Dual-emission antibiotic aptamer sensor based on AIE nano material and application of dual-emission antibiotic aptamer sensor

Abstract

The invention belongs to the technical field of food safety detection, and particularly provides a dual-emission antibiotic aptamer sensor based on an AIE nano material and application of the dual-emission antibiotic aptamer sensor in antibiotic detection. The sensor comprises a blue luminous body G-VP3NP, a red luminous body NMM dye, a hairpin probe HP and a biological enzyme Exo III, wherein the G-VP3NP is an AIE nano particle VP3NP modified by a G-rich single chain DNA (Deoxyribose Nucleic Acid); the AIE nano particles VP3NP are triphenylethylene aggregates with carboxyl groups on the surfaces of the AIE nano particles VP3NP; the HP is hairpin DNA (Deoxyribose Nucleic Acid) containing a target antibiotic aptamer sequence. According to the sensor, the aptamer is used as a recognition element, the ratio of the blue fluorescence signal intensity to the red fluorescence signal intensity is used as an output signal, the false positive problem is effectively solved, and sensitive and accurate detection of antibiotics can be achieved.

Description

Technical Field

[0001] This invention belongs to the field of food safety testing technology, specifically relating to a dual-emission antibiotic aptamer sensor based on AIE nanomaterials and its application. Background Technology

[0002] Antibiotics, due to their strong antibacterial activity, are widely used in human medicine and animal husbandry. However, the improper use of antibiotics leads to large residues in animal-derived foods, environmental water, soil, and the human body, causing serious public health problems such as bacterial resistance, weakened immunity, allergic reactions, and liver and kidney damage. Traditional methods for detecting antibiotic residues, such as chromatography, while highly sensitive and accurate, require expensive and bulky equipment, and complex sample pretreatment processes that require specialized technicians. Therefore, designing and developing novel methods for detecting antibiotic residues is of significant scientific importance for ensuring food safety and public health.

[0003] With the rapid development of science and technology, colorimetric, fluorescence, chemiluminescence, and electrochemical techniques are now widely used for antibiotic residue detection. Among them, fluorescence sensors are favored by researchers at home and abroad due to their advantages such as high sensitivity, fast response speed, and signal visualization, and are widely used in antibiotic residue detection. For example, Khalil Abnous et al. achieved highly sensitive detection of kanamycin residues in serum and milk by combining a nucleic acid aptamer strategy with gold nanoparticles (Sensor Actuat B-Chem, 2016, 222, 1); other researchers have achieved highly sensitive and selective fluorescent detection of antibiotics based on target-induced exonuclease III digestion reactions (J. Hazard. Mater., 2025, 495, 139104). However, most existing fluorescent sensors for antibiotic residue detection focus on single-emission sensors (Anal. Chim. Acta, 2024, 1294, 342309; Chem. Eng. J., 2021, 409, 128135; Biosens. Bioelectron., 2017, 91, 262), which require cumbersome and complex signal molecule labeling, resulting in high costs, poor anti-interference capabilities, and a tendency to produce false positive results. Existing dual-emission sensors are limited to rare-earth-based luminescent devices for detecting tetracycline antibiotics (Sensor Actuat B-Chem, 2022, 372, 132687; Sensor Actuat B-Chem, 2018, 269, 238), and their selectivity, accuracy, and universality require further improvement and expansion. Therefore, designing and constructing novel dual-emission fluorescent sensors to develop sensitive and accurate new methods for antibiotic residue detection is of significant research value.

[0004] To address the problems of poor anti-interference ability, cumbersome and complex signal molecule labeling, high cost, and narrow applicability of existing antibiotic detection methods, the present invention aims to provide a dual-emission antibiotic aptamer sensor based on AIE nanomaterials and its applications. The dual-emission aptamer sensor based on AIE nanoparticles uses aptamers as recognition elements and the ratio of blue fluorescence signal intensity to red fluorescence signal intensity as the output signal. This avoids the cumbersome and complex labeling of signal molecules, effectively overcomes the false positive problem, and enables dual-emission, highly sensitive, and highly selective detection of target antibiotics. It has significant advantages such as low cost, strong anti-interference ability, and good universality.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: A dual-emission antibiotic aptamer sensor based on AIE nanomaterials includes a blue luminescent material G-VP3NP, a red luminescent material NMM dye, a hairpin probe HP, and a biological enzyme Exo III (exonuclease III). The blue luminescent G-VP3NP is an AIE nanoparticle VP3NP modified with G-rich single-stranded DNA; the AIE nanoparticle VP3NP is a tristyrene aggregate with carboxyl groups on its surface. The HP is a hairpin DNA containing the target antibiotic aptamer sequence, which is designed to counteract the digestion characteristics of the target antibiotic, G-rich single-stranded DNA, and Exo III.

[0006] Furthermore, the preparation method of the G-VP3NP includes the following steps: (1) AIE dye VP3 (triphenylene) and PSMA (styrene-maleic anhydride copolymer) were dissolved in tetrahydrofuran to obtain solution A and solution B respectively; solution A and solution B were mixed evenly and poured into ultrapure water, and after sonication, centrifugation and ultrapure water washing, the precipitate was finally dispersed in sterile water to obtain VP3NP solution; (2) For the target antibiotic, design G-rich single-stranded DNA containing amino groups that can be folded into G-quadruplexes and prepare it into a stock solution to obtain G-ssDNA solution; (3) The VP3NP solution obtained in step (1) is mixed with an aqueous solution containing EDC and NHS and reacted. G-ssDNA solution is added and the reaction continues. After the reaction is completed, the blue luminescent G-VP3NP is obtained by centrifugation and washing with ultrapure water.

[0007] Furthermore, in step (1), the concentration of AIE dye VP3 in solution A is 3-18 mg / mL; and the concentration of PSMA in solution B is 5-20 mg / mL.

[0008] Furthermore, in step (1), the volume ratio of solution A to solution B is 15-20:1; and the volume ratio of the mixture of solution A and solution B to ultrapure water is 1:5-15.

[0009] Furthermore, the ultrasonic time in step (1) is 5-20 min; the centrifugation conditions are centrifugation at 8000~15000 rpm for 10~30 min.

[0010] Furthermore, the concentration of the G-ssDNA solution in step (2) is 5-100 µM; in the aqueous solution containing EDC and NHS in step (3), the concentration of EDC is 5-30 µM and the concentration of NHS is 10-50 µM.

[0011] Furthermore, in step (3), the volume ratio of the VP3NP solution, the aqueous solution containing EDC and NHS, and the G-ssDNA is 0.3-3:0.5-2:0.2-1.

[0012] Furthermore, in step (3), the reaction time is 8-12 h, and the centrifugation conditions are 12000-15000 rpm for 10-30 min.

[0013] The present invention also provides the application of the above-mentioned dual-emission antibiotic aptamer sensor based on AIE nanomaterials in the detection of antibiotics.

[0014] Furthermore, the application includes the following steps: Step 1: Dissolve G-VP3NP solution, HP solution, and Exo III in a buffer solution and heat to 70°C. o C-95 o Keep at C for 3-10 min, allow to cool naturally, then add NMM solution. Collect the blue fluorescence signal intensity at 420 nm and the red fluorescence signal intensity at 624 nm under 350 nm excitation, denoted as I'. 420 and I' 624 As a blank control, it was used to detect changes in fluorescence signal intensity; Step 2: Take the sample to be tested and incubate it with HP solution for 10-60 min. Then add G-VP3NP solution and Exo III, 20 o C-37 o After reacting at C for 40-120 min, dissolve in buffer solution and heat to 70°C. o C-95 o Keep at C for 3-10 min, allow to cool naturally, then add NMM solution. Collect the blue fluorescence signal intensity at 420 nm and the red fluorescence signal intensity at 624 nm under 350 nm excitation, denoted as I0 and I1, respectively.420 and I 624 ;if I 420 Greater than I' 420 And I 624 Less than I' 624 This indicates that the target antibiotic is present in the sample being tested.

[0015] Furthermore, I 420 / I 624 Substituting the value into the standard curve yields the concentration of the target antibiotic in the sample to be tested.

[0016] Furthermore, the standard curve is constructed as follows: Different concentrations of target antibiotic standard solutions were co-incubated with HP solution for 10-60 min, followed by the addition of G-VP3NP solution and Exo III. o C-37 o After reacting at C for 40-120 min, dissolve in buffer solution and heat to 70°C. o C-95 o At 350 nm, maintain the temperature for 3-10 min, allow it to cool naturally, then add NMM solution. Under 350 nm excitation, collect the blue fluorescence signal intensity at 420 nm and the red fluorescence signal intensity at 624 nm. Establish the linear relationship between the ratio of blue fluorescence signal intensity to red fluorescence signal intensity and the target antibiotic concentration to obtain the corresponding standard curve.

[0017] The concentration gradient of the target antibiotic standard solution can be selected from 0.01 nM, 0.05 nM, 1 nM, 5 nM, 10 nM, 30 nM, 60 nM, 80 nM, and 100 nM.

[0018] The principle of the dual-emission antibiotic aptamer sensor based on AIE nanomaterials for detecting antibiotics described in this invention is as follows: In the absence of a target antibiotic, because the HP is not activated, Exo III cannot cleave the G-rich single-stranded DNA attached to the VP3NP surface. The NMM intercalates into the resulting G-quadruplex, restricting molecular rotation and enhancing the red fluorescence signal. Simultaneously, the FRET effect of VP3NP to NMM is induced, weakening the blue fluorescence signal. In the presence of a target antibiotic, based on the target antibiotic-aptamer specificity, the hairpin probe HP is recognized and releases a dark blue single-stranded DNA fragment. This fragment hybridizes with the G-rich single-stranded DNA to form a double helix, triggering the Exo III digestion reaction. This reduces the amount of G-rich single-stranded DNA attached to the VP3NP surface, preventing NMM from intercalating into the G-quadruplex, increasing the blue fluorescence signal and weakening the red fluorescence signal. The dual emission ratio detection of the target antibiotic can be achieved based on the ratio of the blue fluorescence signal intensity to the red fluorescence signal intensity after the addition of the target antibiotic.

[0019] This invention provides a dual-emission antibiotic aptamer sensor based on AIE nanomaterials, achieving dual-emission, sensitive, and accurate detection of antibiotics. Compared with existing antibiotic detection methods, it has the following advantages: (1) The dual-emission antibiotic aptamer sensor based on AIE nanoparticles described in this invention outputs a signal with the ratio of blue fluorescence signal intensity to red fluorescence signal intensity. It has strong anti-interference ability and greatly improves detection accuracy. (2) The AIE nanoparticles VP3NP described in this invention have high luminescence efficiency and good stability, and have excellent spectral matching and FRET effect with NMM dyes, which is beneficial for constructing a dual emission system; (3) The dual-emission antibiotic sensor based on AIE nanomaterials described in this invention uses the aptamer of the target antibiotic for molecular recognition, which has high selectivity, good universality, and is easy to extend to the detection of other analytes; (4) The dual-emission antibiotic aptamer sensor based on AIE nanomaterials described in this invention uses Exo III for target cycling signal amplification, which greatly improves the detection sensitivity; at the same time, the output fluorescence signal is regulated by the effective intercalation of NMM dye in the G-quadruplex, avoiding the cumbersome and complicated labeling of signal molecules, and has significant advantages such as low cost and easy operation. Attached Figure Description

[0020] Figure 1 This is a schematic diagram of the preparation of the blue luminescent material G-VP3NP.

[0021] Figure 2 Transmission electron microscopy (A), ultraviolet absorption spectroscopy, and fluorescence emission spectroscopy characterization of VP3NP (B).

[0022] Figure 3The zeta potential (A) and XPS characterization (BF) of G-VP3NP are shown.

[0023] Figure 4 This is a schematic diagram illustrating the principle of a dual-emission antibiotic aptamer sensor based on AIE nanomaterials for antibiotic detection.

[0024] Figure 5 Fluorescence response spectrum of sensors constructed at different Kana concentrations.

[0025] Figure 6 This is a graph showing the linear relationship between the ratio of blue fluorescence signal intensity to red fluorescence signal intensity and different concentrations of Kana.

[0026] Figure 7 Fluorescence response signals of sensors constructed in the presence of different analytes.

[0027] Figure 8 This is a graph showing the linear relationship between the ratio of blue fluorescence signal intensity to red fluorescence signal intensity and the target antibiotic concentration when using the dual-emission antibiotic aptamer sensor based on AIE nanomaterials described in this invention to detect tobramycin (A) and ampicillin (B). Detailed Implementation

[0028] To make the objectives and technical solutions of this invention clearer, the invention will be further described in detail below through embodiments.

[0029] Example 1: Construction of a dual-emission antibiotic aptamer sensor based on AIE nanomaterials This embodiment provides a dual-emission antibiotic aptamer sensor based on AIE nanomaterials, including a blue luminescent material G-VP3NP, a red luminescent material NMM dye, a hairpin probe HP, and a biological enzyme Exo III (exonuclease III). First, the AIE dye VP3 and the stabilizer PSMA are dissolved in tetrahydrofuran. AIE nanoparticles VP3NP with -COOH groups on their surface are prepared using a nanoprecipitation method. Then, G-rich single-stranded DNA-modified AIE nanoparticles G-VP3NP are further prepared via amide condensation (preparation process as follows). Figure 1 (As shown in the image). Secondly, targeting the digestion characteristics of the target antibiotic, G-rich single-stranded DNA, and exonuclease III (Exo III), a hairpin probe HP containing an aptamer sequence was designed. The specific preparation of G-VP3NP and HP is as follows.

[0030] 1. Preparation of G-VP3NP (1) Preparation of VP3NP Dissolve 0.01 g of VP3 in 1 mL of tetrahydrofuran, and denote this as solution A; dissolve 0.01 g of PSMA in 1 mL of tetrahydrofuran, and denote this as solution B. Mix 0.95 mL of solution A with 0.05 mL of solution B thoroughly, then pour the mixture into 10 mL of ultrapure water, sonicate for 5 min, centrifuge at 10,000 rpm for 10 min, and wash three times with ultrapure water. Finally, disperse the resulting precipitate in 10 mL of sterile water for later use.

[0031] Depend on Figure 2 It is known that the particle size of VP3NP is approximately 7.57 nm, emits bright blue fluorescence, has a maximum emission wavelength of 420 nm, and a maximum excitation wavelength of 350 nm.

[0032] (2) Preparation of G-ssDNA G-rich single-stranded DNA (G-ssDNA) with 5' modified amino groups that can be folded into G-quadriplexes was designed for the target antibiotic. In this example, Kana was used as the target antibiotic, and its sequence is as follows: NH2C6-TTAGGGTTAGGGTTAGGGTTAGGGTTTGGGGG (5'→3').

[0033] (3) Preparation of G-VP3NP Mix 1 mL of the VP3NP solution obtained in step (1-1) and 1 mL of a solution containing EDC (20 mM) and NHS (30 mM) at 25°C. o The mixture was combined at C and reacted for 40 min. Then, 1 mL of G-ssDNA (5 µM) solution was added, and the reaction was continued for 8–12 h. After the reaction was completed, the mixture was centrifuged at 15,000 rpm for 20 min, washed three times with ultrapure water, and then dispersed in 5 mL of Tris-HCl for later use.

[0034] After modification with G-ssDNA, the zeta potential changed from -30.43 mV to -40.59 mV, and N and P elements were present, indicating that G-VP3NP was successfully prepared. Figure 3 ).

[0035] 2. Design of the hairpin probe HP Hairpin probe HP sequences were designed targeting antibiotics, G-ssDNA, and Exo III. In this example, Kana was used as the target antibiotic, and the HP sequence is as follows: TCAACCCCCAAACCCTAACCCTAATAATAGGGTTTGGGGGTTGAGGCTAAGCCGA.

[0036] Example 2: Application of a dual-emission antibiotic aptamer sensor based on AIE nanomaterials in the detection of Kana. The principle of the dual-emission antibiotic aptamer sensor based on AIE nanomaterials for antibiotic detection described in this invention is as follows: Figure 4 As shown: In the absence of antibiotics, because the HP is not opened, Exo III cannot cleave the G-rich single-stranded DNA attached to the surface of VP3NP, and NMM is inserted into it, weakening the blue fluorescence and enhancing the red fluorescence. When antibiotics are present, the target opens the HP and releases a single-stranded DNA fragment, which hybridizes with the G-rich single-stranded DNA to form double-stranded DNA, triggering the digestion reaction of Exo III. This results in a smaller amount of G-rich single-stranded DNA attached to the surface of VP3NP, and NMM cannot be inserted into the G-quadruplex, increasing the blue fluorescence signal and decreasing the red fluorescence signal. Based on the ratio of the intensity of the blue fluorescence signal to the intensity of the red fluorescence signal after the addition of the target antibiotic, the quantitative detection of the target antibiotic can be achieved.

[0037] This embodiment provides the application of the sensor constructed in Embodiment 1 in detecting Kana. The detection steps are as follows: (1) Dissolve G-VP3NP solution, HP solution and Exo III in buffer solution and heat to 95°C. o Hold at temperature C for 3-10 minutes, allow to cool naturally, then add NMM solution. Collect the blue and red fluorescence signal intensities in the 400-700 nm range under 350 nm excitation, denoted as I'. 420 and I' 624 ; will I' 420 and I' 624 As a blank control, changes in fluorescence signal intensity were detected; (2) Incubate 10 µL of target antibiotic standard solutions of different concentrations with 10 µL of HP solution for 10-60 min, then add 30 µL of G-VP3NP solution and 20 µL of Exo III, 37 o After reacting at C for 120 min, the solution was dissolved in 10 µL of Tris-HCl buffer solution, and the temperature was raised to 95°C. o At C, maintain for 3-10 min, allow to cool naturally, then add 20 µL NMM solution (1 µM). Under 350 nm excitation, collect the blue fluorescence signal intensity at 420 nm and the red fluorescence signal intensity at 624 nm, denoted as I0 and I1, respectively. 420 and I 624 Establish the ratio of blue fluorescence signal intensity to red fluorescence signal intensity after the addition of antibiotics (I0). 420 / I 624The linear relationship between the antibiotic and the concentration of Kana was investigated, and the corresponding linear regression equation was obtained. The concentrations of the antibiotic in the standard solutions were 0.01 nM, 0.05 nM, 1 nM, 5 nM, 10 nM, 30 nM, 60 nM, 80 nM, and 100 nM, respectively.

[0038] like Figure 5 As shown, with the increase of the target antibiotic Kana concentration, the blue fluorescence signal at 420 nm gradually increases, while the red fluorescence signal at 624 nm gradually decreases.

[0039] Depend on Figure 6 It can be seen that I 420 / I 624 The value showed a good linear relationship with the concentration of Kana in the range of 0.01-30 nM (R0). 2 =0.9915), the linear relationship can be I 420 / I 624 =0.9582+0.0362C. Based on the rule of 3σ / slope (σ is the standard deviation of the blank sample (n=9)), the limit of detection (LOD) was calculated to be as low as 0.0027 nM, which is lower than the maximum residue limit of TC in milk set by the EU (225 nM).

[0040] (3) Perform the test on the sample according to step (3-2), based on Figure 6 The linear relationship shown can be used to achieve quantitative detection of Kana in the sample.

[0041] Example 3: Selective Detection of a Dual-Emission Antibiotic Aptamer Sensor Based on AIE Nanomaterials To evaluate the selectivity of the sensor of the present invention for the target antibiotic, different potential interfering substances were added to the sensing system under the same experimental conditions, including neomycin (NEO), oxytetracycline (OXY), tetracycline (TCY), doxycycline (DOX), ofloxacin (OFLX), norfloxacin (NOR), amoxicillin (AMX), chloramphenicol (CAP), gentamicin (GM), arginine (Arg), glutamic acid (Glu), cysteine ​​(Cys), tobramycin (TOB), and ampicillin (AMP).

[0042] The testing process is as follows: Take 10 µL of different interfering substances and incubate them with HP solution for 10–60 min, then add G-VP3NP solution and Exo III, 37 °C. o After reacting at C for 120 min, dissolve in buffer solution and heat to 95°C. oC and maintain for 3-10 min, then allow to cool naturally before adding NMM solution. After the reaction is complete, collect the blue fluorescence signal intensity at 420 nm under 350 nm excitation. 420 and the intensity of the red fluorescence signal at a wavelength of 624 nm I 624 .

[0043] Test results as follows Figure 7 As shown, when other analytes are present, I 420 / I 624 The values ​​are all low, with I only increasing when Kana is present. 420 / I 624 The value will increase significantly, indicating that the sensor described in this invention has excellent detection selectivity.

[0044] Example 4: Universality Detection of a Dual-Emission Antibiotic Aptamer Sensor Based on AIE Nanomaterials Using tobramycin and ampicillin as target antibiotics, respectively, sensors targeting tobramycin and ampicillin were prepared by altering the base sequences of the nucleic acid aptamers and G-rich single-stranded DNA, respectively, according to Example 1. The prepared sensors were then used to detect the target antibiotics according to the method described in Example 2. Figure 8 As shown, based on the specific recognition of nucleic acid aptamers and the ExoIII-mediated digestion reaction, sensitive detection of the targets tobramycin and ampicillin can be achieved.

[0045] Example 5: Practicality Test To verify the feasibility and practicality of the method, this embodiment uses the dual-emitter aptamer sensor constructed in Example 1 for the detection of Kana in fish meat, an animal-derived food. Fish was purchased from a local market, and the Kana content in the fish meat extract was determined using the standard spiking method. One gram of fish meat was weighed and pulverized. Then, 10 mL of buffer solution, 2 mL of 10% trichloroacetic acid solution, and 5 mL of n-hexane were added sequentially. The mixture was sonicated for 10 min, centrifuged at 8000 rpm for 10 min, and the aqueous phase was collected. The aqueous phase was heated in a 90℃ water bath for 30 min, filtered through a 0.22 µm filter membrane, and the filtrate was purified using an activated C18 microextraction column. After drying, it was redissolved in 10 mL of buffer solution for actual sample detection. The Kana-spiked fish meat extract sample was tested by incubating 10 µL of the fish meat extract sample with HP solution for 10–60 min, followed by the addition of G-VP3NP solution and Exo III, 37 o After reacting at C for 120 min, dissolve in buffer solution and heat to 95°C. oKeep at C for 3-10 min, allow to cool naturally, then add NMM solution. After the reaction is complete, collect the blue fluorescence signal intensity I at 420 nm wavelength under 350 nm excitation. 420 and the intensity of the red fluorescence signal at a wavelength of 624 nm I 624 ,in accordance with Figure 6 The linear relationship shown can be used to achieve quantitative detection of Kana in the sample.

[0046] The experimental results are shown in Table 1: The recovery rates of fish extract samples ranged from 98.0% to 102.6%, with relative standard deviations of 0.21% to 2.57%, demonstrating good accuracy and reliability. The results indicate that the dual-emission aptamer sensor based on AIE nanomaterials of this invention is suitable for the practical detection of Kana in animal-derived foods.

[0047] Table 1. Detection of Kana concentration in fish meat extract (n=7)

[0048] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. All equivalent modifications, substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of the patent coverage of the present invention.

Claims

1. A dual-emission antibiotic aptamer sensor based on AIE nanomaterials, characterized in that, Including blue luminescent material G-VP3NP, red luminescent material NMM dye, hairpin probe HP, and bioenzyme Exo III; The G-VP3NP is AIE nanoparticle VP3NP modified with G-rich single-stranded DNA; the AIE nanoparticle VP3NP is a triphenylene aggregate with carboxyl groups on its surface. The HP is hairpin DNA containing the target antibiotic aptamer sequence.

2. The dual-emission antibiotic aptamer sensor based on AIE nanomaterials according to claim 1, characterized in that, The preparation method of the G-VP3NP includes the following steps: (1) Dissolve AIE dye VP3 and PSMA in tetrahydrofuran to obtain solution A and solution B respectively; mix solution A and solution B evenly and pour into ultrapure water, sonicate, centrifuge and wash with ultrapure water, and finally disperse the precipitate in sterile water to obtain VP3NP solution; (2) For the target antibiotic, design G-rich single-stranded DNA containing amino groups and prepare it into a stock solution to obtain G-ssDNA solution; (3) The VP3NP solution obtained in step (1) is mixed with an aqueous solution containing EDC and NHS and reacted. G-ssDNA solution is added and the reaction continues. After the reaction is completed, the blue luminescent G-VP3NP is obtained by centrifugation and washing with ultrapure water.

3. The dual-emission antibiotic aptamer sensor based on AIE nanomaterials according to claim 2, characterized in that, In step (1), the concentration of AIE dye VP3 in solution A is 3-18 mg / mL; and the concentration of PSMA in solution B is 5-20 mg / mL.

4. The dual-emission antibiotic aptamer sensor based on AIE nanomaterials according to claim 2, characterized in that, In step (1), the volume ratio of solution A to solution B is (15-20):1; the volume ratio of the mixture of solution A and solution B to ultrapure water is 1:5-15.

5. The dual-emission antibiotic aptamer sensor based on AIE nanomaterials according to claim 2, characterized in that, The concentration of the G-ssDNA solution in step (2) is 5-100 µM; in the aqueous solution containing EDC and NHS in step (3), the concentration of EDC is 5-30 µM and the concentration of NHS is 10-50 µM.

6. The dual-emission antibiotic aptamer sensor based on AIE nanomaterials according to claim 2, characterized in that, The volume ratio of the VP3NP solution, the aqueous solution containing EDC and NHS, and the G-ssDNA solution in step (3) is 0.3-3:0.5-2:0.2-1.

7. The application of the dual-emission antibiotic aptamer sensor based on AIE nanomaterials as described in any one of claims 1-6 in the detection of antibiotics.

8. The application according to claim 7, characterized in that, Includes the following steps: Step 1: Dissolve G-VP3NP solution, HP solution, and Exo III in a buffer solution and heat to 70°C. o C-95 o Keep at C for 3-10 min, allow to cool naturally, then add NMM solution. Collect the blue fluorescence signal intensity at 420 nm and the red fluorescence signal intensity at 624 nm under 350 nm excitation, denoted as I'. 420 and I' 624 As a blank control, it was used to detect changes in fluorescence signal intensity; Step 2: Take the sample to be tested and incubate it with HP solution for 10-60 min. Then add G-VP3NP solution and ExoIII. o C-37 o After reacting at C for 40-120 min, dissolve in buffer solution and heat to 70°C. o C-95 o At C, maintain for 3-10 min, allow to cool naturally, then add NMM solution. Under 350 nm excitation, collect the blue fluorescence signal intensity at 420 nm and the red fluorescence signal intensity at 624 nm, denoted as I0 and I1, respectively. 420 and I 624 ;if I 420 Greater than I' 420 And I 624 Less than I' 624 This indicates that the target antibiotic is present in the sample being tested.

9. The application according to claim 8, characterized in that, Will I 420 / I 624 Substituting the value into the standard curve yields the concentration of the target antibiotic in the sample to be tested.

10. The application according to claim 9, characterized in that, The standard curve is constructed as follows: Different concentrations of target antibiotic standard solutions were co-incubated with HP solution for 10-60 min, followed by the addition of G-VP3NP solution and Exo III. o C-37 o After reacting at C for 40-120 min, dissolve in buffer solution and heat to 70°C. o C-95 o At 350 nm, maintain the temperature for 3-10 min, allow it to cool naturally, then add NMM solution. Under 350 nm excitation, collect the blue fluorescence signal intensity at 420 nm and the red fluorescence signal intensity at 624 nm. Establish the linear relationship between the ratio of blue fluorescence signal intensity to red fluorescence signal intensity and the target antibiotic concentration to obtain the corresponding standard curve.

Images