain a detection result, wherein the biomarker includes RORβ.
[0043] Preferably, the detection method includes detecting biomarkers in the sample to be tested; and comparing the detection results of biomarkers in the sample to be tested with those in a healthy population.
[0044] Preferably, the RORβ in the test sample is higher than that in the healthy population, and is therefore considered abnormal.
[0045] More preferably, the method for detecting biomarkers includes detecting the sample to be tested using any of the above-described detection reagents or diagnostic products.
[0046] Preferably, the test sample is derived from body fluids, tissues, and / or organs, including body fluids, tissues, and / or organs of the peripheral system other than the central nervous system, or body fluids, tissues, and / or organs of the central nervous system. More preferably, the body fluids, tissues, and / or organs of the peripheral system include, but are not limited to, blood, urine, saliva, tears, or pancreas, etc., and the body fluids, tissues, and / or organs of the central nervous system include, but are not limited to, cerebrospinal fluid, forebrain, hippocampus, etc.; even more preferably, the biomarker is derived from blood.
[0047] On the other hand, the present invention provides a diagnostic method for BD-related diseases, the diagnostic method comprising detecting biomarkers in a test sample using diagnostic products and / or detection methods for the aforementioned biomarkers, wherein the biomarkers include RORβ.
[0048] Preferably, if the RORβ in the test sample is higher than that in the healthy population, it is considered abnormal and can be diagnosed as BD-related disease.
[0049] Preferably, the test sample is derived from body fluids, tissues, and / or organs, including body fluids, tissues, and / or organs of the peripheral system other than the central nervous system, or body fluids, tissues, and / or organs of the central nervous system. More preferably, the body fluids, tissues, and / or organs of the peripheral system include, but are not limited to, blood, urine, saliva, tears, or pancreas, etc., and the body fluids, tissues, and / or organs of the central nervous system include, but are not limited to, cerebrospinal fluid, forebrain, hippocampus, etc.; even more preferably, the biomarker is derived from blood.
[0050] Preferably, the test results assist in the diagnosis of clinical symptoms.
[0051] On the other hand, the present invention provides a method for screening drugs, the method comprising evaluating the regulatory effect of a candidate on a biomarker of a subject, said biomarker including RORβ.
[0052] Preferably, the drug is used to treat and / or prevent bipolar disorder (BD) related diseases.
[0053] Preferably, the candidate drug that downregulates RORβ levels and / or inhibits RORβ function is a drug for treating and / or preventing BD-related diseases.
[0054] Preferably, the evaluation includes detecting biomarkers in the test sample and comparing the detection results of biomarkers in the test sample before and after administration of the candidate.
[0055] Preferably, the screening method includes the step of establishing a BD disease model.
[0056] More preferably, the step of establishing the disease model includes increasing the content and / or function of RORβ in the pancreas of the disease model.
[0057] More preferably, increasing the RORβ content in the pancreas of the disease model includes: increasing the RORβ content by overexpressing gene modifications, preferably including point mutation, linking a strong promoter, linking an enhancer, or increasing the copy number.
[0058] The step of increasing the RORβ content in the pancreas of the subject includes constructing a RORβ overexpression vector according to the above-mentioned gene modification method. Preferably, the vector is derived from a recombinant vector such as a prokaryotic expression vector, a viral expression vector, or a eukaryotic expression vector.
[0059] For example, a viral expression vector can be used. The viral expression vector may contain a virus-derived DNA or RNA sequence for packaging into a virus (e.g., lentivirus, retrovirus, replication-defective retrovirus, adenovirus, replication-defective adenovirus, and adeno-associated virus (AAV)). The virus and viral expression vector can be used for in vitro, ex vivo, and / or in vivo delivery.
[0060] Preferably, the RORβ overexpression vector includes a RORβ guide RNA (sgRNA), and more preferably, the nucleotide sequence of the RORβ guide RNA (sgRNA) includes:
[0061] sgRNA1: 5'-TCCCCAGACTCTCCACGCGCT-3' (SEQ ID No. 3);
[0062] sgRNA2: 5'-ATCAGCGTCCCGCAGCGCGTG-3' (SEQ ID No. 4).
[0063] More preferably, the RORβ overexpression vector is organ-specific, such as pancreas-specific.
[0064] In one specific implementation, the RORβ overexpression vector comprises an AAV-based Cre / loxP conditional CRISPR activation (CRISPRa) system, wherein the AAV is injected intravenously into an Ins1 receptor that can be activated by tamoxifen. CreERT In the disease model, after injection of tamoxifen, Cre recombinase specifically induced the expression of the endogenous RORβ gene in β cells.
[0065] Furthermore, the system includes components such as rAAV, EF1a, DIO, CRISPRa, and mRORβ, and the assembly sequence is rAAV-EF1α-DIO-VP64-NLS-dSaCas9-hGH polyA-mRORβ.
[0066] The mRORβ component includes the guide RNA of the aforementioned RORβ.
[0067] Preferably, the function of RORβ can be enhanced by using a promoter of RORβ.
[0068] Preferably, insulin inhibitors can be used to reduce the function of insulin.
[0069] Preferably, the function of reducing insulin includes knocking down or eliminating the expression of insulin receptor (InsR) or inhibiting the function of InsR.
[0070] More preferably, the expression of the insulin receptor (InsR) is knocked down or eliminated using InsRs shRNA.
[0071] In one specific implementation, the nucleotide sequence of the InsRs shRNA includes:
[0072] 3'-CCGGCGTCTGGCTATACCATGAATTCTCGAGAATTCATGGTATAGCCAGACGTTTTT-5' (SEQ ID No. 5).
[0073] The function of inhibiting InsR includes selecting an InsR inhibitor, such as BMS-536924, to inhibit InsR.
[0074] More preferably, the step of establishing a BD disease model includes differentiating the iPSCs of BD patients into organoids, wherein the organoids can be any target organ, such as the forebrain, pancreas, hippocampus, etc.
[0075] More preferably, the candidate that downregulates RORβ levels and / or inhibits RORβ function is a medicament that can be used to treat and / or prevent bipolar disorder (BD) related diseases.
[0076] Preferably, the biomarkers in the sample to be tested are detected using any of the above-mentioned detection reagents, diagnostic products, detection methods and / or diagnostic systems.
[0077] Furthermore, the subject refers to any non-human animal, wherein non-human animals include all vertebrates, such as mammals and non-mammals. The mammals include non-human primates, rodents, artiodactyls, carnivores, lagomorphs, etc., such as mice, rats, guinea pigs, goats, sheep, dogs, rabbits, pigs, cats, and cows. The non-mammals include chickens, amphibians, or reptiles.
[0078] On the other hand, the present invention provides a method for establishing a BD disease model, the method comprising constructing a non-human animal body that overexpresses and / or upregulates RORβ.
[0079] Preferably, the non-human animal also includes insulin rhythm disorders and / or downregulation.
[0080] Preferably, the non-human animal body includes all vertebrates, such as mammals and non-mammals. The mammals include non-human primates, rodents, artiodactyls, carnivores, lagomorphs, etc., such as mice, rats, guinea pigs, goats, sheep, dogs, rabbits, pigs, cats, and cattle. The non-mammals include chickens, amphibians, or reptiles.
[0081] Preferably, the steps of establishing the disease model include increasing the content of RORβ in the pancreas of the animal and / or promoting its function.
[0082] More preferably, increasing the RORβ content in the pancreas includes: increasing the RORβ content by overexpressing gene modification methods, preferably including point mutation, linking a strong promoter, linking an enhancer, or increasing the copy number of the overexpressed gene modification methods.
[0083] The step of increasing the RORβ content in the pancreas includes constructing a RORβ overexpression vector according to the above-mentioned gene modification method. Preferably, the vector is derived from a recombinant vector such as a prokaryotic expression vector, a viral expression vector, or a eukaryotic expression vector.
[0084] For example, a viral expression vector can be used. The viral expression vector may contain a virus-derived DNA or RNA sequence for packaging into a virus (e.g., lentivirus, retrovirus, replication-defective retrovirus, adenovirus, replication-defective adenovirus, and adeno-associated virus (AAV)). The virus and viral expression vector can be used for in vitro, ex vivo, and / or in vivo delivery.
[0085] Preferably, the RORβ overexpression vector includes a RORβ guide RNA (sgRNA), and more preferably, the nucleotide sequence of the RORβ guide RNA (sgRNA) includes:
[0086] sgRNA1: 5'-TCCCCAGACTCTCCACGCGCT-3' (SEQ ID No. 3);
[0087] sgRNA2: 5'-ATCAGCGTCCCGCAGCGCGTG-3' (SEQ ID No. 4).
[0088] More preferably, the RORβ overexpression vector is organ-specific, such as pancreas-specific.
[0089] In one specific implementation, the RORβ overexpression vector comprises an AAV-based Cre / loxP conditional CRISPR activation (CRISPRa) system, wherein the AAV is injected intravenously into an Ins1 receptor that can be activated by tamoxifen. CreERTIn animal models, after injection of tamoxifen, Cre recombinase specifically induced the expression of the endogenous RORβ gene in β cells.
[0090] Furthermore, the system includes components such as rAAV, EF1a, DIO, CRISPRa, and mRORβ, and the assembly sequence is rAAV-EF1α-DIO-VP64-NLS-dSaCas9-hGH polyA-mRORβ.
[0091] The mRORβ component includes the guide RNA of the aforementioned RORβ.
[0092] Preferably, the function of RORβ can be enhanced by using a promoter of RORβ.
[0093] Preferably, the function of reducing insulin includes knocking down or eliminating the expression of insulin receptor (InsR) or inhibiting the function of InsR.
[0094] More preferably, the expression of the insulin receptor (InsR) is knocked down or eliminated using InsRs shRNA.
[0095] In one specific implementation, the nucleotide sequence of the InsRs shRNA includes:
[0096] 3'-CCGGCGTCTGGCTATACCATGAATTCTCGAGAATTCATGGTATAGCCAGACGTTTTT-5' (SEQ ID No. 5).
[0097] The function of inhibiting InsR includes selecting an InsR inhibitor, such as BMS-536924, to inhibit InsR.
[0098] More preferably, the step of establishing a BD disease model includes differentiating the iPSCs of BD patients into organoids, wherein the organoids can be any target organ, such as the forebrain, pancreas, hippocampus, etc.
[0099] On the other hand, the present invention provides a BD disease model, which is constructed by the above-described method.
[0100] On the other hand, the present invention provides a drug obtained using the above-described screening method.
[0101] Preferably, the drug downregulates the content of RORβ and / or inhibits the function of RORβ.
[0102] On the other hand, the present invention provides a regulator of biomarkers, wherein the biomarkers include RORβ.
[0103] Preferably, the regulator downregulates the content of RORβ and / or inhibits the function of RORβ.
[0104] More preferably, the regulators of RORβ include structural and / or functional regulators at the RORβ gene level or protein level.
[0105] More preferably, the regulator of the RORβ gene level includes reagents and / or systems that reduce RORβ gene expression and / or inhibit RORβ gene expression or function, such as by using gene modification to inhibit the activity or expression of encoding RORβ. Preferably, the gene modification includes, but is not limited to, point mutations, deletions, insertions, antisense polynucleotides, siRNA, shRNA, microRNA, CRISPR, etc.
[0106] Preferably, the regulator comprises an expression vector constructed according to the above gene modification method, and preferably, the vector is derived from a recombinant vector such as a prokaryotic expression vector, a viral expression vector, or a eukaryotic expression vector.
[0107] For example, a viral expression vector can be used. The viral expression vector may contain a virus-derived DNA or RNA sequence for packaging into a virus (e.g., lentivirus, retrovirus, replication-defective retrovirus, adenovirus, replication-defective adenovirus, and adeno-associated virus (AAV)). The virus and viral expression vector can be used for in vitro, ex vivo, and / or in vivo delivery.
[0108] In one specific implementation, the nucleotide sequence of the shRNA includes:
[0109] RORβ-shRNA1: 3'-CCGGCCCACAACCTATGAAGAAATTACTCGAGTAATTTCTTCATAGGTGTGGGTTTTT-5' (SEQ ID No. 6).
[0110] RORβ-shRNA2: 3'-CCGGCCGTGCCTTCAACCATTAAACTCGAGTTTAATGGGTTGAAGGCACGGTTTTT-5' (SEQ ID No. 7).
[0111] RORβ-shRNA3:
[0112] 3'-CCGGGCATTTGACTTTGCGAAGAATCTCGAGATTCTTCGCAAAGTCAAATGCTTTTT-5' (SEQ ID No. 8).
[0113] The vector includes a lentiviral vector.
[0114] More preferably, the regulator of RORβ protein level includes antibodies, antibody fragments, high-affinity polymers, peptides, peptide mimics, and RORβ inhibitors, including antagonists such as all-trans-4-oxoretinoic acid, etc., that specifically bind to the full length of the protein or fragments thereof.
[0115] On the other hand, the present invention provides the use of a RORβ modulator in the preparation of a medicament for treating and / or preventing BD-related diseases, characterized in that the RORβ modulator downregulates the content of RORβ and / or inhibits the function of RORβ.
[0116] Preferably, the drug includes a modulator of any of the above-mentioned biomarkers.
[0117] On the other hand, the present invention provides a drug comprising a modulator of any of the above-mentioned biomarkers.
[0118] The "medicine" described in this invention can be used to treat humans or non-human animals, such as non-human mammals. The medicine may contain pharmaceutically acceptable carriers, excipients, or salts common in the prior art. The medicine can be administered via any suitable route, such as gastrointestinal (e.g., oral) or non-gastrointestinal (e.g., intravenous, intramuscular, subcutaneous, intradermal, intra-organ, intranasal, intraocular, intravenous infusion, intracerebral, intrathecal, transdermal, rectal, etc.). The medicine can be in any suitable dosage form, such as gastrointestinal or non-gastrointestinal dosage forms, preferably including but not limited to tablets, pills, powders, granules, capsules, lozenges, syrups, liquids, emulsions, microemulsions, suspensions, injections, sprays, aerosols, powder inhalers, lotions, ointments, plasters, pastes, patches, eye drops, nasal drops, sublingual tablets, suppositories, aerosols, effervescent tablets, pellets, gels, etc. Various dosage forms of the medicine can be prepared according to conventional pharmaceutical manufacturing methods.
[0119] On the other hand, the present invention provides a method for preventing and / or treating BD-related diseases, the method comprising administering modulators or drugs of the aforementioned biomarkers to patients with BD-related diseases.
[0120] Preferably, the modulator or drug of the biomarker prevents and / or treats BD-related disease by reducing RORβ levels or inhibiting RORβ function in patients.
[0121] Preferably, the patient includes a human or a non-human animal, wherein the non-human animal includes all vertebrates, such as mammals and non-mammals, the mammals include non-human primates, mice, rats, guinea pigs, goats, sheep, dogs, rabbits, pigs, cats, and cattle, and the non-mammals include chickens, amphibians, or reptiles.
[0122] The terms “comprising” or “including” in this invention are used interchangeably and are open-ended descriptions that include the specified ingredients or steps described, as well as other specified ingredients or steps that do not materially affect them.
[0123] The beneficial effects of this invention include:
[0124] 1. The association between the biomarker RORβ and BD-related diseases was confirmed for the first time, thus enabling RORβ to serve as a target for the diagnosis, drug screening, and treatment of BD-related diseases.
[0125] 2. This invention has found that the level of the biomarker RORβ is increased in the peripheral blood and / or pancreas of patients with BD-related diseases, while this phenomenon has not been observed in MDD, indicating that the biomarker of this invention is specific; at the same time, the biomarker can be detected in peripheral blood, which also increases the convenience of detection and makes clinical application possible.
[0126] 3. The RORβ modulator of the present invention can downregulate RORβ expression and / or function in peripheral blood or pancreas, affect pancreatic secretory function, change the diurnal disorder of pancreas and behavior caused by RORβ overexpression, improve the depressive and manic behavioral phenotypes in mice, thereby improving the behavior of BD patients, while increasing insulin secretion, reversing the abnormal pancreas-brain feedback mechanism in BD patients, and achieving the effect of treating BD.
[0127] 4. Based on research into the pancreas-brain feedback mechanism, this invention discovered that direct injection of insulin into the pancreas of overexpressing mice or regulation of insulin levels through RORβ can regulate mouse behavior through InsRs in the brain. Therefore, regulating insulin activity, especially in the brain, by modulating RORβ expression is a method for treating neuropsychiatric behavioral disorders of brain disorders (BD). Attached Figure Description
[0128] Figure 1 The image shows a sequencing analysis of forebrain organoids derived from iPSCs in BD / MDD patients.
[0129] Figure 1 a shows a schematic diagram of the reprogramming of fibroblasts in BDII and MDD patients into iPSCs and their further differentiation into forebrain organoids;
[0130] Figure 1Immunostaining images of sample b show the expression of forebrain markers CTIP2, TBR1, BRN2, and SATB2 in iPSC-derived forebrain organoids and the corresponding tissues. In the left image, from left to right, the colors are Dapi (blue), CTIP2 (red), TBR1 (purple), and the combination of the three dyes mentioned above. In the right image, from left to right, the colors are Dapi (blue), BRN2 (green), SATB2 (purple), and the combination of the three dyes mentioned above.
[0131] Figure 1 c represents the Na+ / K+ current and the action potential (AP) discharge results of the forebrain organoids. The left figure shows the Na+ / K+ current, and the right figure shows the action potential of the forebrain organoids.
[0132] Figure 1 d represents the quantitative analysis results of the thickness of the apical and basal surfaces of the forebrain organoids, n = 5 subjects;
[0133] Figure 1 e represents the percentage of TBR1+, CTIP2+, SATB2+, and BRN2+ cells in the total Dapi+ nuclei of the forebrain organoid from left to right, n = 5 subjects;
[0134] Figure 1 f represents the distribution of differentially expressed genes among DG neurons, BDII forebrain organoids, and MDD organoids of BDI;
[0135] Figure 1 g represents the differentially expressed KEGG pathway in HCII and BDII forebrain organoids;
[0136] Figure 1 h represents a parallel abnormal pathway between BDII and MDD forebrain organoids.
[0137] Figure 1 i represents the parallel abnormal pathways between BDII organoids and BDIDG neurons, analyzed by one-way ANOVA with Sidak multiple comparison test; error bars, SEM.
[0138] Figure 2 The image shows the maturation of pancreatic islet organoids differentiated from iPSCs in BD patients.
[0139] Figure 2 a is a schematic diagram of PSCs differentiating into pancreatic islet organoids;
[0140] Figure 2Image b shows the immunostaining results of pancreatic islet organoids derived from HC iPSCs. The top left image shows NKX6.1 staining (purple), the bottom left image shows C-peptide staining (green), the bottom right image shows DAPI staining (blue), and the top right image shows a combination of the three dyes. (Scale bar: 50 μm)
[0141] Figure 2 c shows the flow cytometry results, indicating the proportion of NKX6.1+ / C-peptide+ cells in HC (left) and BD (right) organoids;
[0142] Figure 2 d represents the proportion of β-like cells in organoids of HCII / BDII / MDD, n=5 subjects (left figure), BDI (n=6), and HCI (n=4) (right figure).
[0143] Figure 3 The image shows the insulin secretion results of iPSC-derived pancreatic organoids in BD patients.
[0144] Figure 3 ab are the results of immunoblotting (3a) and qRT-PCR quantification (3b), respectively, showing the expression of insulin protein in pancreatic islet organoids of patients with BDI (left), BDII (middle) and MDD (right). HCI, n=4 subjects, BDI, n=6, HCII / BDII / MDD, n=5.
[0145] Figure 3 C and D represent the GSIS results of BD pancreatic islet organoids, where... Figure 3 c and Figure 3 e represents the glucose-stimulated / baseline insulin level ratio of iPSC-derived islets in BDI / HCI (3c) and BDII / HCII / MDD (3e), where HCI / HCII / BDII is n=4 subjects; BDI is n=6; and MDD is n=5. Figure 3 d and Figure 3 f is the average ratio of stimulation to baseline insulin levels over 7 consecutive phases, where n = 7 consecutive phases.
[0146] Figure 4 The image shows the RORβ expression in pancreatic islet organoids derived from iPSCs in other samples from BD patients.
[0147] Figure 4 ac represents the immunoblotting (4a) and qRT-PCR quantification (4b and 4c) of RORβ protein expression in pancreatic islets and forebrain organoids of BDI / BDII patients, respectively; n = 4 (HCI), 6 (BDI), 5 (HCII / BDII)
[0148] Figure 4 The expression of RORβ mRNA in pancreatic islet organoids and forebrain organoids was analyzed by qRT-PCR. For pancreatic islet, n = 4 (HCI), 6 (BDI), 5 (HCII / BDII); forebrain, n = 3 (HCI), 5 (BDI / HCII / BDII).
[0149] Figure 5 The image shows the expression of RORβ in serum and cadaveric brain samples from BD patients.
[0150] Figure 5 a represents the expression of RORβ mRNA in the plasma of BD patients. The left figure shows the data for each subject; the right figure shows the statistical data for each group, n = 50 (BD), 24 (HC).
[0151] Figure 5 b represents the expression of RORβ mRNA in the post-mortem brain samples of BD patients. The left figure shows the data for each subject; the right figure shows the statistical data for each group, n=8 (BD), 16 (HC).
[0152] Figure 6 The image shows an ELISA analysis of insulin secretion from HCI / II iPSC-derived islets overexpressing RORβ.
[0153] Figure 6 a) Cells were stimulated three times with 2mM and 20mM glucose, respectively, and incubated for 30 minutes at each concentration. Then, they were depolarized with 60mM KCl. Insulin levels were measured. HC represents healthy individuals, RORβOE represents RORβ overexpression, and n = 8 subjects.
[0154] Figure 6 b represents the average GSIS level across the seven stimulation phases.
[0155] Figure 7 The image shows how RORβ shRNA reduces RORβ expression in iPSC-derived pancreatic islet organoids from BD patients; among them,
[0156] Figure 7 ad represents the glucose-stimulated / baseline insulin level ratio of BDI / BDII iPSC islets expressing RORβshRNA#2 (7a, 7c; n = 4 (HCI / HCII), 6 (BDI), 4 (BDII)) and mean GSIS (7b, 7d; n = 7 phase) in pancreatic organoids of the BDI (7a-7b) and BDII (7c-7d) groups.
[0157] Figure 8 The image shows a mouse model of pancreas-specific overexpression of RORβ, in which...
[0158] Figure 8 a is a schematic diagram of the AAV-based Cre / loxP conditioned CRISPRa system on RORβ (rAAV-EF1a-DIO-CRISPRa-mRORβ) and intravenous injection of AAV into Ins1CreERT mice.
[0159] Figure 8 b is an immunostaining image of AAV-carrying GFP in various tissues and organs of control mice;
[0160] Figure 8 cf represents the immunoblot (8c, 8e) and quantitative (8d, 8f) data of RORβ protein expression, n = 4.
[0161] Figure 9 The figure shows the changes in plasma insulin levels and phosphorylation levels of insulin receptors in the hippocampus of SG mice.
[0162] Figure 9 a represents the diurnal pattern of baseline plasma insulin in WT and sg mice;
[0163] Figure 9 bc, diurnal variation of plasma insulin levels in control (9b) and sg1 / 2 (9c) mice treated with glucose or saline; n = 3-4 distinct mice per group at each time point. Insulin was administered via intraperitoneal injection 30 minutes prior to blood sample collection. Two-way ANOVA with Sidak multiple comparison test;
[0164] Figure 9 dg represents the insulin expression and InsR phosphorylation levels at the peak (ZT19, 14pm) and trough (ZT11, 6am) of insulin in the hippocampus of mice in immunoblotting (9d, 9f) and quantitative (9e, 9g) mice, n=4.
[0165] Figure 10 The figure shows the behavioral characteristics of sg mice, among which,
[0166] Figure 10 ad represents the forced swimming test (FST) (10a; diurnal phase, n = 10 (Ctrl), 13 (sg1), 13 (sg2); nocturnal phase, n =
[0167] 20 / 13 / 13), Learned Helplessness (LH) (10b; diurnal phase, n=13 / 28; nocturnal phase, n=19 / 26), Sugar Water Preference Test (SPT)
[0168] (10d; n = 13 / 18) and light-dark box (LDB) (10c; diurnal phase, n = 20 / 11 / 10; nocturnal phase, n = 20 / 13 / 11) sg1 / 2 mice in light (white) and dark (gray) phases;
[0169] Figure 10 ef represents the total distance traveled by sg1 / 2 mice in the open field test (OFT) during the diurnal (10e; n=12) and nocturnal (10f; Ctrl, n=12; sg1 / 2, n=11) phases.
[0170] Figure 11 The figure shows the circadian rhythm of sg1 / 2 mice, where,
[0171] Figure 11 a is a representative single image of the voluntary rotation activities of the control group and sg1 / 2 mice in the light-dark (LD) and dark-dark (DD) cycles;
[0172] Figure 11 bc represents the average count (per 6 minutes) of wheel running activity over 7 days for LD(11b) or DD(11c) mice within 14 days. The count was increased in sg1 / 2 mice (n=5) compared to control mice.
[0173] Figure 11 d, the mean free run of the diurnal rhythm in the control group and sg1 / 2 mice, measured by the chi-square periodogram in DD for 7 days (n=5), showed similar period lengths in the control group and sg1 / 2 mice;
[0174] Figure 11 e represents the mean amplitude of the DD7 d motor activity rhythm analyzed using Fast Fourier Transform (FFT). Compared with control mice, the amplitude of sg1 / 2 mice was significantly increased (n=5).
[0175] Figure 12 The diagram shows that RORβ activation reduces pancreatic insulin release and induces depressive-like behavior.
[0176] Figure 12 a represents the ratio of glucose stimulation to baseline insulin level in sg1 / 2β cells expressing scrambled shRNA or mouse RORβshRNA, n = 4;
[0177] Figure 12 b. ELISA analysis of insulin levels in plasma (left panel; n=8) and cerebrospinal fluid (right panel; n=4);
[0178] Figure 12 c, Immunoblotting (left) and quantification (right) of InsR phosphorylation in mouse hippocampus, n=3;
[0179] Figure 12 d. In WT mice that received insulin or BMS-536924 brain infusion, continuous forced swimming test (FST) was performed at different time points at 30-minute intervals as a control group. An initial forced swimming test (FST) was performed 30 minutes before drug administration. n=6.
[0180] Figure 12 e, shown is peripheral or central administration of insulin (2UI / kg) and BMS-536924 (40mg / kg), followed by behavioral testing.
[0181] Figure 13 The figure shows the effect of the insulin receptor blocker BMS-536924 on depressive-like behavior in sg1 / 2 mice.
[0182] Figure 13 a represents the plasma insulin level in sg1 / 2 mice during the photoperiod, Ctrl, n = 22; SG1 / 2, n = 24;
[0183] Figure 13 b shows the FST of sg1 / 2 mice that received peripheral insulin injections, n = 12 / 9 / 9;
[0184] Figure 13 ce represents the results of the sugar water preference test (SPT) (13c; n = 10 / 9 / 10), light-dark box (LDB) (13d; n = 13 / 9 / 7), and learned helplessness (LH) (13e; n = 11 / 11 / 9) mice 30 minutes after peripheral insulin injection and brain infusion of BMS-536924.
[0185] Figure 13 f represents the effect of hippocampal infusion of BMS-536924 on plasma insulin concentration in sg1 / 2 mice, n = 5 (physiological saline), 5 (15 minutes), 4 (30 minutes).
[0186] Figure 14 The diagram shows the validation of the direct role of RORβ in biphasic-like behavior in sg1 / 2 mice.
[0187] Figure 14 a is a schematic diagram of insulin detection in sg mice after administration of 4-OA (3 mg / kg);
[0188] Figure 14 b represents the glucose-stimulated insulin level in sg1 / 2 plasma after 4-OA injection, n = 6 / 4 / 3 / 4;
[0189] Figure 14cd represents the FST (14c) and LDB (14d) of sg1 / 2 mice injected with 4-OA during the night phase, sg1 / 2, n=15; sg1 / 2+4-OA, n=14;
[0190] Figure 14 ef represents the FST (14e) and LDB (14f) of sg1 / 2 mice injected with 4-OA during the diurnal phase, sg1 / 2, n=15; sg1 / 2+4-OA, n=14.
[0191] Figure 15 The figure shows the effects of insulin receptor knockdown on behavior and peripheral insulin secretion in sg1 / 2 mice.
[0192] Figure 15 sg1 / 2 mice with InsR knockdown (KD) in the hippocampus showed a slightly reduced sucrose preference (left, n=14 (Ctrl), 13 (InsR KD)), a slightly increased FST immobility time (middle, n=13 / 15), and a significantly reduced LDB light box activity time during the dark phase (right, n=12 / 15). Ctrl, sg1 / 2 mice; InsR KD, sg1 / 2 mice with InsRKD.
[0193] Figure 15 b shows that sg1 / 2 mice with InsR KD in the hippocampus exhibit a significantly reduced sucrose preference in the light phase (left figure, n =
[0194] 13 / 12), increase the time the FST remains stationary (middle figure, n=15 / 15), and decrease the time the LDB experiment is active in the open box (right figure, n=14 / 15);
[0195] Figure 15 c represents the ELISA analysis of plasma insulin concentration in sg1 / 2 mice with InsR KD in the hippocampus, n=5. Detailed Implementation
[0196] Unless otherwise defined, all scientific and technical terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art.
[0197] All publications, patents, and published patent specifications cited in this article are incorporated herein in their entirety through citation.
[0198] The above text is an exemplary description of the technical solution of the present invention. The technical solution of the present invention will be further described clearly and completely below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. Based on the description in this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.
[0199] Example 1: Insulin signaling defects in forebrain organoids differentiated from iPSCs in BD patients
[0200] We recruited 5 patients with bipolar disorder (BDII), 5 patients with major depressive disorder (MDD), and 5 healthy controls (HCII), and established an iPSC model for the subjects using Sendai virus infection.
[0201] We used a previously reported rotating bioreactor system (Qian, X., et al. Brain-Region-Specific Organoids Using Mini-bioreactors for Modeling ZIKV Exposure. Cell 165, 1238-1254 (2016)) to differentiate iPSCs into forebrain organoids. Figure 1 a).
[0202] Samples were collected on day 84 for further experiments. In mature forebrain organoids, both the patient and control groups showed tissue expression of deep and upper cortical neuronal markers such as CTIP2, TBR1, BRN2, and SATB2 from the apex to the pia mater surface, and exhibited normal Na+ expression. + / K + Current and action potential (AP) discharge ( Figure 1 b, c).
[0203] Quantitative analysis of the thickness of the apical and basal surfaces of forebrain organoids in the three groups, as well as the percentage of TBR1+, CTIP2+, SATB2+, and BRN2+ cells in the total Dapi+ nuclei of forebrain organoids, showed that, compared with the HCII group, the BDII and MDD groups of forebrain organoids exhibited similar thickness and neuronal composition between the apical and basal surfaces. Figure 1 d, e).
[0204] Then, we performed RNA-seq analysis on three subjects in each group (one cell line per subject). Compared with the HCII group, 1636 genes in the BDII group and 1568 genes in the MDD group showed differential expression, |log2 (fold change)|>1, p<0.05. Figure 1f). KEGG pathway analysis showed that differentially expressed genes in the BDII group were enriched in 33 pathways (see Table 1):
[0205] Table 1: Aberrant signaling pathways in forebrain organoids from BDII patients as revealed by KEGG analysis.
[0206]
[0207]
[0208] Note: "Count": The number of genes differentially expressed in BDII neurons for each term.
[0209] This includes the insulin secretion pathway, which was not detected in the MDD group. Figure 1 g, h; Table 2).
[0210] Table 2: KEGG pathway showed similar differential expression in BDII and MDD forebrain organoids.
[0211]
[0212] Figure 1 i shows parallel abnormal pathways between BDII organoids and BDIDG neurons, both of which include the insulin secretion pathway.
[0213] It is evident that the insulin secretion pathway may be BD-specific.
[0214] Example 2: Pancreatic islet organoids differentiated from iPSCs in BD patients showed insulin deficiency.
[0215] To investigate whether insulin secretion abnormalities exist in patient iPSC models, we used a recently developed protocol (Cogger, KF, et al. Glycoprotein 2 is a specific cell surface marker of human pancreatic progenitors. Nature Communications 8, 331 (2017)) to differentiate iPSCs from 5 BDII patients, 5 MDD patients, and 5 HCII subjects, as well as previously reprogrammed iPSCs from 6 BDI patients and 4 HCI subjects, into pancreatic islet organoids containing insulin-producing β-like cells. Figure 2 a).
[0216] Immunofluorescence and qRT-PCR analysis showed that iPSC-differentiated pancreatic islet organoids significantly expressed β-cell markers, such as C-peptide and NKX6.1. Figure 2 b).
[0217] We observed significant differences in gene expression among individuals within each group. Furthermore, based on NKX6.1... + / C-peptide + Flow cytometry analysis showed that the patient group and the control group exhibited approximately 20% similar differentiation rates. Figure 2 c, d).
[0218] Meanwhile, we directly observed insulin-containing granules in iPSC-differentiated cells using electron microscopy (EM), indicating that pancreatic islet organoids differentiated and matured, and that there was no developmental difference between HC and BD.
[0219] The above experimental results indicate that the differentiation of pancreatic organoids was successful.
[0220] We then examined the function of pancreatic organoids.
[0221] ELISA analysis confirmed that the islet organoids differentiated from iPSCs in the HC group showed glucose-stimulated insulin secretion (GSIS) levels comparable to those of β cells in WT mice.
[0222] Ca 2+ Imaging analysis showed that iPSC-differentiated cells exhibited calcium deficiency upon glucose stimulation. 2+ The instantaneous release.
[0223] We compared the function of pancreatic islet organoids in the HC and BD groups and found that, compared with the control group, the expression of insulin protein in cells of both the BDI and BDII groups was significantly reduced, while the MDD group showed only slight changes. Figure 3 ab).
[0224] Furthermore, cells were sequentially challenged three times with 2 and 20 mM glucose, incubated for 30 minutes at each concentration, and then depolarized with 60 mM KCl. ELISA analysis also revealed that, compared to the HCI / II group, pancreatic islet organoids in the BDI / BDII group showed reduced GSIS in response to consecutive low / high glucose concentrations (3c and 3d), while pancreatic islet organoids in the MDD group did not show similar behavior. Figure 3 (e and 3f). This result is consistent with previous RNA-seq findings, namely that abnormalities in the pancreatic secretion pathway were observed in both the forebrain organoids and pancreatic organoids differentiated from iPSCs in the BD group, while no such abnormality was observed in the forebrain organoids and pancreatic organoids differentiated from iPSCs in the MDD group.
[0225] Example 3: Abnormal RORβ expression in pancreatic islet organoids differentiated from iPSCs in BD patients
[0226] Next, we aimed to investigate the molecular mechanisms of insulin deficiency in islet organoids differentiated from iPSCs of BD patients. We collected a list of genes associated with BD susceptibility from the MalaCards Human Disease Database (https: / / www.malacards.org) and compared the expression of several genes in forebrain and islet organoids from iPSCs of 5 BDII, 5 HCII, 6 BDI, and 4 HCI patients. We used the following criteria when screening candidate genes for further investigation into the role of pancreatic insulin signaling in the etiology of BD: the gene should show aberrant expression only in islet organoids but remain normally expressed in forebrain organoids. Among the screened candidate genes, both immunoblotting and qRT-PCR analysis showed that, compared with the HCI / HCII group, the BDI / BDII group may have increased expression of the circadian rhythm transcription factor RORβ in islet organoids. Figure 4 a, b, d). Conversely, in forebrain organoids and DG-like neurons, RORβ expression remained unchanged in the patient group. Figure 4 (a, c, e). Therefore, we chose the RORβ gene for further research.
[0227] To investigate whether the abnormal expression of RORβ in pancreatic islet organoids differentiated from iPSCs in BD patients was also present in other BD patient samples, we performed qRT-PCR analysis to determine the expression of RORβ in plasma and postmortem forebrain samples from BD patients.
[0228] The primer sequences for RORβ are as follows:
[0229] RORβ (human) upstream primer: 5'-CAATGGGCAGTTAGCACCAG-3' (SEQ ID No. 1),
[0230] RORβ (human) downstream primer: 5'-TGCTTCCCTGGACTTGCTTT-3' (SEQ ID No. 2).
[0231] We measured RORβ mRNA levels in the plasma of 50 BD patients and 24 healthy controls, and found that most patients had increased RORβ mRNA levels compared to healthy controls. Figure 5 a). We also measured RORβ expression in postmortem anterior brain samples from 8 BD patients and 16 healthy controls. The results showed no significant difference between the healthy group and the BD group. Figure 5 b). Therefore, RORβ may be aberrantly expressed in the periphery of BD patients but not in the brain, which supports our findings in organoids differentiated from iPSCs in patients.
[0232] In the forebrain samples of the MDD group, the expression level of RORβ was not significantly different from that of the control group (results not shown).
[0233] Next, we investigated whether RORβ plays a role in insulin secretion defects in islet organoids differentiated from iPSCs in patients. We induced exogenous RORβ expression in islet organoids from the HCI / II group via lentiviral infection. ELISA analysis showed that RORβ overexpression reduced insulin release (…). Figure 6 a, b).
[0234] Subsequently, we expressed RORβ-specific shRNA in islet organoids differentiated from iPSCs in BD patients via lentiviral infection.
[0235] The shRNA sequence is as follows:
[0236] RORB-shRNA1:3'-CCGGCCCACAACCTATGAAGAAATTACTCGAGTAATTTCTTCATAGGTGTGGGTTTTT-5'(SEQ IDNo.6)
[0237] RORB-shRNA2:3'-CCGGCCGTGCCTTCAACCCATTAAACTCGAGTTTAATGGGTTGAAGGCACGGTTTTT-5'(SEQ IDNo.7)
[0238] ELISA analysis showed that, compared with the HCI / HCII group, pancreatic islet organoids from BDI / BDII patients and pancreatic islet organoids expressing non-functional shRNAs from the control group (BDII+Scr) still showed lower GSIS, while BD islet organoids expressing RORβshRNAs did not show significant changes. Figure 7 (Note: The figure only shows the results for RORB-shRNA2; the results for RORB-shRNA1 are essentially the same.)
[0239] In summary, our results suggest that RORβ expression levels may be elevated in the plasma of BD patients and in islet organoids differentiated from iPSCs in BD patients, while reducing RORβ expression levels in islet organoids differentiated from iPSCs in BD patients can alleviate the insulin secretion defects they exhibit.
[0240] The above results suggest at the tissue and organ levels that RORβ can serve as a target for diagnosis and drug screening in BD patients.
[0241] RORβ is detected using a RORβ assay kit; elevated RORβ expression is indicated by BD. The assay kit can be a gene-level kit, such as primers, or a protein-level kit, such as antibodies.
[0242] In normal organoids, overexpression of RORβ produces the same insulin secretion deficiency manifestations as BD, indicating that RORβ overexpression in organoids can establish a BD disease model, which can then be used to screen for drugs targeting BD, i.e., using RORβ as a drug target for BD treatment. For example, candidate drugs that reduce RORβ expression levels can alleviate the insulin secretion deficiency exhibited by BD and can serve as target drugs for BD treatment. These target drugs can include gene-level inhibitors, such as RORβ shRNA, or protein-level inhibitors, such as RORβ inhibitors, etc.
[0243] RORβ shRNA, which targets RORβ, can alleviate insulin secretion defects in BD patients.
[0244] Example 4: Mice with pancreatic RORβ overexpression exhibited diurnal fluctuations in insulin secretion and behavior.
[0245] To investigate whether pancreatic overexpression of RORβ affects neuropsychiatric-like behavior, we designed an AAV-based Cre / loxP conditional CRISPR activation (CRISPRa) system (rAAV-EF1a-DIO-CRISPRa-mRORβ) that specifically targets the RORβ gene. This AAV was then injected intravenously into an Ins1 receptor that can be activated by tamoxifen. CreERT In mice ( Figure 8 a).
[0246] CreERT encodes a Cre recombinase (Cre) fused to a mutant estrogen ligand-binding domain (ERT), which can be activated by tamoxifen to express Cre. Upon injection of tamoxifen into Ins1CreERT mice, Cre is specifically expressed in pancreatic β cells, and then the DIO site is cleaved to reverse the reverse cDNA sequence of a Cas9 mutant with DNA cleavage activity deficiency (dCas9), thereby activating the CRISPRa system. CRISPRa functions by fusing dCas9 into the co-activation mediator (SAM) system.
[0247] Following tamoxifen injection, Cre recombinase specifically induced endogenous RORβ gene expression in β cells. We designed two guide RNAs (sg1 and sg2) to express the gene in Ins1. CreERTRORβ was specifically overexpressed in the pancreas of mice (i.e., sg1 / 2 mice or sg1 / sg2 mice), and another group of littermates were injected with AAV encoding a conditionally enhanced GFP expression system (rAAV-EF1a-DIO-EGFP) as a control.
[0248] We designed the AAV-DIO-CRISPRa expression vector based on the rAAV-CMV-DIO-hM3D(Gq)-mcherry-WPRE-hGH polyA vector (BrainVTA, Wuhan Primitive Brain Science Technology Co., Ltd.). The CMV promoter was replaced with EF1α, and hM3D(Gq)-mcherry-WPRE was replaced with VP64-NLS-dSaCas9. To facilitate subsequent TIRFM experiments, GFP was removed from the vector. The control vector contained nonsense sequences instead of RORβ sgRNA and carried an EGFP (Enhanced Green Fluorescent Protein) sequence for subsequent pancreas-specific identification.
[0249] The sgRNA sequence is as follows:
[0250] sgRNA1: 5'-TCCCCAGACTCTCCACGCGCT-3' (SEQ ID No. 3);
[0251] sgRNA2: 5'-ATCAGCGTCCCGCAGCGCGTG-3' (SEQ ID No. 4).
[0252] Two weeks later, we dissected the GFP group mice and found that GFP was expressed only in the pancreas. Figure 8 b). We noted that very weak GFP fluorescence was also observed in the spleen, which is closely connected to the pancreas, but no fluorescence expression was found in other organs examined, including the heart, kidneys, liver, and lungs.
[0253] The expression level of RORβ in sg1 / 2 mice was examined, and it was found that compared with the GFP control group, RORβ expression in sg1 / 2 mice was enhanced only in the pancreas, but not in other organs such as the brain. Figure 8 Therefore, we have verified that this AAV-based conditional expression system is pancreas-specific.
[0254] Subsequently, we monitored plasma basal insulin levels and glucose-induced changes in plasma insulin levels in mice over a full 24-hour period. We found that both the sg1 / 2 group and the control group exhibited fluctuating insulin rhythms, but these rhythms were exactly opposite. In the control group, plasma basal insulin levels peaked during the diurnal phase and reached their lowest point during the nocturnal phase, consistent with previous studies (see Honma, K., Hikosaka, M., Mochizuki, K. & Goda, T. Loss of circadian rhythm of circulating insulin concentration induced by high-fat diet intake is associated with disrupted rhythmic expression of circadian clock genes in the liver. Metabolism 65, 482-491 (2016).). However, the sg1 / 2 mice showed the opposite pattern, with peak plasma basal insulin levels occurring during the nocturnal phase and the lowest point during the diurnal phase. Figure 9 a). Furthermore, compared to the control group, sg1 / 2 mice exhibited lower plasma insulin levels and GSIS capacity during the diurnal phase, while showing higher insulin secretion levels during the nocturnal phase. Figure 9 bc).
[0255] Because performing ELISA in brain tissue is challenging, we performed immunoblotting analysis to determine insulin and InsR phosphorylation levels in the hippocampus of sg1 / 2 mice. We found that, compared to the control group, insulin and InsR phosphorylation levels in sg1 / 2 mice increased at peak plasma insulin levels and decreased at their nadir. Figure 9 We noticed that the expression of InsRs shows the opposite trend (de). Figure 9 This (fg) may be due to steady-state regulation.
[0256] We then evaluated the behavioral performance of the sg1 / 2 mice. Stress responses were assessed using the forced swimming test (FST) and learned helplessness test (LH), while anhedonia and anxiety levels were assessed using the sugar water preference test (SPT) and the light-dark box test (LDB), respectively. In the diurnal phase, compared to littermate GFP controls, sg1 and sg2 mice exhibited increased LH escape failure rates and FST resting times, and decreased sugar water preference rates and LDB time spent in the light box. Interestingly, in the nocturnal phase, compared to the GFP control group, sg1 / sg2 mice showed decreased LH escape failure rates, decreased FST resting times, and increased sugar water preference rates. Figure 10These behavioral phenotypes conform to the criteria for manic-like behavior in rodent models (see Logan, RW & McClung, CA Animal models of bipolar mania: The past, present and future. Neuroscience 321, 163-188 (2016)). In the LDB test, the increased time spent in the bright box by sg1 / sg2 mice indicated a reduction in anxiety-like behavior. Figure 10 d). Furthermore, these behavioral abnormalities were not due to motor deficits, as sg1 / sg2 mice and control mice exhibited similar motor activity ( Figure 10 e, f).
[0257] In addition, we monitored the circadian rhythm of sg1 / 2 mice by continuously recording their use of the self-motivated running wheel. Mice were housed in a 12L:12D diet for 14 days, then transferred to constant darkness for 7 days. White shading indicated light on, while gray shading indicated light off. Figure 11 a). Compared with the control group, the circadian rhythm pattern of sg1 / 2 mice did not change; however, the sg1 / 2 mice showed increased activity in using the running wheel and an increased amplitude of their circadian rhythm. Figure 11 The results indicate that the activity patterns of the sg1 / 2 mice have changed.
[0258] In summary, our findings indicate that, at the animal level, pancreatic RORβ overexpression can induce abnormal diurnal variations in basal plasma insulin levels and glucose-induced plasma insulin levels in mice, while also causing abnormal fluctuations in mouse behavior in accordance with diurnal rhythms, similar to the behavioral manifestations of bipolar disorder (BD). This can be used to construct a BD disease model.
[0259] Example 5: Activation of RORβ directly induced decreased diurnal insulin release and depressive-like behavior.
[0260] To investigate how RORβ affects the behavior of sg1 / sg2 mice, we first examined the direct effect of RORβ on insulin release in cultured β cells. Similar to results in iPSC-differentiated pancreatic islet organoids, β cells overexpressing RORβ showed reduced gastrointestinal systolic spectroscopy (GSIS) compared to the control group, and GSIS was restored in sg1 / 2 mice after reducing RORβ expression in these mice via lentiviral expression of mouse-specific shRNA3. Figure 12 a) In this study, the shRNA3 lentiviral packaging was performed using a three-plasmid packaging system via transfection into 293FT cells. The sequence of shRNA3 is:
[0261] shRNA3: 3'-
[0262] CCGGGCATTTGACTTTGCGAAGAATCTCGAGATTCTTCGCAAAGTCAAATGCTTTTT-5' (SEQ ID No. 8).
[0263] These results confirm that RORβ plays an important role in insulin release from the pancreas. To assess the direct impact of insulin dysfunction on mouse behavior, we injected insulin or the insulin receptor (InsR) inhibitor BMS-536924 into the dentate gyrus (DG) of the hippocampus in WT mice via an implanted cannula. The DG region is rich in InsR and associated with depression (see Medrihan, L., et al. Initiation of Behavioral Response to Antidepressants by Cholecystokinin Neurons of the Dentate Gyrus. Neuron (2017).). Thirty minutes after insulin injection, insulin concentrations in mouse plasma and cerebrospinal fluid (CSF) increased ( Figure 12 b) Phosphorylation levels of InsRs (pInsRs) in DG neurons are upregulated. Figure 12 c).
[0264] Conversely, BMS-536924 injection reduced pInsR levels in DG. We assessed the effects of these two sets of experiments on mouse behavior using a series of consecutive FST experiments. At 30 minutes after injection, compared to the solvent control group, mice injected with insulin showed a significantly reduced resting time, while animals injected with BMS-536924 showed an increased resting time. Figure 12 d). To avoid the negative effects of repeated FST on mice, we conducted another single FST experiment and obtained the same results; furthermore, pre-injection of BMS-536924 blocked insulin stimulation of the peripheral nervous system and brain. Figure 12 e). In summary, these results suggest that insulin may directly regulate mouse behavior by acting on insulin receptors in the brain.
[0265] During the diurnal phase, plasma insulin levels in sg1 / 2 mice were lower than those in their littermates (control mice). Figure 13 a) This is consistent with the reduced GSIS in islet organoids differentiated from iPSCs in patients. We tested whether modulating insulin signaling in sg1 / sg2 mice affected their diurnal depressive-like behavior. Figure 13 b). Peripheral or intracerebral injection of insulin can alleviate the prolonged resting time in sg1 / 2 mice during the FST experiment. Figure 13b). The results for LH, LDB, and SPT also indicated that peripheral and intracerebral injection of insulin in sg1 / 2 mice reduced the LH escape failure rate and increased the time LDB remained in the light box and the sucrose preference rate, while intracerebral infusion of BMS-536924 neutralized the effect of insulin. Figure 13 Furthermore, during the diurnal phase, brain injection of BMS-536924 into the hippocampus of sg1 / 2 mice further increased their FST resting time and decreased their sucrose preference rate. Figure 13 c) indicates that the effect of BMS-536922 is in the same direction as that of RORβ overexpression. Interestingly, we observed that BMS-536924 infusion can stimulate insulin secretion from the pancreas ( Figure 13 f). Although the enhanced insulin release may have a smaller impact on mouse behavior because BMS-536924 can still block InsRs in the hippocampus, this observation suggests that the pancreas-brain feedback system may play a role in maintaining insulin signal homeostasis in the islets of Langerhans.
[0266] To verify the direct role of RORβ in depressive-like behavior during the diurnal phase in sg1 / 2 mice, we administered the RORβ antagonist all-trans-4-oxyretinoic acid (4-OA) intraperitoneally to sg1 / 2 mice during the diurnal phase. Figure 14 a). The results showed that sg1 / 2 mice injected with 4-OA had increased plasma insulin levels and time spent in the LDB test chamber, and decreased FST resting time (a). Figure 14 Therefore, reducing RORβ activity can alleviate diurnal phenotypic abnormalities and improve depressive-like symptoms in sg1 / 2 mice. Furthermore, 12 hours after diurnal administration, we examined the nocturnal behavior of sg1 / 2 mice and found that the time spent in the LDB light box was reduced, while the FST resting time was increased (bd). Figure 14 The result (ef) indicates that the manic-like behavior of the nocturnal phase was also improved.
[0267] In addition to pharmacological methods, we also knocked down (KD)InsRs expression by expressing InsRsshRNA in the hippocampus of sg1 / 2 mice through lentiviral infection.
[0268] InsRs shRNA: 3'-
[0269] CCGGCGTCTGGCTATACCATGAATTCTCGAGAATTCATGGTATAGCCAGACGTTTTT-5'(SEQIDNo.5)
[0270] We found that InsR-KD sg1 / 2 mice exhibited significant depressive-like behavior during the diurnal phase, while during the nocturnal phase, the behavior of sg1 / 2 mice was no longer manic-like, and even slightly depressive. Figure 15 a, b). These results further confirm that the diurnal depressive-like behavior in sg1 / 2 mice may be directly caused by insulin dysfunction. Silencing InsR expression during the diurnal phase restored basal plasma insulin levels and enhanced GSIS capacity in mice. Figure 15 c) This means that disrupting the insulin pathway in the brain may induce homeostatic regulation of peripheral insulin secretion.
[0271] In summary, our results suggest that the depressive-like behavioral phenotype is likely primarily a result of pancreatic insulin secretion disorder induced by RORβ overexpression.
[0272] In animal models, overexpression of RORβ can induce insulin secretion defects, and the animals exhibit BD-like behaviors, thus serving as an animal model of BD. Reducing RORβ in animals that overexpress RORβ can alleviate insulin secretion defects and improve BD behavior.
[0273] The above animal experiments further demonstrate that RORβ can serve as a diagnostic and drug target for BD.
[0274] Reagents screened with RORβ as the target, such as the RORβ antagonist all-trans-4-oxyretinoic acid (4-OA) and shRNA drugs containing RORβ, have therapeutic effects on BD.
[0275] The above results also mean that modulators of the above biomarkers that downregulate RORβ levels and / or inhibit RORβ function and promote insulin function can be used to treat BD, such as the RORβ antagonist all-trans-4-oxyretinoic acid (4-OA), RORβ-containing shRNA drugs, etc.
[0276] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
[0277] The foregoing embodiments and methods described in this invention may vary based on the capabilities, experience, and preferences of those skilled in the art.
[0278] Listing the steps of the method in a certain order in this invention does not constitute any restriction on the order of the method steps.
Claims
1. The use of a biomarker in the preparation of diagnostic products for bipolar disorder (BD), drugs for the treatment and / or prevention of BD-related diseases, and in the screening of drugs for the treatment and / or prevention of BD-related diseases, characterized in that, The biomarkers mentioned include the transcription factor (RORβ) of retinoic acid-related orphan receptor β.
2. The application according to claim 1, characterized in that, The biomarker is a detection target of the diagnostic product or a therapeutic, preventive, and / or screening target of the drug.
3. A reagent for detecting a biomarker, characterized in that, The biomarkers mentioned include RORβ.
4. The detection reagent according to claim 3, characterized in that, The detection reagents include detection reagents for biomarker genes or protein levels; the gene-level detection reagents include qualitative, semi-quantitative, and / or quantitative detection reagents for the DNA and / or mRNA of the biomarker; and the protein-level detection reagents include antibodies, antibody fragments, and high-affinity polymers that specifically bind to the full-length protein or fragments of the biomarker.
5. The detection reagent according to claim 3, characterized in that, The detection reagent includes RORβ primers, and the nucleotide sequence of the RORβ primers includes: F:5'-CAATGGGCAGTTAGCACCAG-3' (SEQ ID No. 1); R: 5'-TGCTTCCCTGGACTTGCTTT-3' (SEQ ID No. 2).
6. The use of the detection reagent according to any one of claims 3-5 in the preparation of diagnostic products for bipolar disorder-related diseases.
7. The application according to claim 6, characterized in that, The detection reagent is used to detect biomarkers in the sample to be tested, and the diagnostic product includes a diagnostic kit, a diagnostic chip and / or a diagnostic system, or the sample to be tested is derived from body fluids, tissues and / or organs.
8. A diagnostic product, characterized in that, The diagnostic product includes the detection reagents as described in any one of claims 3-5.
9. The diagnostic product according to claim 8, characterized in that, The diagnostic products include diagnostic kits, diagnostic chips, and / or diagnostic systems.
10. The diagnostic product according to claim 9, characterized in that, The diagnostic product is a diagnostic kit, which includes PCR, qRT-PCR, qPCR, RNA-seq analysis kits, ELISA kits, immunoblotting detection kits, immunohistochemistry detection kits, immunochromatographic detection kits, electrochemiluminescence detection kits, or flow cytometry analysis kits formed using the detection reagents of any one of claims 3-5. or, The diagnostic product is a diagnostic system, which includes: (1) Detection unit: The detection unit is used to detect biomarkers, the biomarkers including RORβ, and the detection unit includes the detection reagent of any one of claims 3-5; (2) Result judgment unit: The result judgment unit is used to output the risk of having BD-related diseases based on the detection results of the biomarkers obtained by the detection unit.
11. A method for screening drugs, characterized in that, The screening method includes evaluating the moderating effect of candidate substances on biomarkers of subjects, including RORβ, wherein the candidate substances downregulate RORβ levels and / or inhibit RORβ function as drugs for the treatment and / or prevention of BD-related diseases.
12. A method for establishing a BD disease model, characterized in that, The establishment method includes constructing non-human animal bodies that overexpress and / or upregulate RORβ.
13. The method for establishing according to claim 12, characterized in that, The establishment method includes constructing a RORβ overexpression vector.
14. The method for establishing according to claim 13, characterized in that, The RORβ overexpression vector includes a guide RNA (sgRNA) for RORβ, and the nucleotide sequence of the sgRNA includes: sgRNA1: 5'-TCCCCAGACTCTCCACGCGCT-3' (SEQ ID No. 3); sgRNA2: 5'-ATCAGCGTCCCGCAGCGCGTG-3' (SEQ ID No. 4).
15. The method for establishing according to claim 13 or 14, characterized in that, The RORβ overexpression vector is pancreatic specific.
16. The method for establishing according to claim 15, characterized in that, The RORβ overexpression vector includes an AAV-based Cre / loxP conditional CRISPR activation (CRISPRa) system.
17. The use of RORβ modulators in the preparation of medicaments for the treatment and / or prevention of BD-related diseases, characterized in that, The RORβ regulator downregulates the RORβ content and / or inhibits the function of RORβ.
18. The application according to claim 17, characterized in that, The regulator of RORβ includes an shRNA that downregulates RORβ expression, the nucleotide sequence of which includes: RORβ-shRNA1:3'- CCGGCCCACAACCTATGAAGAAATTACTCGAGTAATTTCTTCATAGGTGTGGGTTTTT-5' (SEQ IDNo. 6); RORβ-shRNA2:3'- CCGGCCGTGCCTTCAACCCATTAAACTCGAGTTTAATGGGTTGAAGGCACGGTTTTT-5'(SEQ IDNo.7); or, RORβ-shRNA3: 3'-CCGGGCATTTGACTTTGCGAAGAATCTCGAGATTCTTCGCAAAGTCAAATGCTTTTT-5' (SEQ ID No. 8), or, The regulators of RORβ include the RORβ antagonist all-trans-4-oxoretinoic acid.