Recombinant tannase mutant, coding gene, genetically engineered bacterium and application thereof

Abstract

The invention relates to the technical field of genetic engineering and protein engineering modification, in particular to a recombinant tannase mutant, a coding gene, a genetically engineered bacterium and application of the recombinant tannase mutant, the coding gene and the genetically engineered bacterium, and the mutant is obtained by performing single-point or multi-point combined mutation on the 102nd site, the 163rd site or the 437th site of an amino acid sequence shown in SEQ ID NO.1. The constructed aspergillus niger engineering bacterium can be used for producing the tannase mutant through fermentation, and the enzyme activity of the aspergillus niger engineering bacterium is remarkably improved compared with the enzyme activity (120.01 U / mL) of non-mutated wild type tannase and reaches 234.98 U / mL. When the tannase mutant is used for catalyzing tara tannin hydrolysis to produce gallic acid, the yield is up to 69.82% and is 2.07 times that of wild type tannase, and the tannase mutant has a good industrial application prospect.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and protein engineering technology, specifically relating to a recombinant tanninase mutant, its encoding gene, genetically engineered bacteria, and their applications. Background Technology

[0002] Tannins, also known as tannins, are a class of complex polyphenolic compounds widely found in plants, with molecular weights ranging from 500 Da to 3000 Da, and are known as "plant polyphenols." Based on their chemical structure and stability, tannins are generally divided into two main categories: hydrolyzable tannins and condensed tannins. Hydrolyzable tannins, depending on their hydrolysis products, can be further classified into gallic tannins and ellagitannins. Taratannins, derived from the pods of the tara bean, belong to the gallic tannin category.

[0003] Tanninase (EC 3.1.1.20), also known as tannic acidase, is a tannic acyl hydrolase that catalyzes the hydrolysis of ester bonds in tannins and gallic esters, releasing free gallic acid, ellagic acid, and other small-molecule polyphenols. Under the catalysis of this enzyme, taratanine can be completely hydrolyzed to produce gallic acid and quinic acid. Gallic acid, as an important fine chemical, has been widely used in the food, pharmaceutical, and chemical industries. Compared with acid or alkaline methods, the bio-enzymatic synthesis of gallic acid has significant advantages such as mild reaction conditions and less environmental pollution, aligning with the development direction of green chemistry.

[0004] Tanninases are found in tannin-rich plants, and the microorganisms that produce them are abundant, mainly including *Aspergillus*, *Penicillium*, and *Rhizopus*. Most early research focused on screening natural wild-type fungi capable of producing tanninases and using methods such as fermentation optimization and mutagenesis breeding to improve the enzyme activity of the tanninases produced by these strains. However, these methods suffer from high cost and low efficiency, and the complex enzyme systems produced by wild-type fungal fermentation severely restrict the industrial production of these enzymes. With the development of modern biotechnology, researchers have begun to utilize molecular biology techniques to promote the efficient production of these enzymes. *Aspergillus niger*, with its excellent expression and secretion capabilities, high safety, and low production cost, has become an excellent chassis cell for protein expression and is widely used in the fermentation industry. However, tanninases are diverse, and the catalytic properties of tanninases from different sources vary considerably. Furthermore, the substrate specificity of tanninases expressed by recombinant strains also differs significantly, thus presenting a problem of inefficiently hydrolyzing tararatanin to prepare gallic acid.

[0005] Therefore, there is an urgent need to construct a strain with high enzyme activity that can efficiently hydrolyze tararatanin to prepare gallic acid. Summary of the Invention

[0006] To overcome the shortcomings of existing technologies, this invention provides a recombinant tanninase mutant, encoding gene, genetically engineered bacteria, and their applications, which solve the problem that the tanninase expressed by current recombinant strains cannot efficiently hydrolyze tararatanin to prepare gallic acid.

[0007] To solve the above problems, the technical solution adopted in this application is:

[0008] A first aspect of the present invention is to provide a recombinant tanninase mutant obtained by single-point or multi-point combination mutation of the amino acid sequence shown in SEQ ID NO. 1 at position 102, position 163 or position 437.

[0009] Preferably, the mutant is an amino acid sequence shown in SEQ ID NO.1 that has been mutated to one of the following:

[0010] (1) The A at position 102 mutates into D;

[0011] (2) The D at position 163 mutates to N;

[0012] (3) The D at position 437 mutates to E;

[0013] (4) The A at position 102 mutates to D, and the D at position 163 mutates to N;

[0014] (5) The D at position 163 mutates to N, and the D at position 437 mutates to E;

[0015] (6) The A at position 102 mutates to D, and the D at position 437 mutates to E;

[0016] (7) The A at position 102 mutates to D, the D at position 163 mutates to N, and the D at position 437 mutates to E.

[0017] A second aspect of the present invention is to provide a gene encoding the recombinant tanninase mutant.

[0018] Preferably, the encoding gene is derived from Aspergillus niger WZ001.

[0019] Preferably, the nucleotide sequence of the encoding gene is shown in SEQ ID NO.2.

[0020] A third aspect of the present invention is to provide a recombinant expression vector comprising the coding gene of the recombinant tanninase mutant.

[0021] A fourth aspect of the present invention is to provide a genetically engineered bacterium comprising the coding gene of the recombinant tanninase mutant or the recombinant expression vector.

[0022] The fifth aspect of the present invention is to provide a method for constructing the genetically engineered bacteria, comprising the following steps: integrating the coding gene of the recombinant tanninase mutant or the linearized expression fragment of the recombinant plasmid into the host bacteria by means of PEG-mediated protoplast transformation.

[0023] Preferably, the host bacterium is Aspergillus niger NBB12.

[0024] A sixth aspect of the present invention is to provide the application of the recombinant tanninase mutant or the genetically engineered bacteria described herein in the catalytic hydrolysis of taratanine.

[0025] Preferably, the method of application is as follows: using the crude enzyme solution after fermentation and centrifugation of the genetically engineered bacteria as a catalyst, taratanine as a substrate, and ddH2O as a solvent to prepare a reaction system, reacting at 45℃ and 300 rpm for 1~10 h, then boiling to inactivate the enzyme solution, separating and purifying to obtain the product gallic acid; during the reaction, the pH value of the reaction system is 5.0.

[0026] Preferably, the tannic acid content in the taratin is 80% or more.

[0027] Preferably, the catalyst preparation method is as follows: the genetically engineered bacteria are inoculated on a PDA plate and activated at 30°C for 4 days. Spores of 1 cm × 1 cm size are inoculated into modified Martin medium and cultured at 30°C and 200 rpm for 24 h. The seed culture is then transferred to the fermentation medium at a volume concentration of 10% and fermented at 30°C and 200 rpm for 7 days. After centrifugation at 12000 rpm for 10 min, the supernatant is collected to obtain the crude enzyme solution of the recombinant tannin enzyme mutant.

[0028] Compared with the prior art, the beneficial effects of this application are:

[0029] This invention constructs an engineered Aspergillus niger strain capable of efficiently expressing recombinant tanninase mutants. The produced recombinant tanninase mutants, Tan-A102D-D163N and Tan-A102D-D163N-D437E, exhibit significantly higher enzyme activities than the wild-type enzyme (120.01 U / mL), reaching 211.37 U / mL and 234.98 U / mL, respectively. The mutant Tan-A102D-D163N-D437E can efficiently catalyze the hydrolysis of taratanine to gallic acid, with a maximum yield of 69.82%, which is 2.07 times that of the wild-type tanninase. This promotes the specific hydrolysis of taratanine by tanninase, which is beneficial for the subsequent industrial application of enzymatic catalysis in the preparation of gallic acid from taratanine. Attached Figure Description

[0030] Figure 1 Electrophoresis results of the tanninase gene tan.

[0031] Figure 2 Image of pUC57-PamyA-tan-TcbhI-pyrG plasmid.

[0032] Figure 3 Electrophoresis results of PCR identification of Aspergillus niger positive transformants.

[0033] Figure 4 HPLC chromatogram of gallic acid standard. Detailed Implementation

[0034] The following specific examples illustrate the implementation of this application. Those skilled in the art can easily understand other advantages and effects of this application from the content disclosed in this specification. This application can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of this application.

[0035] It should be noted that the process equipment or apparatus not specifically mentioned in the following embodiments are all conventional equipment or apparatus in the art.

[0036] Furthermore, it should be understood that the existence of other method steps before or after the combined steps, or the insertion of other method steps between these explicitly mentioned steps, does not preclude the existence of other method steps before or after the combined steps, or the insertion of other method steps between these explicitly mentioned steps, unless otherwise stated. It should also be understood that the combined connection relationship between one or more devices / apparatus mentioned in this invention does not preclude the existence of other devices / apparatus before or after the combined devices / apparatus, or the insertion of other devices / apparatus between these explicitly mentioned devices / apparatus, unless otherwise stated. Moreover, unless otherwise stated, the numbering of each method step is merely a convenient tool for identifying each method step, and not for limiting the order of the method steps or limiting the scope of the invention. Changes or adjustments to their relative relationships, without substantially altering the technical content, should also be considered within the scope of the invention.

[0037] The specific formulations of the culture medium and solution used in the following examples are as follows:

[0038] (1) LB liquid medium: 0.5% yeast extract, 1% NaCl, 1% peptone, solvent ddH2O, pH 7.0.

[0039] (2) LB solid medium: based on LB liquid medium, with 2% agar powder added.

[0040] (3) DPY medium: 1% peptone, 0.5% yeast extract, 2% glucose, 0.5% KH2PO4, 0.05% MgSO4·7H2O, solvent is ddH2O, pH is natural.

[0041] (4) PDA medium: Weigh 200 g of peeled potatoes and boil them thoroughly. Filter the liquid through a sieve and add 20 g of glucose. After cooling, bring the volume to 1 L and add 2% agar powder. The solvent is ddH2O and the pH is natural.

[0042] (5) Hypertonic CD solid medium: 35% sucrose, 0.3% NaNO3, 0.2% KCl, 0.1% KH2PO4, 0.05% MgSO4·7H2O, 0.001% FeSO4·7H2O, plus 2% agar powder, solvent is ddH2O, pH 5.5.

[0043] (6) Hypertonic CD soft agar medium: Same as its solid formulation, except that the agar powder is changed to 0.5% and the pH is 5.5.

[0044] (7) Modified Martin seed culture medium: 0.5% peptone, 0.2% yeast extract, 2% glucose, 0.1% K2HPO4, 0.05% MgSO4, solvent is ddH2O, pH is natural.

[0045] (8) Fermentation medium: 4.2% corn steep liquor, 3% soybean meal powder, 6% glucose, 6% maltose, 1.5% K2HPO4, 1.5% (NH4)2SO4, 0.3% citric acid, 0.25% peptone, 0.25% yeast powder, 0.02% CaCl2, 0.5% MgSO4, solvent is ddH2O, pH is natural.

[0046] The pH value mentioned here refers to the pH value of the fermentation medium without any special adjustment, so that it reflects the natural pH value after the addition of the medium components.

[0047] (9) Uracil nucleoside solution: Weigh 2.442 g of uracil nucleoside and dissolve it in 10 mL of sterile ddH2O.

[0048] (10) 5-Fluororhodic acid (5-FOA): Weigh 1 g of 5-FOA powder and dissolve it in 10 mL of dimethyl sulfoxide.

[0049] (11) 0.8 M NaCl solution: Weigh 46.8 g NaCl, add ddH2O to dissolve and make up to 1 L.

[0050] (12) STC buffer: Weigh 10.93 g sorbitol, 0.303 g Tris, and 0.277 g anhydrous CaCl2, dissolve in ddH2O and bring to a final volume of 50 mL, pH 7.5.

[0051] (13) PEG buffer: Weigh 30 g PEG6000, 0.061 g Tris, and 0.277 g anhydrous CaCl2, add ddH2O to dissolve and bring the volume up to 50 mL, pH 7.5.

[0052] (14) 100mM sodium phosphate buffer (pH 6.0): Weigh 1.37 g NaH2PO4·2H2O and 0.43 g Na2HPO4·12H2O, add ddH2O to dissolve and make up to 100 mL, pH 6.0.

[0053] (15) Enzymatic hydrolysate: Weigh 0.2 g cellulase, 0.1 g snail enzyme, 0.1 g lysozyme, 0.05 g lysozyme, 0.468 g NaCl, 1 mL of the above sodium phosphate buffer, and add 9 mL ddH2O to dissolve completely.

[0054] Example 1: Cloning of the tanninase gene and construction of recombinant plasmids

[0055] The taninase gene *tan* from *Aspergillus niger* was retrieved from the NCBI database (GenBank: XM_001401772). Following the instructions of the genomic DNA extraction kit (Sangon Biotech Co., Ltd.), the genome of wild-type *Aspergillus niger* WZ001 (China Center for Type Culture Collection No.: CCTCC NO.206047, this bacterium is disclosed in patent CN100467586C) preserved in our laboratory was extracted. Using the extracted *Aspergillus niger* WZ001 genome as a template, the taninase gene fragment was amplified using specific primers tan-F / tan-R (Table 1). Its nucleotide sequence and encoded amino acid sequence are shown in SEQ ID NO.2 and SEQ ID NO.1, respectively.

[0056] Using the extracted Aspergillus niger WZ001 genome as a template, the promoter PamyA and selection tag pyrG gene fragments with homologous arms were amplified using primers LPamyA-F / LPamyA-R and LpyrG-F / LpyrG-R (Table 1), respectively. Using plasmid pET28a-TcbhI synthesized by Qingke Biotechnology Co., Ltd. as a template, the terminator TcbhI gene fragment with homologous arms was amplified using primers LTcbhI-F / LTcbhI-R (Table 1). Using plasmid pUC57 (purchased from Qingke Biotechnology Co., Ltd.) as a template, the linearized fragment of the plasmid was amplified in reverse using primers pUC57-F / pUC57-R (Table 1). After digestion and gel recovery, the promoter, terminator, selection tag gene, and plasmid vector fragment were ligated using a one-step cloning kit (Novizan Biotechnology Co., Ltd.). The recombinant product was then transformed into E. coli DH5α competent cells and cultured at 37°C for 12 h. Single colonies were picked and cultured at 37°C and 200 rpm for 12 h. The resulting bacterial culture was sent for sequencing, and the recombinant plasmid with correct sequencing was named pUC57-PamyA-TcbhI-pyrG.

[0057] Using the amplified tanninase gene fragment as a template, the target gene fragment with homologous arms was amplified using primers Ltan-F / Ltan-R (Table 1). Using the recombinant plasmid pUC57-PamyA-TcbhI-pyrG as a template, the linearized fragment of the plasmid was amplified in reverse using primers pUC-F / pUC-R (Table 1). After digestion and gel recovery, the target gene and plasmid vector fragment were ligated using a one-step cloning kit (Novizan Biotechnology Co., Ltd.), and the recombinant product was transformed into E. coli DH5α competent cells. After incubation at 37℃ for 12 h, single colonies were picked and cultured at 37℃ and 200 rpm for 12 h. The resulting bacterial culture was sent for sequencing, and the correctly sequenced recombinant plasmid was named pUC57-PamyA-tan-TcbhI-pyrG.

[0058] Table 1 Primer List Primer Name Primer Base Sequence (5'-3') tan-F ATGCGTTCACCCGCCTGGGCTCCCATA tan-R TTAGTACACAGGCATAGGAACCGCATCCA LPamyA-F GTTGTAAAACGACGGCCAGTGAATTCATGGTGTTTTGATCATTTTA LPamyA-R GAGGCCGCTCAGGGCGAGTAGAGATCGGAACGACATGGTGGCCATAAATGCCTTCTGTGGGGTT LpyrG-F GCACTGTTGGAGACCAACTTCGTAAGCCAACCTCACACAAACAGGATTC LpyrG-R GCTATGACCATGATTACGCCGGGGTAGTAACGTTTTAGCGACGGTCAGG LTcbhⅠ-F ACTCGCCCTGAGCGGCCTCGTCTGCACAGGGTTGGCACCTAGGAGCTCCGTGGCGAAAGCCTG LTcbhⅠ-R TTGTGTGAGGTTGGCTTACGAAGTTGGTCTCCAACAGTGCTTTCCA pUC57-F GGCGTAATCATGGTCATAGCTGTTTCCT pUC57-R ACGACGTTGTAAAACGACGGCCAGT Ltan-F CGTCTGCACAGGGTTGGCACGTTCACCCGCCTGGGCTCC Ltan-R TTCGCCACGGAGCTCCTAGGTTAGTACACAGGCATAGGAACCG pUC-F CCTAGGAGCTCCGTGGCGAAAGC pUC-R TGCCAACCCTGTGCAGACGAGG .

[0059] Example 2: Construction of recombinant plasmid of tanninase mutant

[0060] Using the recombinant plasmid pUC57-PamyA-tan-TcbhI-pyrG as a template, site-directed mutagenesis was introduced by inverse PCR of the whole plasmid using primers A102D-F / A102D-R, D163N-F / D163N-R, and D437E-F / D437E-R (Table 2). The PCR products were digested, purified, and transformed into E. coli DH5α competent cells. Single colonies were then picked and inoculated, and the bacterial cultures were sequenced. The three correctly sequenced single-point mutant plasmids were named pUC57-tan-Mut1, pUC57-tan-Mut2, and pUC57-tan-Mut3. The mutation site of pUC57-tan-Mut1 is A102D, the mutation site of pUC57-tan-Mut2 is D163N, and the mutation site of pUC57-tan-Mut3 is D437E.

[0061] Using the aforementioned single-point mutant plasmids as templates, site-directed mutagenesis was introduced via full-plasmid reverse PCR using primers D163N-F / D163N-R, D437E-F / D437E-R, and A102D-F / A102D-R (Table 2). The PCR products were digested, purified, and transformed into E. coli DH5α competent cells. Single colonies were then picked, inoculated, and sequenced. The three double-point mutant plasmids with correct results were named pUC57-tan-Mut4, pUC57-tan-Mut5, and pUC57-tan-Mut6. The mutation sites for pUC57-tan-Mut4 are A102D and D163N, for pUC57-tan-Mut5 they are D163N and D437E, and for pUC57-tan-Mut6 they are A102D and D437E.

[0062] Using the double-point mutant plasmid pUC57-tan-Mut4 as a template, site-directed mutagenesis was introduced by inverse PCR of the whole plasmid using primers D437E-F / D437E-R (Table 2). The PCR products were digested, purified, and transformed into E. coli DH5α competent cells. Single colonies were then picked, inoculated, and sequenced. The plasmid with the correct three-point mutant was named pUC57-tan-Mut7. The mutation sites of pUC57-tan-Mut7 are A102D, D163N, and D437E.

[0063] Table 2 Primer List Primer Name Primer Base Sequence (5'-3') A102D-F CTGGCTTCCTGACCCCACGGATTTCCAAAAC A102D-R CCGTGGGGTCAGGAAGCCAGATTTCC D163N-F GCACCCTTAACTACGAGACGCTTTACATG D163N-R GCGTCTCGTAGTTAAGGGTGCCATTTG D437E-F CCACGGTGAGGCCGACTTCAGTATTCCC D437E-R CTGAAGTCGGCCTCACCGTGGAAATGGATGAC .

[0064] Example 3: Recombinant expression of tanninase and its mutants in Aspergillus niger

[0065] Using the Aspergillus niger expression host NBB12 (China Center for Type Culture Collection No.: CCTCC M2025878, deposit date: April 24, 2025, deposit address: Wuhan University, Wuhan, China, 430072, China) preserved in the laboratory as the starting strain, genetically engineered bacteria expressing tanninase and its mutants were constructed respectively.

[0066] 3.1 Amplification of the target gene expression fragment

[0067] Using the wild-type tanninase and its mutant recombinant plasmids constructed in Examples 1 and 2 as templates, eight linearized expression fragments were amplified and purified using primers PD-F / PD-R (Table 3).

[0068] 3.2 Preparation of protoplasts

[0069] (1) Culture of mycelium: The Aspergillus niger strain stored in glycerol at -80℃ was spread onto PDA medium and cultured in a 30℃ incubator for 3-4 days. The spores were washed off with 10 mL of sterile ddH2O and inoculated into 100 mL of DPY medium with 2 mL of spore suspension. The medium was then cultured at 30℃ and 200 rpm for 24 h.

[0070] (2) Collection of mycelium: Use a vacuum filtration pump to filter out the culture medium, and then collect the mycelium. First wash with sterile ddH2O, then wash with 0.8 M NaCl solution, and filter until it is dry. Use a sterile spatula to scrape about 1 g of mycelium into a sterile conical flask and add 15 mL of enzyme hydrolysis solution.

[0071] (3) Enzymatic hydrolysis: Place the conical flask in a water bath shaker and perform enzymatic hydrolysis at 30℃ and 120 rpm. The enzymatic hydrolysis is complete in about 3 hours. After removing the conical flask, all operations must be carried out at low temperature.

[0072] (4) Purification: Filter the enzymatically digested bacterial solution through a funnel lined with four layers of Magic Filter Cloth. Collect the filtrate in a 50 mL sterile centrifuge tube. To obtain more protoplasts, wash the remaining bacterial solution in the conical flask with 30 mL of pre-cooled 0.8 M NaCl solution. Centrifuge the tube containing the protoplasts at 4°C, 1200×g for 10 min, and discard the supernatant. Add 10 mL of STC buffer to the precipitate, wash the precipitate while resuspending it thoroughly, and centrifuge at 4°C, 1200×g for 10 min, discarding the supernatant. Add 3 mL of STC buffer to the protoplast precipitate and gently resuspend it with a de-pointed pipette tip to fully disperse the protoplasts.

[0073] 3.3 Transformation of protoplasts

[0074] 3.3.1 Transformation Process

[0075] The protoplast-PEG conversion method includes three groups: a positive control group, a negative control group, and an experimental group, to ensure the accuracy of the conversion results.

[0076] Positive control group: Add 160 μL of protoplast resuspension, 100 μL of STC buffer, and 60 μL of PEG buffer to a 2 mL centrifuge tube, and gently invert to mix.

[0077] Negative control group: Same as positive control group.

[0078] Experimental group: Add 160 μL of protoplast resuspension, 100 μL of the amplified expression fragment, and 60 μL of PEG buffer to a 2 mL centrifuge tube, gently invert and mix, for a total of 8 transformation groups.

[0079] All mixtures were converted on ice, and the mixture was gently inverted and mixed once every 10 minutes. After 30 minutes, 1.5 mL of PEG buffer was added to each centrifuge tube containing the mixture, and the mixture was gently inverted and mixed. After being removed from ice, the mixture was allowed to stand for 25 minutes.

[0080] 3.3.2 Inverted plate culture

[0081] Prepare the required hypertonic CD solid medium lower plates in advance, with only the positive control group having a final concentration of 10 mM uracil nucleoside and 5-FOA added.

[0082] Take 3 mL of hypertonic CD soft agar, 1.5 mL of STC solution, and each of the above mixtures, and gently mix them separately. Spread the mixture evenly on two corresponding hypertonic CD solid culture medium plates. Incubate at 30℃ for 4–6 days and observe the growth of Aspergillus niger on each plate.

[0083] 3.4 PCR identification of Aspergillus niger positive transformants

[0084] Transformants of *Aspergillus niger* were randomly selected from the experimental group plates and transferred to PDA plates, where they were incubated at 30°C for 3–4 days. Genomic DNA was extracted from the spores and used as a template for genomic PCR identification using primers jdtan-F / jdtan-R (Table 3). The PCR products were then analyzed by electrophoresis; transformants with correctly identified band sizes were considered positive transformants containing the target gene.

[0085] Table 3 Primer List Primer Name Primer Base Sequence (5'-3') PD-F CACGACGTTGTAAAACGACGG PD-R GGGGTAGTAACGTTTTAGCGACG jdtan-F GTAGTAAAACCCCGGAGTCAACAGCATCCA jdtan-R GTACACAGGCATAGGAACCGCATCCAAGTC .

[0086] Example 4: Enzyme activity determination in fermentation supernatant of engineered Aspergillus niger

[0087] 4.1 Shake-flask fermentation of recombinant Aspergillus niger strain

[0088] The selected Aspergillus niger positive transformants were inoculated onto PDA plates and cultured at 30°C for 4 days to obtain fresh spores required for fermentation. Spores of 1 cm × 1 cm size were scraped from each positive transformant and inoculated onto modified Martin seed culture medium, and cultured at 30°C and 200 rpm for 24 h. The seed culture was then transferred to the fermentation medium at a 10% (V / V) inoculation rate and cultured at 30°C and 200 rpm for 7 days to produce tanninase. After fermentation, the mixture was centrifuged at 12000 rpm for 10 min, and the resulting supernatant was the crude enzyme solution.

[0089] 4.2 Determination of tanninase activity

[0090] The activity of tanninase was determined by the cyclotanine method of Baoxinyu. This method uses propyl gallate (PG) as a substrate. Tanninase hydrolyzes PG to generate gallic acid (GA). The product forms a red complex with methanol cyclotanine under alkaline conditions, and the complex has a maximum absorption at 520 nm.

[0091] Enzyme activity is defined as the amount of enzyme required to hydrolyze a PG solution to produce 1 μmol of GA per minute at 30°C and pH 5.0.

[0092] The steps for determining tanninase activity are as follows:

[0093] (1) Preheat the substrate and enzyme solution in a 30°C water bath for 5-10 min;

[0094] (2) Take four 10 mL test tubes, one as a blank tube and the other three as test tubes. Add 0.25 mL of PG solution to each test tube, and then add 0.25 mL of the enzyme solution to be tested to each test tube. Incubate in a 30°C water bath for 5 min.

[0095] (3) Add 0.3 mL of methanol-tannin solution (0.667%, W / V) to each test tube and keep warm for 5 min;

[0096] (4) Add 4.2 mL of 0.5 M KOH solution to each test tube, and then add 0.25 mL of enzyme solution to the blank tube. After bathing in a water bath at 30℃ for 10 min, the blank tube is reset to zero, and the absorbance of the solution in each test tube is measured at a wavelength of 520 nm.

[0097] The enzyme activities of tanninases in the fermentation supernatants of eight recombinant Aspergillus niger strains were determined, and the results are shown in Table 4. The results showed that all recombinant tanninase mutants possessed enzyme activity, and the enzyme activities of the tanninase mutants Tan-A102D-D163N and Tan-A102D-D163N-D437E both exceeded 200 U / mL, representing increases of 76.1% and 95.8% compared to the wild type, respectively.

[0098] Table 4 Enzyme activities of recombinant tanninases and their mutants Recombinant tanninase Enzyme activity (U / mL) after 7 days of fermentation Tan-WT 120.01 Tan-A102D 123.44 Tan-D163N 181.53 Tan-D437E 157.43 Tan-A102D-D163N 211.37 Tan-D163N-D437E 172.66 Tan-A102D-D437E 91.28 Tan-A102D-D163N-D437E 234.98 .

[0099] Example 5: Application of recombinant tanninase mutant in catalyzing the hydrolysis of taratanine

[0100] The fermentation enzyme broths of each recombinant strain obtained in Example 4 were used as catalysts in the hydrolysis of taratanine to produce gallic acid. Reaction system: Total system 100 mL, enzyme addition 1000 U, using 10% (w / v) taratanine (tannic acid content 80%) as substrate, reacted for 6 h at pH 5.0, 45℃, and 300 rpm. The enzyme broth was then boiled for 10 min to inactivate it. Gallic acid in the reaction solution was detected by high-performance liquid chromatography (HPLC). HPLC detection conditions: Ultimate® AQ C18 column, 5 μm, 4.6 × 250 mm; mobile phase: phase A methanol: phase B 0.1% formic acid = 10:90 (v / v); flow rate 1.0 mL / min; column temperature: 30℃; injection volume: 10 μL; detection wavelength: 280 nm.

[0101] The results are shown in Table 5. Compared with the wild type, all recombinant tanninase mutants showed varying degrees of improvement in the yield of gallic acid produced from the hydrolysis of taratanine. Among them, the recombinant tanninase mutant Tan-A102D-D163N-D437E had the highest gallic acid yield, which was 2.03 times that of the wild type. This indicates that the mutant has a significantly enhanced specific catalytic ability for the substrate taratanine, so this mutant was used for subsequent experiments.

[0102] Table 5. Hydrolysis of taratin by recombinant tanninases and their mutants. Recombinant tanninase Gallic acid yield (%) Tan-WT 29.78 Tan-A102D 35.89 Tan-D163N 43.56 Tan-D437E 43.06 Tan-A102D-D163N 54.86 Tan-D163N-D437E 46.60 Tan-A102D-D437E 56.32 Tan-A102D-D163N-D437E 60.50 .

[0103] Example 6: Effect of conversion time on the hydrolysis of taratanine catalyzed by Tan-A102D-D163N-D437E

[0104] This embodiment studies the effect of conversion time on the enzyme-catalyzed hydrolysis of taratanine. Following the experimental method of Example 5, recombinant bacterial strain fermentation enzyme broths Tan-A102D-D163N-D437E and Tan-WT were used as catalysts. The conversion time in this embodiment was 1–10 h, with other conditions remaining unchanged, to hydrolyze and convert taratanine.

[0105] The results are shown in Table 6. After 8 hours of enzymatic hydrolysis, the recombinant tanninase mutant Tan-A102D-D163N-D437E catalyzed the hydrolysis of taratan to produce gallic acid, achieving a maximum yield of 69.82%, which is 2.07 times that of the wild type under the same hydrolysis time. The theoretical yield of gallic acid is approximately 70%, indicating that the mutant achieved complete reaction after 8 hours of enzymatic hydrolysis. The hydrolyzed sample was centrifuged at 12,000 rpm for 10 minutes at 4℃, the supernatant was discarded, and the sample was dried at 60℃ to constant weight. The final product yielded a gallic acid purity of 95%. The industrial-scale production of gallic acid using this tanninase mutant shows promising application prospects.

[0106] Table 6. Effect of different enzymatic hydrolysis times on enzyme-catalyzed hydrolysis of taratanine. Enzymatic hydrolysis time (h) Gallic acid yield (%) of Tan-A102D-D163N-D437E Gallic acid yield (%) in Tan-WT 1 13.42 5.62 2 25.91 11.15 3 34.62 15.71 4 43.23 21.23 5 52.94 26.57 6 60.50 29.78 7 66.14 32.05 8 69.82 33.81 9 69.80 34.97 10 69.81 35.22 .

[0107] In summary, the engineered Aspergillus niger strain constructed in this invention can ferment and produce the tanninase mutant, with its enzyme activity significantly increased to 234.98 U / mL compared to the unmutated wild-type tanninase (120.01 U / mL). Using the tanninase mutant to catalyze the hydrolysis of tararatanin to produce gallic acid, the yield reached a maximum of 69.82%, which is 2.07 times that of the wild-type tanninase, demonstrating promising industrial application prospects.

[0108] The amino acid sequence encoded by the tanase gene (SEQ ID NO.1): MRSPAWAPIATTAFAALANAATPSTLAELCTDSIVKAALPPSEFIQGITIDSDSVTTEVVTNSSVSSEFYPSATINYCNVTFAYSHDGIDGDQVLLEIWLPAPTDFQNRWLSTGGGGYAINSGDQSLPGGVMYGAASGMTDGGFGGFSNNADTAMLLANGTLDYETLYMFAYKAHRELSLIGKALTRNVYGMSDSDKLYAYYQGCSEGGREGWSQVQRFGDEWDGAIIGAPAFRWSFQQTQHLYSNVVEKTLDYYPPPCELDKIVNETIAACDAMDGKVDWVVARTDLCLLDFDISTIEGKPYSCAASRGTPAQNGTVSAKGIEVAKTIINGLHDSQGRRVYFSYQPTAAFDDAETQYNSTTGQWGLDIDQLGGEYIALLVDKNGTTLDSLDGVTYDTLKDWMISGLQEYYSTLQTTWPDLTPFHEAGGKVIHFHGDADFSIPTAASIRYWESVRSIMYPNQDYNSSAEALNEWYRLYTVPGAGHCATNDAMPNGPFPQTNMAVMIDWVENGVVPTTLNATVLQGENEGQNQQLCAWPLRPLWTNNGTTMECVYNQRSIDSWHYDLDAVPMPVY。

[0109] Nucleotide sequence of tannase gene tan, SEQ ID NO.2:

[0110] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A recombinant tanninase mutant, characterized in that, The mutant is obtained by single-point or multi-point combination mutation of the amino acid sequence shown in SEQ ID NO.1 at position 102, position 163 or position 437.

2. The recombinant tanninase mutant according to claim 1, characterized in that, The mutant is one in which the amino acid sequence shown in SEQ ID NO. 1 is mutated to one of the following: (1) The A at position 102 mutates into D; (2) The D at position 163 mutates to N; (3) The D at position 437 mutates to E; (4) The A at position 102 mutates to D, and the D at position 163 mutates to N; (5) The D at position 163 mutates to N, and the D at position 437 mutates to E; (6) The A at position 102 mutates to D, and the D at position 437 mutates to E; (7) The A at position 102 mutates to D, the D at position 163 mutates to N, and the D at position 437 mutates to E.

3. The encoding gene of the recombinant tanninase mutant of claim 1.

4. The encoding gene of the recombinant tanninase mutant according to claim 3, characterized in that, The nucleotide sequence of the encoding gene is shown in SEQ ID NO.

2.

5. A recombinant expression vector, characterized in that, The gene encoding the recombinant tanninase mutant as described in claim 3 or 4.

6. A genetically engineered bacterium, characterized in that, The gene encoding the recombinant tanninase mutant as described in claim 3 or 4, or the recombinant expression vector as described in claim 5.

7. A method for constructing the genetically engineered bacteria according to claim 6, characterized in that, Includes the following steps: The encoding gene of the recombinant tanninase mutant as described in claim 3 or 4, or the linearized expression fragment of the recombinant plasmid as described in claim 5, is integrated into the host bacterium using PEG-mediated protoplast transformation.

8. The method for constructing genetically engineered bacteria according to claim 7, characterized in that, The host bacterium is Aspergillus niger NBB12.

9. The use of a recombinant tanninase mutant as described in claim 1 or 2, or the genetically engineered bacteria as described in claim 6, in the catalytic hydrolysis of taratanine.

10. The application as described in claim 9, characterized in that, The method of application is as follows: using the crude enzyme solution after fermentation and centrifugation of the genetically engineered bacteria as a catalyst, taratanine as a substrate, and ddH2O as a solvent, a reaction system is prepared. After reacting at 45℃ and 300rpm for 1~10 h, the enzyme solution is boiled to inactivate it, separated and purified to obtain the product gallic acid; during the reaction, the pH value of the reaction system is 5.0.

Images