Method for targeted blocking of antibiotic resistance gene horizontal transfer based on replication-deficient engineering bacteriophage and application
By replicating defective engineered phages to deliver the CRISPR-Cas9 system, the problems of ARGs diffusion and biosafety risks in traditional phage therapy have been solved, achieving efficient and safe blocking of antibiotic resistance genes.
Patent Information
- Application Number
- CN202511742147.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-25
- Publication Date
- 2026-02-24
AI Technical Summary
In existing technologies, traditional phage therapy may release antibiotic resistance genes (ARGs) when killing host bacteria, causing them to spread in the environment. Furthermore, engineered phages pose biosafety risks and are difficult to effectively block the horizontal transfer of antibiotic resistance genes.
By employing replication-defective engineered phages carrying the CRISPR-Cas9 system, and using phage display technology to encapsulate and target the cleavage of antibiotic resistance genes, specific clearance of antibiotic resistance genes is achieved, preventing phage replication and residue in the host.
It achieves highly specific targeted clearance of antibiotic resistance genes, reduces the risk of drug resistance gene spread in the environment, and improves biosafety.
Smart Images

Figure CN121555533A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of environmental microbiology and genetic engineering technology, specifically relating to a method and application of targeting and blocking the horizontal transfer of antibiotic resistance genes based on replication-defective engineered bacteriophages. Background Technology
[0002] The rapid spread of antibiotic resistance genes (ARGs) among bacterial populations, especially through horizontal gene transfer (HGT), is a major driving force behind the escalating problem of antibiotic resistance (Brito, IL; Examining horizontal gene transfer in microbial communities. Nat. Rev. Microbiol., 2021, 19(7): 442-453). HGT is mainly achieved through three pathways: conjugation (plasmid-mediated), transduction (phage-mediated), and transformation (uptake of cell-free DNA). Among these, mobile genetic elements (MGEs) carrying ARGs, such as plasmids, play a key role.
[0003] The development of traditional antibiotics is far slower than the evolution of drug-resistant bacteria. Phage therapy is considered a promising alternative strategy, but traditional lytic phages mainly work by lysing host bacteria (Lin JX; DuF.Y.; Long M., et al.; Limitations of phage therapy and corresponding optimization strategies: A review. Molecules, 27(6), 1857). While this "killing" strategy can reduce the number of drug-resistant bacteria, it may also release a large number of ARGs and virulence factors into the environment at the moment of lysis, which may facilitate other bacteria to acquire ARGs through transformation pathways, and may even accelerate the spread of ARGs through generalized transduction (Wang Q.; Wang M.; Yang Q., et al.; The role of bacteriophages in facilitating the horizontal transfer of antibiotic resistance genes in municipal wastewater treatment plants, Water Research, 2025, 268: 122776).
[0004] The CRISPR-Cas9 system, as a revolutionary gene-editing tool, has been applied to precisely cut specific DNA sequences. Most existing technologies focus on using this system to cut bacterial chromosomes or essential genes to achieve specific "killing" of drug-resistant bacteria. However, simply killing the host bacteria cannot solve the problem of the spread of ARGs "gene pool" in the environment. In addition, if the engineered phages used for delivery (especially temperate phages) can replicate or integrate in the host, they may carry virulence genes or their genome may remain in the environment, posing biosafety risks (Gummalla VS; Zhang Y.; Liao Y.T., et al.; The role of temperate phages in bacterial pathogenicity, Microorganisms, 2023; 11(3):541).
[0005] Therefore, there is an urgent need to develop a novel strategy that does not rely on host lysis, can specifically eliminate antibiotic resistance genes (ARGs), and has high biosafety, in order to block the horizontal transfer of antibiotic resistance genes at the source. Summary of the Invention
[0006] The purpose of this invention is to overcome the technical problems existing in the prior art, such as the release of ARGs due to lysis strategies and the biosafety risks of engineered phages. It proposes a method and application for targeting and blocking the horizontal transfer (HGT) of antibiotic resistance genes (ARGs) based on replication-defective engineered phages (RD-Phage). By encapsulating a CRISPR-Cas9 system with targeted cleavage of resistance genes through a packaging system related to phage display technology, replication-defective engineered phages (RD-Phage) are obtained, which can reduce the risk of drug resistance gene spread in the environment and medical scenarios.
[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0008] A method for targeting and blocking the horizontal transfer of antibiotic resistance genes based on replication-deficient engineered phages. The replication-deficient engineered phages have the dual functions of phage host phenotype recognition and CRISPR-Cas9 gene targeting cleavage, selectively cleaving / removing plasmids or mobile genetic elements carrying drug resistance genes, thereby blocking the horizontal transfer of drug resistance genes.
[0009] First, the sequence sgTet, which specifically targets the tetB gene, and the Cas9 gene were cloned into a replication-deficient phage vector to obtain the recombinant plasmid pComb3XSS-Cas9-sgTet. Then, the recombinant plasmid was packaged using the f1 ori phage display system to obtain a high-titer, replication-deficient phage vector pComb3XSS-Cas9-sgTet-f1 ori. Finally, phage hM13 was prepared using the Escherichia coli XL1-Blue strain containing this phage vector.
[0010] The replication-defective engineered phages constructed using the above method possess CRISPR-Cas9 gene editing elements, including the Cas9 nuclease gene and a gRNA sequence that specifically targets antibiotic resistance genes.
[0011] The replication-defective engineered phage proposed in this invention can be applied to block the horizontal transfer of antibiotic resistance genes, such as on the surface of medical equipment, in water bodies, soil, and biofilms, to clear ARGs or reduce the frequency of horizontal ARG transfer. After being delivered to the CRISPR-Cas9 system, the engineered phage does not have stable genetic replication capabilities. The phage coat rapidly degrades naturally within the bacteria, and the exogenous DNA it carries, i.e., the phage genome, is rapidly degraded under the action of endogenous nucleases in the bacteria, thus avoiding the risk of engineered phage residue.
[0012] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0013] 1) Dual specificity: It combines the ability of bacteriophages to recognize specific host phenotypes with the specific recognition of ARGs sequences by CRISPR-Cas9, achieving dual precise targeting.
[0014] 2) High biosafety: The use of replication-defective phages means that after delivering the elements, the phages cannot replicate in the host, and the exogenous DNA is easily degraded by the host, thus avoiding the residual and unintended evolution of engineered phages in the environment. Attached Figure Description
[0015] Figure 1 This is a plasmid construction map of the CRISPR-Cas9 system (pComb3XSS-Cas9-sgTet) targeting antibiotic resistance genes in Example 1.
[0016] Figure 2 This is a plasmid construction map of the CRISPR-Cas9 system phage vector (pComb3XSS-Cas9-sgTet-f1 ori) containing packaging signals in Example 2.
[0017] Figure 3This is a morphological image (transmission electron microscope) of the replication-defect engineered phage RD-CRISPR-Phage:hM13 (VCSM13 containing pComb3XSS-Cas9-sgTet-f1 ori) prepared in Example 3.
[0018] Figure 4 This describes the effect of the replication-defective engineered phage RD-CRISPR-Phage:hM13 (VCSM13 containing pComb3XSS-Cas9-sgTet-f1 ori) in Example 5 on the elimination of resistance genes in antibiotic-resistant bacteria. Detailed Implementation
[0019] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings.
[0020] Example 1: Construction of a CRISPR-Cas9 system targeting antibiotic resistance genes (pComb3XSS-Cas9-sgTet)
[0021] 1. Culture medium:
[0022] Formula for 1 L of 2×YT medium: 5.0 g sodium chloride, 16.0 g tryptone, and 10.0 g yeast extract. Sterilize at 121℃ for 15 min.
[0023] 1 L PBS formulation: 8 g sodium chloride, 0.2 g potassium chloride, 0.27 g potassium dihydrogen phosphate dodecahydrate, 1.42 g disodium hydrogen phosphate. Sterilize at 121 °C for 15 min.
[0024] 1 L of PEG / NaCl formulation: 292.5 g sodium chloride, 1000 g PEG8000. Sterilize at 121 ℃ for 30 min.
[0025] 2. Plasmid extraction:
[0026] Plasmids were extracted from DH5α containing pComb3XSS-Cas9 plasmid, and the plasmid concentration was measured using a Q5000 instrument. The plasmids were stored at -20 °C.
[0027] 3. Fragment amplification:
[0028] (1) Select phanta enzyme and add it to the PCR system:
[0029] name Volume (5×) Phanta 1 μL bacterial solution 1 μL F 2 μL R 2 μL 2×Buffer 25 μL dNTP 1 μL <![CDATA[ddH2O]]> 18 μL
[0030] The complete nucleotide sequence of the introduced sgTetB fragment is shown in SEQ ID No: 1, and its primer sequence is as follows:
[0031] Primers Primer sequence 5'-3' base F AGCCTTCACGCGTTGAGAAGCTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC 58 bp R CAGCTTCTCAACGCGTGAAGGCTAAGATCTGACTCCATAACAGAGTACTCGCCTATG 57 bp
[0032] (2) Set the PCR instrument program: 95 ℃ pre-denaturation for 3 min, 95 ℃ denaturation for 15 s, 56 ℃ annealing for 15 s, 72 ℃ extension for 3 min 36 s, 31 cycles, then extend at 72 ℃ for another 10 min, and store at 4 ℃ for later use.
[0033] temperature time 95 ℃ 3 min 95 ℃ 15 s 56 ℃ 15 s 72 ℃ 3 min 36 s 72 ℃ 10 min 16 ℃ 10 min
[0034] (3) Gel preparation: two 150 mL TAE (1 X), 15 μL nucleic acid, dye, and 1.5 g agarose.
[0035] (4) Electrophoresis: 110 V, 90 min.
[0036] 4. Glue recycling:
[0037] (1) Cut the rubber under ultraviolet light (irradiation should not exceed 30 s).
[0038] (2) Place the cut glue into a 2 mL EP tube, add an equal volume of XP2 Bingding Buffer, and bathe in a 60℃ water bath for about 7 minutes (adjust according to the size of the glue). Shake it every 2 minutes to mix it evenly. At the same time, add 1 mL of ddH2O to the water bath.
[0039] (3) Take one HiBind DNA Mini binding column and put it into a 2 mL collection tube; only 700 μL of DNA gel can be transferred into the binding column at one time, and the rest can be transferred in multiple times. At room temperature, use 12000 xg for 1 min, discard the filtrate, and put the column back into the collection tube.
[0040] (4) Add 300 μL XP2 Bingding Buffer to the binding column, incubate at 12000 xg for 1 min at room temperature, and discard the filtrate.
[0041] (5) Put the HiBind DNA Mini Column back into the 2 mL collection tube, add 700 μL SPW Buffer (diluted with anhydrous ethanol) to the binding column, centrifuge at 12000 xg for 1 min at room temperature, and discard the filtrate; repeat this step again.
[0042] (6) Put the HiBind DNA Mini Column back into the 2 mL collection tube, centrifuge at 12000 xg for 2 min to remove any remaining liquid from the binding column matrix.
[0043] (7) Place the HiBind DNA Mini Column in a clean 1.5 mL centrifuge tube and leave it at room temperature for 2-3 min to allow the ethanol to evaporate completely.
[0044] (8) Add 15-30 μL of pre-baked ddH2O at 60 ℃ to the binding column matrix (drop it in the middle), place at room temperature for 1 min, and centrifuge (12000 xg, 1 min) to elute DNA.
[0045] (9) The concentration was measured using a Q5000.
[0046] 5. Gibson connection:
[0047] (1) Ligate the purified PCR products end-to-end:
[0048] sample volume Gibson Connecting Fluid 10 μL Excerpt 2 μL <![CDATA[ddH2O]]> 8 μL
[0049] (2) After mixing the system, centrifuge and then amplify using a PCR instrument (Gibson program: 50 ℃ 1 h; 16 ℃ 10 min).
[0050] 6. Electroplating and coating:
[0051] (1) Take out 50 μL of DH5α competent cells from a -80 ℃ refrigerator and label them.
[0052] (2) Take the electric rotating cup and the same receptive state and store them on ice, and place them one by one.
[0053] (3) Take 5 μL of the product after Gibson ligation and add it to the corresponding centrifuge tube containing DH5α competent cells.
[0054] (4) Use a 60 μL pipette tip to mix thoroughly, and then draw 60 μL into the central groove of the electric rotary cup.
[0055] (5) Add 1 mL of 2×YT medium to a 1.5 mL centrifuge tube.
[0056] (6) Before using the electric rotary instrument, wipe the electrode plates on the side of the electric rotary cup dry, place the electrode plates close to the left and right sides of the instrument, and set the voltage to 2.47 kV.
[0057] (7) After the electroporation is completed, take 1 mL of the culture medium from step 5 and add it to the electroporation cup, and mix well.
[0058] (8) Pour the contents back into the centrifuge tube (step 5) and incubate at 30 °C for 1 h.
[0059] (9) Plate spreading: Take 500 μL of bacterial culture after 1 h of incubation in the incubator and spread it evenly on one side of the plate using a glass spreader.
[0060] (10) Seal with sealing film and incubate upside down in a 37 ℃ incubator.
[0061] 7. Colony PCR:
[0062] (1) The Taq enzyme used for verification, in a 25 μL system, is as follows:
[0063] name Volume 1× 2×Taq-As Mix 12.5 μL bacterial solution 1 μL F 0.5 μL R 0.5 μL <![CDATA[ddH2O]]> 11.5 μL
[0064] The primers for colony PCR are:
[0065] Primers Primer sequence 5'-3' base F1 AATGCCGTCGTTGGAACTG 19 bp R1 TGGAACAACACTCAACCCTATC 22 bp F2 CCTTTGACAACGGCTCTATTCC 22 bp R2 TTTGCGGTTGCTTTGCCTATT 21 bp F3 CCTGATTCTGTGGATAACCGTATT 24 bp R3 CGCCAATGGACCAACATAATAAG 23 bp
[0066] (2) The PCR procedure is as follows:
[0067] temperature time 95 ℃ 10 min 95 ℃ 30 s 56 ℃ 30 s 72 ℃ 2 min 72 ℃ 10 min 16 ℃ 10 min
[0068] (3) Electrophoresis: 140 V, 25 min.
[0069] 8. Bacterial PCR: The procedure is the same as colony PCR. The band sizes are consistent, and sequencing is performed.
[0070] After plasmid construction, sequencing was performed. The complete nucleotide sequence of the constructed pComb3XSS-Cas9-sgTet is shown in SEQ ID No: 2.
[0071] Figure 1 This is a plasmid construction map of the CRISPR-Cas9 system (pComb3XSS-Cas9-sgTet) targeting antibiotic resistance genes in Example 1. The map shows the plasmid structure, including CRISPR-Cas9 elements (the Cas9 gene and the gRNA sequence sgTet targeting the tetB gene) and a selectability marker. The plasmid design ensures that the CRISPR-Cas9 system can specifically cleave target ARGs after phage infection.
[0072] Example 2: Construction of a CRISPR-Cas9 system phage vector containing packaging signals (pComb3XSS-Cas9-sgTet-f1ori)
[0073] The plasmid construction steps are the same as in Example 1. The complete nucleotide sequence of the introduced f1 ori fragment is shown in SEQ ID No: 3, and its primer sequence is:
[0074] Primers Primer sequence 5'-3' base F GGAGGATCTGGGAAATTGTAAGCG 24 bp R AAAAGTGCCACCTGACGCGCCCTGTA 26 bp
[0075] After plasmid construction and sequencing, the complete nucleotide sequence of the constructed pComb3XSS-Cas9-sgTet-f1 ori is shown in SEQ ID No: 4.
[0076] Figure 2 This is a plasmid construction map of the CRISPR-Cas9 system phage vector (pComb3XSS-Cas9-sgTet-f1 ori) containing packaging signals, as shown in Example 2. The map illustrates the coupling design between the packaging signal and the CRISPR-Cas9 system, including key components such as f1 ori, to assist in the efficient packaging of phage VCSM13. This design successfully yielded high-titer replication-defective engineered phage particles. This map verifies the feasibility of the preparation method and provides a foundation for "efficiently blocking HGT." The engineered phage obtained based on the f1 ori packaging signal, due to its replication-defective characteristics, avoids the persistent presence of engineered phages in the environment.
[0077] Example 3: Preparation of replication-defective engineered phage RD-CRISPR-Phage:hM13 (VCSM13 containing pComb3XSS-Cas9-sgTet-f1 ori)
[0078] 1. Preparation of XL1-Blue electrocompetent states:
[0079] (1) Take Escherichia coli out of the -80 ℃ freezer, thaw it on ice, and culture it on 2×YT solid medium.
[0080] (2) After a single colony grows, pick a single colony and inoculate it into 5 mL of 2×YT liquid medium and incubate overnight at 37 °C.
[0081] (3) Transfer the cultured bacterial solution at a ratio of 1% (1 mL) to an Erlenmeyer flask containing 2×YT (100 mL) liquid culture medium, and place it in a shaker at 200 rpm and 37 ℃ for shaking culture.
[0082] (4) Pre-cool all the supplies needed later on ice, including pipette tips, centrifuge tubes, EP tubes, ddH2O and 10% glycerol, and pre-cool the 50 mL centrifuge to 4 °C.
[0083] (5) The culture time in the conical flask is generally 3-4 hours. If it is longer than 3 hours, take 1 mL of sample at the ultra-clean bench every once in a while to measure OD. 600 When OD 600 When the concentration is 0.5-0.6, immediately transfer it to a 50 mL centrifuge tube and place it on ice for 20 minutes, inverting it several times every 5 minutes during this period.
[0084] (6) Centrifuge at 4000 rpm for 15 min in a 50 mL centrifuge and discard the supernatant.
[0085] (7) Resuspend in 20 mL ddH2O, centrifuge at 4000 rpm for 15 min in a centrifuge (4 ℃), and discard the supernatant.
[0086] (8) Resuspend in 20 mL of 10% glycerol, centrifuge at 4000 rpm for 15 min in a centrifuge (4 ℃), and discard the supernatant.
[0087] (9) Resuspend the bacterial culture in 10% glycerol at 1% bacterial volume and centrifuge at 4000 rpm for 15 min in a centrifuge (4 ℃). At this time, the competent cells are prepared. Aliquot 50 μL into 1.5 mL EP tubes and store in a -80 ℃ refrigerator.
[0088] 2. Transfer the pComb3XSS-Cas9-sgTet-f1 ori electrotransfer state to the XL1-Blue electrotransfer competent state:
[0089] (1) Take out 50 μL of XL1-Blue electrocompetent state from a -80 ℃ refrigerator and mark it.
[0090] (2) Take the electric rotating cup and the same receptive state and store them on ice, and place them one by one.
[0091] (3) Take 5 μL of the product after Gibson ligation and add it to the corresponding centrifuge tube containing XL1-Blue electrocompetent state.
[0092] (4) Use a 60 μL pipette tip to mix the mixture thoroughly, and then draw 60 μL into the central groove of the electric rotary cup.
[0093] (5) Add 1 mL of 2×YT medium to a 1.5 mL centrifuge tube.
[0094] (6) Before using the electric rotary instrument, wipe the electrode plates on the side of the electric rotary cup dry, place the electrode plates close to the left and right sides of the instrument, and set the voltage to 2.47 kV.
[0095] (7) After the electroporation is completed, take 1 mL of the culture medium from step 5 and add it to the electroporation cup, and mix well.
[0096] (8) Pour the contents back into the centrifuge tube (step 5) and incubate at 30 °C for 1 h.
[0097] (9) Take a petri dish, write the label, and invert the plate to blow the plate (Amp-Tet resistance).
[0098] (10) Dilute three gradients, take 200 μL of bacterial solution after 1 h of incubation in the incubator and spread it on one side of the plate, and spread it evenly with a glass spreader.
[0099] (11) Seal the opening with sealing film and incubate upside down in a 37 ℃ incubator.
[0100] (12) Colonies grew on the Amp-Tet resistant plate, indicating successful electroporation.
[0101] 3. VCSM13 phage amplification:
[0102] (1) Streak helper phage VCSM13 (inoculation loop) on 2×YT agar plate.
[0103] (2) Prepare 2×YT semi-solid agar (0.7% agar) as the upper layer agar, cool it to 50 ℃ (it can be placed in a 50 ℃ water bath after preparation), take 5 mL of upper layer agar and add 0.5 mL of fresh XL1-Blue bacteria (OD) cultured overnight. 600 To reach a concentration of 0.8, generally inoculate with liquid 2×YT medium at a ratio of 1:100 and incubate at 37 ℃ with full shaking for 15 h), mix thoroughly, and pour the upper layer of agar along the direction of the streaked concentration from low to high.
[0104] (3) Incubate at 37 ℃ for 10-14 h. Observe the plate against the light. There should be a round, semi-transparent phage plaque about the size of a pipette tip of about 200 μl against a hazy background. Use the pipette tip to puncture a single phage plaque and inoculate it into 100 mL of 2×YT (final concentration of Tet: 30 mg / L, final concentration of Amp: 50 mg / L). Incubate at 37 ℃ with full shaking for 16 h.
[0105] (4) Centrifuge at 8000 rpm for 15 min at 4 ℃, carefully remove the supernatant, dispense into sterile tubes, and store in a 4 ℃ refrigerator.
[0106] 4. Titration of VCSM13 bacteriophage:
[0107] (1) Prepare 2×YT solid culture medium without any antibiotics, heat and melt it, and after the temperature has cooled slightly, pour it into a non-antibiotic solid plate and preheat it in a 37 ℃ constant temperature incubator.
[0108] (2) After heating the upper layer of agar, cool it to 50 °C in a water bath and store it at a constant temperature of 50 °C.
[0109] (3) The phage solution prepared above was cultured in a medium for 10... -1 -10 -13 Gradient dilution.
[0110] (4) Take the overnight cultured XL1-Blue bacterial suspension (OD) 600 =Approximately 1), dispensed into sterile small test tubes, 500 μL / small test tube, labeled 10. -1 -10 -13Dilution rate.
[0111] (5) Add 100 μL of the phage diluted in step (3) above to each corresponding standard dilution test tube and mix thoroughly.
[0112] (6) Add 5 mL of the upper layer of agar to each test tube and vortex to mix.
[0113] (7) Pour the prepared plate and incubate at 37°C overnight.
[0114] (8) Calculate the number of plaques on the plate and multiply it by the corresponding dilution factor to obtain the plaque forming unit (pfu) titer per 100 μL of phage.
[0115] 5. Phage hM13 was prepared using *Escherichia coli* XL1-Blue strain containing the pComb3XSS-Cas9-sgTet-f1 ori system:
[0116] (1) Take out pure XL1-Blue from a -20 ℃ freezer (ice bath until melted).
[0117] (2) Take 50 μL of bacterial culture and add it to a tube containing 5 mL of 2×YT liquid culture medium with Tet resistance.
[0118] (3) Incubate overnight at 37 °C.
[0119] (4) Streak VCSM13 on an antibiotic-free plate, pour it into a 5 mL agar test tube, and incubate at 37 °C overnight.
[0120] (5) Transfer the overnight culture to a 2×YT bottle and incubate at 37 ℃ for OD growth. 600 Up to 0.3.
[0121] (6) Pick 5 VCSM13 plaques and add them to a 2×YT bottle. Incubate overnight at 37 ℃.
[0122] (7) Centrifuge at 7500 r / min for 10 min to remove cells.
[0123] (8) Add 20% PEG / NaCl solution to the supernatant to precipitate the phage, shake vigorously to mix, and let it settle.
[0124] (9) Centrifuge at 12000 xg / min for 10 min to settle the phage, discard the supernatant to remove the cells, which is hM13 (VCSM13 containing pComb3XSS-Cas9-sgTet-f1 ori).
[0125] Figure 3This is a morphological image (transmission electron microscope) of the replication-defect engineered phage RD-CRISPR-Phage:hM13 (VCSM13 containing pComb3XSS-Cas9-sgTet-f1 ori) prepared in Example 3. The image shows the typical morphology of the engineered phage under transmission electron microscopy, presenting a complete phage particle structure, with a size and shape similar to the wild-type M13 phage.
[0126] Example 4: Validation of engineered phage RD-CRISPR-Phage:hM13 (VCSM13 containing pComb3XSS-Cas9-sgTet-f1 ori)
[0127] 1. RD-CRISPR-Phage: hM13 (VCSM13 containing pComb3XSS-Cas9-sgTet-f1 ori) resistance verification:
[0128] (1) Take 100 μL of the prepared hM13 and add it to 5 mL of 2×YT liquid medium (antibiotic-free), then add 500 μL of pure XL1-blue bacterial solution, and mix and incubate in a shaker at 37 ℃ for 1-3 h.
[0129] (2) The mixture of phage and bacterial culture was streaked in three zones on a 2×YT plate with Amp-Tet resistance. 5 ml of upper agar containing 500 μL XL1-blue was poured (heated to 50 °C) and incubated in a 37 °C incubator for 12 h.
[0130] (3) Colonies grew on the plate containing Amp-Tet, while plaques appeared on the plate without antibiotics.
[0131] 2. RD-CRISPR-Phage: hM13 (VCSM13 containing pComb3XSS-Cas9-sgTet-f1) titer determination:
[0132] (1) Prepare 2×YT culture plates without any antibiotics and preheat them in a 37 ℃ constant temperature incubator.
[0133] (2) Prepare 0.7% agar plates using 2×YT medium, which is the upper agar. Cool to 50 ℃ and store at a constant temperature of 50 ℃.
[0134] (3) The phage solution prepared above was cultured in a medium for 10... -1 -10 -13 Gradient dilution.
[0135] (4) Take the overnight cultured XL1-Blue bacterial suspension (OD) 600 =0.8 (approximately), dispensed into sterile small test tubes, 500 μL / small test tube, labeled 10.-1 Up to 10 -13 Dilution rate.
[0136] (5) Add 100 μL of the phage diluted in step 3 above to each corresponding standard dilution test tube and mix thoroughly.
[0137] (6) Add 5 mL of upper agar to each test tube, immediately pour into the prepared petri dish, and incubate at 37 °C overnight.
[0138] (7) Calculate the number of plaques on the plate and multiply it by the corresponding dilution factor to obtain the plaque forming unit (pfu) titer per 100 μL of phage.
[0139] Example 5: In vitro experiment to block antibiotic resistance gene transfer using engineered bacteriophages
[0140] (1) Preparation of initial bacterial culture: Inoculate pure XL1-Blue in 5 mL of 2×YT liquid medium and culture overnight at 37℃ and 200 rpm.
[0141] (2) The next day, the bacterial culture was diluted 1:100 into fresh 2×YT and cultured at 37 ℃ and 200 rpm until OD. 600 =0.3-0.4.
[0142] (3) Add recombinant phage hM13 at MOI = 10.
[0143] (4) Incubate at 37 ℃ for 1 h to promote infection, then dispense into 5 mL of bacterial culture into each tube, add IPTG (final concentrations of 0, 0.05, 0.1, 0.2, 0.5, and 1 mM), and continue to induce Cas9 expression at 30 ℃ for 4 h.
[0144] (5) After induction, dilute the bacterial solution in a gradient.
[0145] (6) Take 100 µL of each dilution concentration and spread it on the following resistance plates:
[0146] LB agar (antibiotic-free): Total colony count (positive control)
[0147] LB plate (Tet): Observe whether resistance is still present.
[0148] (7) Incubate overnight at 37 ℃, count the number of colonies on each plate, and compare whether there are significant differences between different groups on Tet plates.
[0149] Figure 4This figure shows the clearance effect of the replication-defective engineered phage RD-CRISPR-Phage:hM13 (VCSM13 containing pComb3XSS-Cas9-sgTet-f1 ori) on antibiotic resistance genes in antibiotic-resistant bacteria, as described in Example 5. The figure illustrates the clearance effect of the engineered phage on resistance genes carrying the tetB gene in antibiotic-resistant bacteria at different IPTG induction concentrations. Experimental data show that the number of colonies on Tet-resistant plates decreased significantly with increasing IPTG concentration (0 to 1 mM). For example, under 0.2 mM IPTG induction, the number of Tet-resistant colonies decreased by approximately 80%.
[0150] In summary, this invention achieves targeted clearance of antibiotic resistance genes (ARGs) through the CRISPR-Cas9 system delivered by a replication-defective engineered phage. Experimental results and analysis of the accompanying figures consistently demonstrate that this method possesses high specificity and biosafety, making it suitable for controlling ARGs in environments such as medical devices, water bodies, and soil, and providing a novel strategy for addressing the spread of antibiotic resistance.
Claims
1. A method for targeting and blocking the horizontal transfer of antibiotic resistance genes based on replication-defective engineered bacteriophages, characterized in that, This replication-defective engineered phage possesses the dual functions of phage host phenotype recognition and CRISPR-Cas9 targeted gene cleavage, selectively cleaving / eliminating plasmids or mobile genetic elements carrying drug resistance genes, thereby blocking the horizontal transfer of drug resistance genes.
2. The method for targeting and blocking the horizontal transfer of antibiotic resistance genes based on replication-defective engineered bacteriophages as described in claim 1, characterized in that, First, the sequence sgTet, which specifically targets the tetB gene, and the Cas9 gene were cloned into a replication-deficient phage vector to obtain the recombinant plasmid pComb3XSS-Cas9-sgTet. Then, the recombinant plasmid was packaged using the f1 ori phage display system to obtain a high-titer, replication-deficient phage vector pComb3XSS-Cas9-sgTet-f1 ori. Finally, phage hM13 was prepared using the Escherichia coli XL1-Blue strain containing this phage vector.
3. The method for targeting and blocking the horizontal transfer of antibiotic resistance genes based on replication-defective engineered bacteriophages as described in claim 2, characterized in that, The complete nucleotide sequence of the sgTet is shown in SEQ ID No:
1.
4. The method for targeting and blocking the horizontal transfer of antibiotic resistance genes based on replication-defective engineered bacteriophages as described in claim 2, characterized in that, The complete nucleotide sequence of pComb3XSS-Cas9-sgTet is shown in SEQ ID No:
2.
5. The method for targeting and blocking the horizontal transfer of antibiotic resistance genes based on replication-defective engineered bacteriophages as described in claim 2, characterized in that, The complete nucleotide sequence of the f1 ori is shown in SEQ ID No:
3.
6. The method for targeting and blocking the horizontal transfer of antibiotic resistance genes based on replication-defective engineered bacteriophages as described in claim 2, characterized in that, The complete nucleotide sequence of pComb3XSS-Cas9-sgTet-f1 ori is shown in SEQ ID No:
4.
7. The replication-defective engineered phage constructed by the method according to any one of claims 1-6, characterized in that, The CRISPR-Cas9 gene editing elements possessed by replication-defective engineered bacteriophages include the Cas9 nuclease gene and gRNA sequences that specifically target antibiotic resistance genes.
8. The application of the replication-defective engineered phage as described in claim 7 in blocking the horizontal transfer of antibiotic resistance genes, characterized in that, It can be applied to the surfaces of medical devices, water bodies, soil, and biofilms to remove ARGs or reduce the horizontal transfer frequency of ARGs. After being delivered to the CRISPR-Cas9 system, the engineered phage does not have a stable genetic replication ability. The phage shell is rapidly degraded naturally within the bacteria, and the exogenous DNA it carries, i.e. the phage genome, is rapidly degraded under the action of endogenous nucleases in the bacteria, thus avoiding the risk of engineered phage residue.