Lignin and cellulose degradation strain and application thereof

By loading a composite strain of Pseudomonas aeruginosa and Bacillus fusiforme onto a sessile biochar carrier, the problem of low degradation efficiency of microbial agents under low temperature conditions was solved, achieving high-efficiency composting over a wide temperature range and improving the degradation capacity of cellulose and lignin.

CN121574873APending Publication Date: 2026-02-27LIAONING HENGRUN AGRI CO LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511797001.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-02
Publication Date
2026-02-27

AI Technical Summary

Technical Problem

In existing technologies, microbial agents have problems such as narrow temperature adaptability, low degradation efficiency, and low cell survival rate when degrading cellulose and lignin. They are particularly ineffective under low temperature conditions, and compound agents have poor stability in practical applications, which affects composting efficiency.

Method used

A composite microbial agent was formed by loading a sesquiterpenoid biochar carrier with a combined strain of Pseudomonas aeruginosa and Lysinibacillus fusiformis. This agent is suitable for composting fermentation over a wide temperature range, and is particularly effective in degrading cellulose and lignin under low and normal temperature conditions.

Benefits of technology

This compound microbial agent can efficiently secrete cellulase and lignin-degrading enzymes at both low and normal temperatures, significantly improving composting efficiency, shortening the composting cycle, and enhancing the quality of organic fertilizer. It is suitable for the treatment of agricultural waste under different climatic conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention relates to the technical field of agricultural waste biological treatment, in particular to a lignin and cellulose degrading strain and application thereof. The strain is pseudomonas aeruginosa PA (Pseudomonas aeruginosa), and is preserved in the China General Microbiological Culture Collection Center (CGMCC) on November 6, 2025, and the preservation number is CGMCC NO.36523. The invention further discloses a preparation method of the pseudomonas aeruginosa strain. By screening and optimizing strains and combining with reasonable formula design, the activity of the microbial inoculum in low-temperature and normal-temperature environments is remarkably improved, the technical problems of narrow applicable temperature range, low efficiency, poor product quality, potential environmental risk and the like of the microbial inoculum in the prior art are solved, annual decomposition can be realized, the microbial inoculum is not influenced by seasons, and the yield of the microbial inoculum is improved. Resources are fully utilized, and the resource utilization efficiency is improved.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of agricultural waste biological treatment, and particularly relates to a lignin and cellulose degrading strain and application thereof. BACKGROUND

[0002] Agricultural waste contains a large amount of cellulose and lignin, which are difficult to degrade. The accumulation of such substances not only causes resource waste, but also causes environmental pollution problems. Traditional physical and chemical treatment methods are high in cost and easy to cause secondary pollution, while microbial degradation is gradually becoming a research hotspot due to its environmental friendliness and high efficiency. At present, a variety of microbial agents have been applied to the biological degradation of cellulose and lignin, but there are still problems such as poor environmental adaptability of strains, low degradation efficiency, and significant decrease in activity under low temperature conditions. For example, normal temperature microbial agents metabolize slowly under low temperature conditions, and low temperature special microbial agents are difficult to maintain high degradation capacity when the temperature rises, which limits their practical application range.

[0003] Pseudomonas aeruginosa has strong organic matter decomposition ability and environmental adaptability, and can secrete various enzymes to participate in lignocellulose degradation. Lysinibacillus fusiformis shows stable cellulase and ligninase activity under high and low temperature conditions. However, the application of a single strain often has limited effect, and the application of a compound microbial agent is often unable to fully exert the synergistic effect due to competition or inhibition between strains.

[0004] In addition, microbial agents are susceptible to environmental influences in practical application, and have low survival rate and slow proliferation. Biochar, as an excellent microbial carrier, has the advantages of rich pore structure, large specific surface area, and good adsorption performance, and can provide habitat and protection for microorganisms. Sesbania biochar is derived from natural plants, and has good environmental compatibility and rich nutrient release performance, but its application as an immobilized carrier for compound functional microbial agents has not been systematically studied.

[0005] Composting technology often uses livestock manure, crop straw and forestry residues as raw materials. The stable structure of lignocellulose makes it difficult to decompose, which is the main limiting factor affecting the composting effect. Inoculation of exogenous microorganisms (such as lignin-degrading bacteria and cellulose-degrading bacteria) can effectively destroy the structure of lignocellulose, enhance the activity of microbial communities, speed up the composting process, and shorten the composting period. In existing research, a variety of microorganisms naturally having lignocellulose degradation ability have been found, but their enzyme activity is significantly inhibited under low temperature conditions, and their metabolism is slow, and their decomposition efficiency is obviously insufficient. The physical warming methods commonly used in low-temperature composting, including steam injection, electric heating assistance, and addition of thermal insulation materials, have problems such as high energy consumption, complicated operation, unstable temperature maintenance, and limited application effect.

[0006] Therefore, it has important practical significance and application value to develop a complex microbial agent capable of efficiently degrading cellulose and lignin in a wide temperature range, especially in an alternating environment of low temperature and normal temperature, and having good carrier compatibility and operation stability. SUMMARY

[0007] The present application aims at the problems of narrow temperature adaptation range, insufficient degradation efficiency, and low survival rate of microbial degradation agents, and provides a low-temperature-resistant lignin and cellulose degrading strain and application.

[0008] To achieve the above-mentioned purpose, the technical scheme adopted by the present application is: A lignin and cellulose degrading strain, the strain is Pseudomonas aeruginosa PA, which was preserved in the China General Microbiological Culture Collection Center on November 6, 2025, and the preservation number is CGMCC NO.36523.

[0009] A lignin and cellulose degrading agent, the agent contains the strain.

[0010] The agent is a mixture of the agent and fusiform lysinibacillus LF, wherein PA and LF are mixed at a mass ratio of 1:1. The fusiform lysinibacillus (Lysinibacillus sp.) LF was preserved in the China General Microbiological Culture Collection Center on October 24, 2024, and the preservation number is CGMCC No:32336.

[0011] The agent is a culture solution or a suspension solution of the strain.

[0012] The culture solution of the agent is obtained by mixing the culture solutions of the Pseudomonas aeruginosa PA and the fusiform lysinibacillus LF in a certain proportion after the culture solutions are cultured in LB liquid medium at 10-20℃ to the logarithmic growth phase, and then centrifuging the culture solution to collect the precipitate, and resuspending the precipitate in sterile normal saline to obtain a bacterial suspension solution with OD600 of 0.7-1.4.

[0013] The agent is a mixture of the strain and an adsorption carrier, wherein the strain and the carrier are mixed at a mass ratio of 1:1, and the adsorption carrier is a sesbania charcoal.

[0014] The adsorption carrier is sesbania charcoal with a particle size of 0.5-2 mm and a specific surface area not less than 200 m 2 / g.

[0015] The application of the strain or the agent, the strain or the agent is used for degrading lignin and / or cellulose.

[0016] Use of the strain or the microbial inoculant in the degradation of lignin and / or cellulose at low temperature (5-15 DEG C) and normal temperature (20-35 DEG C).

[0017] A composting maturity agent containing the strain or the microbial inoculant.

[0018] The strain or the microbial inoculant is added to raw materials to be treated for composting treatment.

[0019] The composting maturity agent can be added to cow dung, straw or their mixture for composting treatment, which can effectively promote the degradation of cellulose and lignin, accelerate the composting and improve the quality of organic fertilizer.

[0020] The application has the advantages that: The microbial inoculant provided by the application is based on a Pseudomonas aeruginosa and Lysinibacillus fusiformis complex bacterial system and is loaded on a Sesbania charcoal carrier, is suitable for efficient composting fermentation (promoting the degradation of cellulose and lignin) of agricultural waste such as livestock and poultry manure and straw in a wide temperature range (5-35 DEG C), and can continuously exert a degradation effect under low-temperature and non-low-temperature conditions. The maturity agent effectively solves the problems of narrow temperature adaptation range, single function and poor stability in actual application of existing microbial inoculants, significantly improves the composting efficiency, shortens the composting period and reduces the treatment cost.

[0021] For organic waste such as cow dung with high cellulose and lignin content and difficult to be rapidly degraded, the Pseudomonas aeruginosa and Lysinibacillus fusiformis used in the application both have wide temperature adaptability and can still efficiently secrete cellulase and lignin-degrading enzyme under low-temperature (5-15 DEG C) and normal temperature (20-35 DEG C) conditions, and exhibit stable organic matter decomposition capacity. The Sesbania charcoal as a carrier not only effectively fixes and protects the functional strains and enhances the environmental stress resistance of the strains, but also can further synergistically improve the degradation efficiency of the complex microbial inoculant by adsorbing nutrients and improving the microbial growth microenvironment.

[0022] In the prior art, microbial strains with low-temperature and normal-temperature activity and capable of efficiently degrading cellulose and lignin are relatively scarce. The application fuses the metabolic characteristics of the two strains, so that the strains still maintain high enzyme activity and degradation efficiency at multiple typical temperatures such as 10 DEG C and 20 DEG C, solves the bottleneck problem of unstable performance of single strains or conventional complex microbial inoculants in actual composting temperature fluctuations, and provides reliable technical support for stable operation of composting engineering under different climate conditions throughout the year.

[0023] The 16S rDNA molecular identification of the microbial inoculant determines that the strains are Pseudomonas aeruginosa and Lysinibacillus fusiformis respectively In another aspect, this invention loads a composite bacterial suspension of *Pseudomonas aeruginosa* (PA) and *Lysinibacillus fusiformis* (LF) onto a sessile biochar carrier to prepare a solid-form composting agent. This formulation not only effectively maintains the biological activity and stability of the functional strains but also greatly facilitates the storage, transportation, and on-site application of the agent.

[0024] Because the selected *Pseudomonas aeruginosa* and *Bacillus fusiforme* both possess excellent wide-temperature adaptability and highly efficient cellulose and lignin-degrading enzyme systems, this composting agent can quickly activate and continuously function under different environmental temperature conditions. It can rapidly decompose macromolecular cellulose and lignin in organic waste such as straw and livestock manure, accelerating material decomposition and significantly shortening the composting cycle.

[0025] In particular, sesame biochar carriers not only provide a favorable habitat and protection for functional microorganisms, preventing cell inactivation under adverse conditions, but also adsorb nutrients and improve substrate aeration through their rich porous structure, further synergistically enhancing the degradation efficiency of the strains. Therefore, this composting agent is suitable for the efficient resource utilization of various agricultural organic solid wastes under different climatic seasons and regional conditions, and has broad application potential. Attached Figure Description

[0026] Figure 1 The images show the morphological characteristics of PA and LF strains provided in the embodiments of the present invention.

[0027] Figure 2 Results of lignin degradation at low temperature (10°C) by PA, LF, RE, and sesquiterpene biochar-supported REC strains provided in the embodiments of the present invention.

[0028] Figure 3 The results of lignin degradation by PA, LF, RE strains and sesquiterpene biochar-supported REC strains provided in the embodiments of the present invention at room temperature (20°C).

[0029] Figure 4 The results of cellulose degradation at low temperature (10°C) by PA, LF, RE, and sesquiterpene biochar-supported REC strains provided in the embodiments of the present invention.

[0030] Figure 5 The results of cellulose degradation at room temperature (20°C) by PA, LF, RE, and sesquiterpene biochar-supported REC strains provided in the embodiments of the present invention.

[0031] Figure 6The germination rate, radicle length, and germination index of the REC group and the blank group provided in the embodiments of the present invention are shown.

[0032] Figure 7 The graph shows the changes in pH and EC in the REC group and the blank group during the composting of cow manure under low temperature conditions, as provided in the embodiments of the present invention.

[0033] Figure 8 The diagram shows the changes in OM (Oxygen Oxygen) in the REC group and the control group during the composting of cow manure under low temperature conditions, as provided in the embodiments of the present invention.

[0034] Figure 9 The graph shows the nitrogen changes in the REC group and the blank group during the cow manure composting process under low temperature conditions, as provided in the embodiments of the present invention. Detailed Implementation

[0035] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0036] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0037] Example 1: Isolation and Identification of Strains This embodiment details the isolation and identification process of Pseudomonas aeruginosa (PA) and Lysinibacillus fusiformis (LF).

[0038] 1) Sample enrichment and separation: 10 g each of humus soil collected from the low-temperature environment (5-15℃) and agricultural compost collected at normal temperature (20-30℃) in northern China during winter were used. The samples were inoculated into inorganic salt liquid culture media with sodium carboxymethyl cellulose (CMC-Na) and alkaline lignin as the sole carbon sources, and cultured at 10℃ and 30℃ with shaking at 150 rpm for 7 days. The enriched bacterial solutions were then serially diluted, spread onto corresponding solid screening plates, and incubated upside down in incubators at 10℃ and 30℃ for 3-5 days, respectively. See [details omitted]. Figure 1 .

[0039] 2) Purification and initial screening: Single colonies that grew well at different temperatures were selected and repeatedly streaked on LB agar plates for purification. The purified strains were then subjected to Gram staining and microscopic observation, yielding one Gram-negative bacillus and one Gram-positive spore-forming bacillus.

[0040] 3) Enzyme production characteristics verification: Strains PA and LF were inoculated on CMC-Na Congo red plates and lignin-guaiacol identification plates, and both strains were cultured at 10℃ and 20℃ for 72 h, respectively. The results showed that both strains could produce obvious hydrolysis zones (CMC-Na plates) or reddish-brown zones (lignin plates) at both temperatures, proving that they have the ability to secrete cellulase and laccase / peroxidase.

[0041] 4) Molecular biological identification: Genomic DNA was extracted from strains PA and LF, and their 16S rDNA sequences were amplified by PCR and sequenced. The sequencing results were compared with those in a database. The two strains were finally identified as *Pseudomonas aeruginosa* PA and *Lysinibacillus fusiformis* LF, respectively.

[0042] 16SRNA sequence Pseudomonas aeruginosa: CAGAACGAAGACTGGGTCAAGCAGTTGGAGAAGGAAGCGGCGACCTACGGCAAGGGTCGGGCTGCGTTGCGTGAGTACGAGCTGGACCAACGTAATCTGACGGGAGCCCTGGAAGCCCGCGCTCGCGCCGCCTGGGCGACCCTGGACGCGGCAGAAAAGCAGAAGAAGGCCGACGAACAGGCAAAGAAAGACGCCACAACCCTGAAGCAACTCAACCTGGACTACCTTCGGGCCACCGGCCAAACCGTCGAAGCGGCCGGCGCCGAGATCGAGAAGAAGTACGGCGACCTGCAGAAGCGTCTGCTCGCCACGGGTGACACCGAAGGCGCCGGCCTGGTCAGCAAGCTGATGGGAATCGAGAAGGCCAAGGCTGAGCTGCAGCAGCTCCAGGACCAGGTCGACCGGATATTCGGCGAGCAGTCGAGGCAAGAGTCGAGTATCCAGGCCGCCCAGCAGGCCGGTCTCGTCAGCGAACTGGCCGCGCGGCAGCAACTGCTAGACCTGCATCGGTCCACCGCCGACGAGGTAGAGCAACTTGTGCCTCGCATGGA Lysinibacillus fusiformis Pseudomonas aeruginosa PA was deposited at the China General Microbiological Culture Collection Center on November 6, 2025, with accession number CGMCC NO.36523; Bacillus fusiformis LF was deposited at the China General Microbiological Culture Collection Center on October 24, 2024, with accession number CGMCC No: 32336; Example 2: Preparation and compatibility verification of sesame biochar loaded with bacterial agent 1) Preparation of supported microbial agents The *Pseudomonas aeruginosa* PA strain and *Lysinibacillus fusiformis* LF strain, identified and purified in Example 1, were cultured separately in LB medium at 37°C and 180 rpm until the OD value was reached. 600 =1.0. The two bacterial suspensions were mixed at a mass ratio of 1:1 to obtain a composite bacterial solution. The pretreated sesame biochar (particle size 0.5-1.0 mm, specific surface area ≥400 m²) was then added. 2 The sesame biochar-loaded composite bacterial agent was mixed with the sterilized bacterial solution (at 121℃ for 30 min) at a mass ratio of 1:1 (g / mL) and shaken at 30℃ and 80 rpm for 4 h to allow the bacteria to be fully loaded into the porous structure of the biochar. Then, it was dried at 40℃ until the moisture content was below 15%, thus obtaining the sesame biochar-loaded composite bacterial agent.

[0043] 2) Compatibility verification of the loaded microbial agent To assess the biocompatibility of the two immobilized strains, a plate confrontation culture method was used for verification. An appropriate amount of the above-mentioned loaded bacterial agent was taken and vortexed with sterile physiological saline, and the eluent was collected as the inoculum. The eluent was serially diluted 10-fold, and a suitable dilution was selected and inoculated on opposite sides of the same LB agar plate, 4.0 cm apart. An unloaded pure bacterial mixture was used as a positive control. Three replicates were set up and incubated at 10℃, 25℃, and 37℃ for 48 h, respectively, to observe colony growth and morphology at the interface.

[0044] Results: Under all temperature conditions, strains PA and LF eluted from sesame biochar grew well and formed normal colonies. The boundary between the two colonies was clear and smooth, without any inhibition zone or growth inhibition area, consistent with the positive control group. The results indicate that after loading with sesame biochar, *Pseudomonas aeruginosa* PA and *Bacillus fusiformis* LF maintained good compatibility without antagonism. This loading process did not affect the activity or compatibility of the strains.

[0045] Example 3: Lignin degradation test under low temperature conditions (10℃) 1) Culture medium and inoculation: In a liquid system, an inorganic salt liquid culture medium with alkaline lignin as the sole carbon source (composition (g / L): alkaline lignin 1.0, (NH4)2SO4 1.0, KH2PO4 1.5, Na2HPO4·12H2O 2.5, MgSO4·7H2O 0.2, NaCl 0.1, CaCl2 0.01, and trace element solution 1 mL) was set up. Four treatment groups were set up: (1) Single bacterial PA group: after inoculation, centrifugation and washing, the culture was resuspended to OD. 600 =1.0 Pseudomonas aeruginosa PA bacterial suspension; (2) Single bacterial LF group: inoculated with the same method prepared Bacillus fusiformis LF bacterial suspension; (3) Compound bacterial RE group: the above PA and LF bacterial suspensions were mixed at a mass ratio of 1:1 and then inoculated; (4) Sesquid biochar loaded compound bacterial group (REC): inoculated with the loaded bacterial agent prepared in Example 2. The treatment groups were inoculated into Erlenmeyer flasks containing 50 mL of culture medium at a 5% inoculation amount, and each group was set with 3 replicates. Subsequently, all Erlenmeyer flasks were placed in a constant temperature shaking incubator at 10℃ and 120 rpm for liquid shaking culture.

[0046] 2) Degradation rate determination in water: Samples were taken on day 0 and day 21 of culture, and the supernatant was collected by centrifugation. The changes in lignin content in the aqueous culture medium were determined by ultraviolet spectrophotometry, and the lignin degradation rate was calculated. The results are shown below. Figure 2 .

[0047] Results: After 21 days of cultivation, the lignin degradation rate of the sesame biochar-supported composite microbial group (REC) was the highest, reaching 86.86%, significantly higher than that of the two single-strain groups (PA group: 38.77%; LF group: 57.68%) and the composite microbial group (RE group: 73.89%). The results indicate that the sesame biochar-supported composite microbial group exhibited a significant synergistic lignin degradation effect in a 10℃ low-temperature water environment.

[0048] Example 4: Lignin degradation test under normal temperature conditions (20℃) The experimental method was exactly the same as in Example 4, except that the culture temperature was adjusted to 20°C. The results are shown in […]. Figure 3 .

[0049] Results: After 21 days of cultivation, the lignin degradation rate of the sesquiterpene biochar-supported composite microbial group (REC) reached 94.63%, which was significantly higher than that of the two single-strain groups (PA group: 40.51%; LF group: 45.61%) and the composite microbial group (RE group: 77.33%). This demonstrates that the biochar-supported composite microbial group can maintain a high level of synergistic degradation ability even under normal temperature conditions in the aquatic environment.

[0050] Example 5: Determination of cellulase activity in strains under low temperature conditions (10℃) This embodiment aims to quantitatively determine the activity of cellulase secreted by Pseudomonas aeruginosa PA and Bacillus fusiformis LF under low temperature conditions (10℃) through an aqueous experimental system, and to evaluate their low temperature catalytic efficiency.

[0051] 1) Strains and culture: The activated PA and LF single colonies, the RE complex group, and the sesquiterpenoid biochar-supported complex group prepared in step 1 of Example 2 were respectively inoculated into a liquid inorganic salt medium (composition (g / L): CMC-Na 10.0, (NH4)2SO4 1.4, KH2PO4 2.0, Na2HPO4 2.0, MgSO4·7H2O 0.3, CaCl2·2H2O 0.3, and trace element solution 1.0 mL) with sodium carboxymethyl cellulose (CMC-Na, 1%) as the sole carbon source, and cultured at 10℃ and 120 rpm for 7 days with constant temperature shaking. After the culture was completed, the fermentation broth was centrifuged at 4℃ and 10000 rpm for 10 min, and the supernatant was collected as crude enzyme solution, which was stored at 4℃ for later use.

[0052] 2) Enzyme activity assay: All enzyme activation reactions were carried out at 10°C, with three replicates.

[0053] Endoglucanase (EG) activity: The reaction system contained 0.5 mL of 1% (w / v) CMC-Na (dissolved in 0.05 M pH 5.0 sodium acetate buffer) and 0.5 mL of appropriately diluted crude enzyme solution. After reacting at 10 °C for 30 min, 1.0 mL of DNS reagent was immediately added to terminate the reaction. The mixture was then boiled in a water bath for 5 min, cooled, and the absorbance was measured at 540 nm. One enzyme activity unit (U) is defined as the amount of enzyme required to produce 1 µmol of glucose per minute.

[0054] The enzyme activity of *Pseudomonas aeruginosa* PA was 1.2 U / mL, the enzyme activity of *Bacillus fusiforme* LF was 1.4 U / mL, and the cellulase activity of the sesquiterpenoid biochar-supported composite group (REC) reached 2.4 U / mL. (See results below.) Figure 4 .

[0055] The results showed that both *Pseudomonas aeruginosa* (PA) and *Bacillus fusiforme* (LF) could secrete a complete and active cellulase system at a low temperature of 10℃. Among them, the sesquiterpene biochar-supported composite microbial group exhibited higher endonuclease activity, providing direct enzymatic evidence for the synergistic and efficient degradation of cellulose by the combined bacteria in a low-temperature composting environment.

[0056] Example 6: Assay of Cellulose-Degrading Enzyme Activity of Strains under Normal Temperature (20℃) The method is exactly the same as in Example 6, and is also carried out in an aquatic culture system, except that the culture temperature is adjusted to 20°C and the culture time is shortened to 14 days.

[0057] Results: After 14 days of culture, the cellulase activity of the sesame biochar-supported composite bacterial group (REC) reached 2.1 U / mL, significantly higher than that of the two single bacterial groups, further demonstrating that the two strains have a stronger synergistic effect and higher degradation efficiency at room temperature. (See attached results). Figure 5 .

[0058] Example 7: Experiment on the effect of degrading microbial agents on compost quality 1) Using a mixture of cow dung and straw (dry weight ratio 6:4) as composting material, set up the following two groups. Blank processing group (CK): Do not add; Sesquid biochar-supported compound microbial group (REC): Sesquid biochar-supported compound microbial agent was prepared in step 1 of Example 2 by adding 2% (w / w).

[0059] Each group had three independent replicates, and a 50-day composting experiment was conducted using a 200 L composting reactor. Results are shown below. Figure 6 .

[0060] 2) Sample collection: Samples were taken at different times during the composting process. After being air-dried, ground, and sieved (2 mm), the samples were used to extract the compost aqueous extract.

[0061] 3) Preparation of compost water extract: Weigh 10.0 g of dry sample at each time point of the composting process, add sterile deionized water at a mass-to-volume ratio of 1:10 (g / mL), extract at 25℃ and 180 rpm for 1 h, let stand at 4℃ for 30 min, take the supernatant and filter it through a 0.45 μm filter membrane. The filtrate is the compost water extract, which is stored at 4℃ for analysis.

[0062] 4) Seed germination rate determination The fermented and matured control group (uninoculated) and the experimental group (inoculated with sesquiterpene biochar loaded with compound bacterial agent REC) were mixed with deionized water at a certain mass-volume ratio (1:10, w / v), and extracted by shaking on a constant temperature shaker for 2 hours. After centrifugation at 4000 rpm for 15 minutes, the supernatant was collected as the extract for seed germination test.

[0063] Select plump, uniform cucumber seeds and place them in sterile petri dishes lined with filter paper. Add an equal volume of the above-mentioned extract to each dish (using deionized water as a negative control), and replenish the solution periodically to maintain humidity. Each treatment should be performed in at least three replicates. Place the petri dishes in a 25°C incubator for cultivation. After 7 days, determine the seed germination rate and measure the radicle length.

[0064] Radicle length (RL, cm): The length of 5 healthy radicles was randomly measured in each dish and the average value was taken.

[0065] Seed germination rate (GP, %) = (Number of germinated seeds / Total number of seeds) × 100 Germination index (GI, %) = (germination rate of treatment group × average radicle length of treatment group) / (germination rate of control group × average radicle length of control group) × 100 Conclusion: The germination rate and radicle growth of the final product were significantly better than those of the control group. This indicates that the microbial agent can rapidly eliminate plant toxicity by promoting the degradation of harmful organic matter (such as phenols and organic acids), thus producing high-quality and safe organic fertilizer.

[0066] Example 8: Evaluation of the impact of degrading microbial agents on basic physicochemical indicators of the composting process 1) Using a mixture of pig manure and rice husks (dry weight ratio 8:2) as composting material, the following two treatment groups were set up: Treatment group (T): Added 2% (w / w) of the sesame biochar-supported compound microbial agent prepared in step 1 of Example 2; Control group (CK): Added an equal amount of sterilized guarana biochar.

[0067] Each group consisted of three independent replicates, and a 50-day composting experiment was conducted using a 150 L compost bin. The compost was turned over once a week.

[0068] 2) Sample collection and analysis: Samples were taken at days 0, 3, 12, 23, and 43 of the composting process. After being reduced to quarters, a portion of the fresh sample was used to determine pH and EC, while the other portion was air-dried, ground, and sieved (1 mm) for determining OM and nitrogen levels.

[0069] 3) Results Analysis: Dynamic changes in pH value: In the initial stage of composting, the pH of both groups decreased due to the mineralization of organic nitrogen into ammonia. The treatment group reached its lowest pH of 8.35 on day 43. The control group had a higher peak (8.4). The faster pH decrease in the treatment group indicates stronger nitrification, which is beneficial for nitrogen preservation and decomposition. See results below. Figure 7 .

[0070] Changes in electrical conductivity (EC): EC values ​​reflect salt concentration. Both groups showed an initial increase followed by a slow decrease in EC values. The treatment group peaked at 2.53 mS / cm on day 12, but eventually decreased to 2.21 mS / cm. The control group peaked at 2.5 mS / cm and ultimately reached 2.37 mS / cm. This indicates that the addition of microbial agents promoted the reduction of salt ion concentrations (such as K+). + Na + The fixation or transformation of [a substance] reduces the risk of salt damage in the final product. Results are shown in [the table / document / etc.]. Figure 7 .

[0071] Organic matter (OM) degradation: The organic matter content showed a trend of first decreasing and then increasing. It reached its lowest value on day 43, at 36% in the CK group and 31% in the REC group. This indicates that the addition of microbial agents and biochar significantly reduced the decomposition and transformation of organic matter (especially recalcitrant cellulose and lignin). Results are shown below. Figure 8 .

[0072] Dynamic changes in nitrogen: TN: The loss rate in the treatment group (REC) should be lower than that in the control group (CK), indicating that the microbial agent helps to retain nitrogen.

[0073] NH4 + -N: Initially increases and then decreases, and the rate and magnitude of decrease in the treatment group (REC) should be greater than that in the control group (CK), indicating that the microbial agent promotes nitrification.

[0074] NO3 - -N: This accumulates continuously throughout the process, and the final content in the treatment group (REC) should be significantly higher than that in the control group (CK). This is a key indicator of compost maturity.

[0075] TON / TKN: As organic matter degrades, its content gradually decreases and is converted into inorganic nitrogen. See results below. Figure 9 in conclusion The results of this embodiment show that adding the guar biochar-supported composite microbial agent of the present invention can significantly optimize the physicochemical environment of the composting process.

[0076] in conclusion: The above examples demonstrate that there is no antagonistic effect between *Pseudomonas aeruginosa* (PA) and *Bacillus fusiforme* (LF), and both bacteria can efficiently degrade lignin and cellulose at different temperatures (10℃ and 20℃), exhibiting a significant synergistic effect. This provides a solid theoretical and experimental basis for the subsequent combination of the two bacteria and their loading onto sesame biochar to prepare a highly efficient composting agent suitable for a wide temperature range.

Claims

1. A lignin- and cellulose-degrading strain, characterized in that: The strain is Pseudomonas aeruginosa PA, which was deposited at the China General Microbiological Culture Collection Center on November 6, 2025, with accession number CGMCC NO.36523.

2. A lignin and cellulose degrading microbial agent, characterized in that: The bacterial agent contains the strain described in claim 1.

3. The lignin and cellulose degrading microbial agent according to claim 2, characterized in that: The bacterial agent is a mixture of the bacterial agent described in claim 1 and Bacillus fusiformis LF, wherein PA and LF are mixed in a mass ratio of 1:1; The *Bacillus fusiformis* LF was deposited on October 24, 2024, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No: 32336.

4. The lignin and cellulose degrading microbial agent according to claim 2 or 3, characterized in that: The bacterial agent is a culture medium or suspension containing the bacterial strain.

5. The lignin and cellulose degrading microbial agent according to claim 3 or 4, characterized in that: The bacterial culture medium is prepared by culturing Pseudomonas aeruginosa PA and Bacillus fusiformis LF at 10-20°C in LB liquid medium until the logarithmic growth phase, and then mixing the culture media in a certain proportion. The culture medium is centrifuged to collect the precipitate, and the precipitate is resuspended in sterile physiological saline to a bacterial suspension with an OD600 of 0.7-1.

4.

6. The lignin and cellulose degrading microbial agent according to any one of claims 2-5, characterized in that: The microbial agent consists of a bacterial strain and an adsorption carrier, wherein the bacterial strain and the carrier are mixed at a mass ratio of 1:1, and the adsorption carrier is sesquiterpene biochar.

7. The application of the strain according to claim 1 or the microbial agent according to claim 2, characterized in that: The application of the strain of claim 1 or the microbial agent of claim 2 in the degradation of lignin and / or cellulose.

8. The application according to claim 7, characterized in that: Application of the strain of claim 1 or the agent of claim 2 in the degradation of lignin and / or cellulose at low temperature (5–15°C) and normal temperature (20–35°C).

9. A composting agent, characterized in that: Contains the strain of claim 1 or the agent of claim 2.

10. The composting agent according to claim 9, characterized in that: The strain described in claim 1 or the microbial agent described in claim 2 is added to the raw material to be treated for composting.