Recombinant corynebacterium glutamicum for producing L-ornithine as well as construction method and application of recombinant corynebacterium glutamicum

Abstract

The invention relates to the technical field of construction of recombinant bacteria, in particular to recombinant corynebacterium glutamicum for producing L-ornithine as well as a construction method and application of the recombinant corynebacterium glutamicum for producing L-ornithine, corynebacterium glutamicum SO30 is taken as an original strain, a SigD gene and a FruR gene are sequentially knocked out through a suicide plasmid pK18mobsacB mediated homologous recombination technology, and double knockout recombinant corynebacterium glutamicum SO30-SigD-FruR is constructed. The L-ornithine yield of the strain subjected to shake-flask fermentation reaches 51.88 g / L and is increased by 56.7% compared with that of an original strain SO30; the fermentation yield of a 5L bioreactor reaches 123 g / L and is increased by 57.6% compared with that of an original strain SO30, and the cell biomass and the sugar conversion rate are remarkably increased. Through global transcriptional regulation factor transformation, the existing yield bottleneck is broken through, and efficient strains and technical support are provided for industrial fermentation production of L-ornithine.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of construction of recombinant bacteria, and particularly relates to a recombinant corynebacterium glutamicum for producing L-ornithine, a construction method and application thereof. BACKGROUND

[0002] L-ornithine is a non-protein amino acid, an intermediate metabolite of urea cycle, participates in the synthesis of urea metabolism and biological polyamines, and plays a key role in the process of ammonia excretion in vivo. It does not directly participate in protein coding, but exists in various antibacterial peptides, has the functions of protecting liver and enhancing immunity. In the food industry, it is used as an additive in dairy products, meat products, etc.; in the pharmaceutical field, it is a key raw material for preparing liver-protecting drugs; and in the chemical and feed industries, it also has applications.

[0003] In industry, ornithine is mainly produced by chemical synthesis, enzyme catalysis and microbial fermentation. However, the enzyme catalysis method has problems such as high cost, difficulty in industrialization, complicated steps, low yield, serious pollution, high price of raw material arginine, and feedback inhibition of product ornithine on enzyme activity. The microbial fermentation method gradually becomes the focus of research due to the advantages of low cost and no pollution to the environment. Corynebacterium glutamicum is a gram-positive bacterium, which is widely used for fermentation production of various valuable metabolites, and is also the mainstream strain for producing ornithine. However, the efficiency of producing ornithine by using corynebacterium glutamicum is still low, which is difficult to meet the needs of industrialization. Therefore, it is a very urgent problem to take appropriate methods to breed high-yield ornithine engineering strains.

[0004] In recent years, with the rapid development of metabolic engineering technology, the research on L-ornithine production by C. glutamicum has made a series of important progress. For example, Nie et al. published in the journal Bioresources and Bioprocessing in 2022 (DOI: 10.1186 / s40643-022-00503-9) first discovered that the co-utilization of glucose and sucrose had a significant synergistic promotion effect on L-ornithine production by C. glutamicum. The research team used C. glutamicum S9114 (China Industrial Microbial Culture Collection Center, CICC 20935, an industrial strain for glutamic acid production) as the original strain, and through systematic metabolic engineering, constructed the basic engineering strain SO26. The L-ornithine yield of this strain under single glucose carbon source was 35.88 g / L. To further improve the yield, the researchers regulated the fructose metabolic pathway by knocking out the pfkB1 gene encoding fructose-1-phosphate kinase, and constructed the engineering strain SO30. In the shake flask fermentation, with glucose and sucrose (1:1 mass ratio) as mixed carbon source, the L-ornithine yield of this strain reached 47.64 g / L, which was 32.8% higher than that of the original strain SO26; in the 5L fed-batch fermentation, the yield was further improved to 78.0 g / L. Nie et al.'s research confirmed the effectiveness of regulating the fructose metabolic pathway to improve L-ornithine yield, and the core mechanism lies in that: after intracellular transport and phosphorylation, sucrose is decomposed into glucose phosphate and fructose by sucrose-6-phosphate hydrolase. Fructose-1-phosphate produced during fructose metabolism can up-regulate the expression of glycolysis pathway-related genes, accelerate carbon source utilization, and at the same time increase the supply of intracellular NADPH, providing sufficient reducing power for L-ornithine synthesis. In addition, the study also found that knocking out the pfkB2 gene (encoding another fructose-1-phosphate kinase) alone can increase the L-ornithine yield by 8.3%, but double-knocking out the pfkB1 and pfkB2 genes will completely block the fructose utilization pathway, and the yield will decrease by 19.8%, indicating that the regulation of the fructose metabolic pathway needs to be balanced precisely and cannot blindly knock out related genes.

[0005] Although the SO30 strain only optimized the fructose metabolic pathway by knocking out the pfkB1 gene, it did not involve the modification of the global transcriptional regulation level, resulting in insufficient systematization of the metabolic network regulation. Single-dimensional metabolic modification cannot break through the yield limit and cannot fully tap the production potential of C. glutamicum, so the yield of the SO30 strain in the 5L fermenter is only 78.0 g / L, which still lags behind the high yield required for industrial production.

[0006] Therefore, the prior art still needs to be improved and developed. SUMMARY

[0007] In view of the above deficiencies of the prior art, the purpose of the present application is to provide a recombinant coryneform bacterium for producing L-ornithine, a construction method and application thereof, aiming to improve the L-ornithine yield of the recombinant coryneform bacterium.

[0008] In order to achieve the above-mentioned purpose, the present application adopts the following technical solutions: A construction method of a recombinant coryneform bacterium for producing L-ornithine, comprising the following steps: On the basis of coryneform bacterium SO30, the SigD gene is knocked out to obtain a first recombinant coryneform bacterium, which is recorded as SO30-SigD; On the basis of the first recombinant coryneform bacterium, the FruR gene is further knocked out to obtain a second recombinant coryneform bacterium, which is recorded as SO30-SigD-FruR.

[0009] The construction method of the recombinant coryneform bacterium for producing L-ornithine, wherein the SigD gene and the FruR gene are obtained by knocking out the coryneform bacterium suicide plasmid pK18mobsacB.

[0010] A recombinant coryneform bacterium for producing L-ornithine, which is constructed by the construction method of the recombinant coryneform bacterium for producing L-ornithine.

[0011] The application of the recombinant coryneform bacterium for producing L-ornithine, wherein the recombinant coryneform bacterium for producing L-ornithine is used for fermenting to produce L-ornithine.

[0012] The application, comprising the following steps: The second recombinant coryneform bacterium is activated and cultured on an LB plate without antibiotics; The bacteria on the LB plate are inoculated into a conical flask containing LBG medium, and cultured at a temperature of 32℃ and a shaking speed of 250 rpm for 12 h to obtain LBG liquid; The obtained LGB liquid is inoculated into seed medium at an inoculation amount of 20%, and cultured at a temperature of 32℃ and a shaking speed of 250 rpm for 8 h to obtain seed culture liquid, wherein the seed medium comprises corn syrup 10 ml / L, yeast powder 10 g / L, (NH4)2SO4 15 g / L, MgSO4 2.5 g / L, KH2PO4 1 g / L, K2HPO4 0.5 g / L, Na2HPO4 0.5 g / L, and 30 g / L glucose; The seed culture solution is inoculated into a 5L bioreactor containing fermentation medium at an inoculation amount of 15%, and the volume is controlled at 2L after inoculation, the ventilation amount is 2l / min, the rotating speed is controlled at 500rpm before 12h, and the rotating speed is controlled and maintained at 650rpm after 12h, residual sugar is detected by sampling every 12h, the residual sugar concentration is controlled below 10g / L, and the fermentation is stopped until the culture time reaches 72h, and the fermentation medium components include: yeast powder 8g / L, (NH4)2SO4 50g / L, MgSO4 2.5g / L, KH2PO4 1g / L, K2HPO4 0.5g / L, Na2HPO4 0.5g / L, FeSO4 0.02g / L, MnSO4 0.02g / L, and 100g / L glucose.

[0013] Beneficial effects: the present application adopts a double-gene progressive knockout strategy, takes the SO30 strain with optimized fructose metabolism as the basis, sequentially knocks out the SigD and FruR genes by means of the mature pK18mobsacB suicide plasmid homologous recombination system, the construction process does not require complex equipment, the genetic stability of the recombinant strain is high, and the strain can be prepared on a large scale; the yield of the double-knockout strain in a flask is increased by 56.7% compared with that of the original strain, the yield in a 5L fermenter reaches 123g / L, and the yield upper limit of single metabolic pathway modification is broken through. BRIEF DESCRIPTION OF DRAWINGS

[0014] Figure 1 It is an electrophoresis map for PCR verification of SigD gene knockout.

[0015] Figure 2 It is an electrophoresis map for PCR verification of co-knockout of SigD and FruR genes.

[0016] Figure 3 It is an electrophoresis map for PCR verification of FruR gene knockout.

[0017] Figure 4 It is an L-ornithine yield graph of shake flask fermentation of recombinant corynebacterium glutamicum prepared in examples 1-3.

[0018] Figure 5 It is an L-ornithine yield graph of 5L fermenter fermentation of the second recombinant corynebacterium glutamicum SO30-SigD-FruR. DETAILED DESCRIPTION

[0019] The present application provides a recombinant corynebacterium glutamicum for producing L-ornithine, a construction method and application thereof, in order to make the purpose, technical scheme and effect of the present application more clear and explicit, the present application is further described in detail below with reference to the drawings and examples. It should be understood that the specific examples described herein are only used to explain the present application, and are not used to limit the present application.

[0020] In the description of the present application, it should be understood that the terms "first", "second" are only for the purpose of description, and cannot be understood as indicating or implying relative importance or implicitly indicating the number of indicated technical features. Therefore, the features defined with "first", "second" can be explicitly or implicitly included one or more of the features. In the description of the present application, unless otherwise specified, the meaning of "a plurality of" is two or more.

[0021] In the existing research, the strain of corynebacterium glutamicum SO30 only optimizes the fructose metabolic pathway by knocking out the pfkB1 gene, without involving the modification of the global transcriptional regulation level, resulting in insufficient systemization of the metabolic network regulation, and the single-dimensional metabolic modification is difficult to break through the upper limit of the yield, and the production potential of corynebacterium glutamicum cannot be fully tapped. The global transcriptional regulator is a kind of protein that can simultaneously regulate the expression of multiple functionally related or unrelated genes, and activates or inhibits the transcription initiation of the genes by binding to specific DNA sequences, so as to realize the systematic regulation of the cell metabolic network, stress response, growth and development and other processes. In microbial metabolic engineering, targeted modification of global transcriptional regulators has become an effective strategy to improve the yield of target products, and its advantage lies in that multiple metabolic pathways can be simultaneously optimized, avoiding the metabolic flow imbalance caused by single gene modification.

[0022] Based on this, the present application provides a construction method of recombinant corynebacterium glutamicum for producing L-ornithine, which comprises the following steps: S10, knocking out the SigD gene based on corynebacterium glutamicum SO30 to obtain a first recombinant corynebacterium glutamicum, which is recorded as SO30-SigD; S20, continuing to knock out the FruR gene based on the first recombinant corynebacterium glutamicum to obtain a second recombinant corynebacterium glutamicum, which is recorded as SO30-SigD-FruR.

[0023] The present application successfully constructs the single knockout strain SO30-ΔSigD and the double knockout strain SO30-ΔSigD-ΔFruR by homologous recombination technology. The results of the present application show that the knockout of SigD and FruR genes has a significant effect on the improvement of L-ornithine yield, and the improvement effect of the double knockout strain is better than that of the single knockout strain, which indicates that there is a synergistic regulation effect between them. At the same time, the cell biomass and sugar conversion rate of the recombinant strain are significantly improved, which proves that the gene knockout optimizes the metabolic flow distribution of the cell and improves the carbon source utilization efficiency.

[0024] Specifically, SigD, as a sigma factor of C. glutamicum, mainly participates in the regulation of cell adaptation to environmental stress and the dynamic balance of metabolic network. In the process of L-ornithine synthesis, the knockout of SigD gene plays a role through the following mechanisms: SigD can bind to RNA polymerase, recognize the promoter region of specific genes, and regulate the transcription initiation of genes. Studies have shown that SigD has a transcriptional inhibitory effect on the key genes (argB, argC, argD, argJ) of the L-ornithine synthesis pathway, which encode acetylglutamate synthetase, acetylglutamate kinase, acetylglutamate semialdehyde dehydrogenase, and acetylornithine transaminase, respectively, and are the core enzymes of L-ornithine synthesis. After the knockout of SigD gene, the inhibitory effect of SigD on these genes is removed, which significantly increases the expression amount of enzymes, thereby accelerating the conversion of precursor glutamate to L-ornithine; the deletion of SigD also affects the energy metabolism and carbon source distribution of cells, reduces the generation of by-products, and in the SO30 strain, part of the carbon source will generate by-products such as lactic acid and acetic acid through the glycolytic pathway, resulting in carbon source waste. After the knockout of SigD gene, the activity of the glycolytic pathway of the cell is slightly reduced, while the activity of the pentose phosphate pathway is increased, which can generate more NADPH to provide sufficient reducing power for L-ornithine synthesis, while reducing the generation of by-products and improving the carbon source conversion rate to L-ornithine; during fermentation, with the accumulation of L-ornithine and the consumption of carbon source, the environmental parameters such as pH and osmotic pressure of the fermentation broth will change, which may lead to cell stress response and affect product synthesis. As a stress regulatory factor, the deletion of SigD can reconfigure the cell stress response mechanism, enhance the cell's tolerance to pH fluctuation and high osmotic pressure, and thus maintain the stability of L-ornithine synthesis during fermentation.

[0025] FruR is a key global regulator of carbon metabolism in C. glutamicum, which mainly regulates the expression of genes related to fructose transport and metabolism by binding to the promoter region of target genes, and also indirectly regulates glucose metabolism. The knockout of FruR gene improves the production of L-ornithine through the following mechanisms: FruR has an inhibitory effect on the expression of fructose transporter (PtsF) and fructose metabolic enzymes (if sugar kinase, fructose-1-phosphate kinase), after the knockout of FruR gene, the expression of PtsF is improved, which enhances the absorption efficiency of fructose produced by the hydrolysis of sucrose; at the same time, the activity of fructose metabolic enzymes is improved, which accelerates the conversion of fructose to fructose-1-phosphate, combined with the characteristics of SO30 strain which has knocked out pfkB1 gene, fructose-1-phosphate accumulates moderately in the cell, further activating the expression of glycolysis pathway related genes, realizing the synergistic and efficient utilization of glucose and fructose; FruR not only regulates fructose metabolism, but also indirectly affects the absorption and metabolism of glucose, it is found that FruR can bind to the promoter region of glucose transporter (PtsG) and inhibit its expression, after the knockout of FruR gene, the expression of PtsG is improved, which enhances the absorption rate of glucose by cells; at the same time, the inhibition of FruR on key enzymes of glycolytic pathway (such as phosphofructokinase, pyruvate kinase) is removed, and the enzyme activity is improved, which accelerates the conversion of glucose to pyruvate, providing more precursor substances (acetyl coenzyme A, glutamic acid) for L-ornithine synthesis; L-ornithine synthesis needs sufficient ammonia nitrogen as a nitrogen source for the amination reaction of glutamic acid, the knockout of FruR gene can activate the expression of glutamine synthetase (GlnA) and glutamate dehydrogenase (GdhA), which are involved in the assimilation of ammonia and the synthesis of glutamic acid. Experiments have proved that after the knockout of FruR gene, the activities of GlnA and GdhA can be improved, which enhances the utilization efficiency of ammonia nitrogen by cells and improves the synthesis amount of glutamic acid, providing sufficient precursors for L-ornithine synthesis.

[0026] This invention involves the double knockout of the SigD and FruR genes in Corynebacterium glutamicum SO30. The results showed that the increase in L-ornithine production was not a simple additive effect, but rather achieved through synergistic regulation. Knockout of FruR optimized the metabolic efficiency of glucose and fructose, providing sufficient carbon skeleton and energy for L-ornithine synthesis. Knockout of SigD relieved the inhibition of the L-ornithine synthesis pathway, activated the expression of the core enzyme, and enabled the efficient conversion of the carbon skeleton into L-ornithine. The synergistic effect of these two genes achieved a highly efficient connection between carbon source supply and product synthesis, avoiding the metabolic imbalance caused by single gene knockout. For example, FruR knockout enhances carbon source metabolism, but without SigD knockout, the enzyme activity in the synthesis pathway is insufficient, and carbon sources may flow to byproducts. Conversely, SigD knockout activates the synthesis pathway, but without FruR knockout, the carbon source supply is insufficient, failing to fully realize the potential of the synthesis pathway. With double knockout, the carbon source supply and the needs of the synthesis pathway are precisely matched, resulting in a significant increase in yield.

[0027] The present invention will be further explained and illustrated below through specific embodiments: Example 1: First recombinant Corynebacterium glutamicum SO30-SigD The specific preparation steps of the first recombinant Corynebacterium glutamicum SO30-SigD are as follows: Construction of the recombinant knockout plasmid pK18mobsacB-ΔSigD: Using the genomic DNA of Corynebacterium glutamicum SO30 as a template, specific primers were used. SigD-up-F: aacgacggccagtgccaagcttTCAGCGAGGTTAAGCATGGTC; SigD-up-R: GCGTGGAATCAATGTGATGATCATGGGGTTACC; SigD-down-F: CATGATCATCACATTGATTCCACGCTGTCGCTCG; SigD-down-R: cggtacccggggatcctctaCTGCATAACCGTGGTGTCCGA, the upstream homology arm (about 1023 bp in length) and the downstream homology arm (about 987 bp in length) of the SigD gene were amplified by PCR; the upstream homology arm and the downstream homology arm were spliced into a complete SigD knockout fragment (ΔSigD, about 2010 bp in length) by overlap extension PCR, and the splicing product was recovered and purified; the suicide plasmid pK18mobsacB and the ΔSigD fragment were double-digested with restriction endonucleases Hind III and Xba I, the digested products were recovered by gel electrophoresis, and then ligated by T4 DNA ligase at 16°C overnight to construct the recombinant plasmid pK18mobsacB-ΔSigD; the ligation product was transformed into E. coli DH5α competent cells, which were spread on LB plates containing 50 mg / L spectinomycin and cultured at 37°C for 12-16 h; single colonies were picked for PCR verification and sequencing verification to confirm that the recombinant plasmid pK18mobsacB-ΔSigD was correctly constructed.

[0028] Preparation of Corynebacterium glutamicum SO30 competent cells: The SO30 strain was activated on an LB plate without antibiotics at 32°C for 24 h, a single colony was picked and inoculated into 10 mL of LB liquid medium, and cultured at 32°C and 250 rpm for 12 h to obtain a seed solution; the seed solution was inoculated into 100 mL of LB liquid medium at a 2% inoculation amount, and cultured at 32°C and 250 rpm until the OD 600 = 0.6-0.8, and then cooled in an ice bath for 30 min; the cells were collected by centrifugation at 4°C and 6000 rpm for 10 min, washed with pre-cooled 10% glycerol three times, and finally resuspended in 100 μL of pre-cooled 10% glycerol to prepare Corynebacterium glutamicum SO30 competent cells, which were stored at -80°C for later use.

[0029] Electroporation and first homologous recombination screening: 10 μg of the recombinant plasmid pK18mobsacB-ΔSigD was mixed with 100 μL of SO30 competent cells, and then added to a 0.2 cm electroporation cup; the electroporation instrument was set at 2.5 kV, 25 μF, and 200 Ω for electroporation; 500 μL of LB liquid medium without antibiotics was immediately added after electroporation, and the cells were relaxed cultured at 32°C and 150 rpm for 4 h; then 200 μL of the bacterial solution was spread on an LB plate containing 12.5 mg / L spectinomycin, and cultured at 32°C for 48 h. Single colonies on the plate were picked and subjected to PCR verification using SigD-up-F and SigD-down-R primers, and colonies that amplified a fragment of about 2010 bp were first homologous recombination positive strains (single crossover strains).

[0030] Second homologous recombination and double crossover strain screening: The first homologous recombination positive strain was inoculated into antibiotic-free LB liquid medium and cultured at 32°C and 250 rpm for 24 h to perform the second homologous recombination. The cultured bacterial solution was serially diluted and plated on LB agar containing 10% sucrose and cultured at 32°C for 48 h (the pK18mobsacB plasmid contains the sacB gene, and strains that did not undergo the second homologous recombination will die on sucrose agar agar agar because they contain this gene). Single colonies from the sucrose agar agar agar agar were picked and inoculated into LB agar agar containing 12.5 mg / L spectinomycin and antibiotic-free LB agar ...

[0031] Validation of SO30-SigD strain: Using genomic DNA from the double-crossover candidate strains as templates, PCR verification was performed using SigD-check-F (ATCGTCGGGCATTGCAAAGAA) and SigD-check-R (CTGCATAACCGTGGTGTCCGA) primers, with strain SO30 serving as a control. The results are as follows: Figure 1 As shown, from Figure 1 It can be seen that the control group (CK) amplified the SigD gene-specific band, while the candidate strain (1) did not have the corresponding band, thus confirming that the first recombinant Corynebacterium glutamicum SO30-SigD was successfully constructed.

[0032] Example 2: Second recombinant Corynebacterium glutamicum SO30-SigD-FruR The preparation of the second recombinant Corynebacterium glutamicum SO30-SigD-FruR includes the following steps: Construction of the recombinant knockout plasmid pK18mobsacB-ΔFruR: Using the genomic DNA of Corynebacterium glutamicum SO30 as a template, specific primers were used (FruR-up-F: aacgacggccagtgccaagcttGATTGCCTCATTAACGGCAGT; FruR-up-R: CTGCCGGATTTTGTTCCGTCAAGCTCATTGGTGCTC). FruR-down-F: ATGAGCTTGACGGAA CAAAATCCGGCAGGT TTCC; FruR-down-R: cggtacccggggatcctctaAATTCACGCCCTGCTTACCAG), the upstream and downstream homologous arms of the FruR gene were amplified by PCR; the upstream and downstream homologous arms were spliced ​​together by overlapping extension PCR to obtain the FruR knockout fragment (ΔFruR), which was then double-digested (HindⅢ / XbaⅠ) and ligated to the pK18mobsacB plasmid digested with the same enzymes to construct the recombinant plasmid pK18mobsacB-ΔFruR.

[0033] After transformation into Escherichia coli DH5α, the recombinant plasmid was confirmed to be correctly constructed through spectinomycin resistance screening, PCR verification, and sequencing verification.

[0034] Preparation of SO30-SigD competent cells of the first recombinant strain: Following the method for preparing SO30 competent cells in Example 1, competent cells were prepared using SO30-ΔSigD strain as the starting strain and stored at -80℃ for later use.

[0035] Electroporation transformation and two homologous recombination screenings: 10 μg of recombinant plasmid pK18mobsacB-ΔFruR was mixed with 100 μL of SO30-ΔSigD competent cells, transformed by electroporation, and cultured under relaxation. The mixture was then plated on LB agar plates containing 12.5 mg / L spectinomycin to screen for positive strains of the first homologous recombination. Single-exchange strains were cultured without antibiotics and then plated on LB agar plates containing 10% sucrose to screen for double-exchange candidate strains (those without spectinomycin resistance and capable of growing on sucrose plates).

[0036] Validation of SO30-SigD-FruR strain: Using the genome of the double-crossover candidate strain as a template, PCR verification was performed using FruR-check-F (CGGAAAGACAGCATGCAATTG) and FruR-check-R (ATTGATGCCTTTACCACCTGC) primers, with the SO30-SigD strain as a control. The results are as follows: Figure 2 As shown, the control group amplified a specific band of the FruR gene, while the candidate strain did not have a corresponding band, indicating that the second recombinant Corynebacterium glutamicum SO30-SigD-FruR was successfully constructed.

[0037] Example 3: Third Recombinant Corynebacterium Glutamate SO30-FruR The specific preparation steps for the third recombinant Corynebacterium glutamicum SO30-FruR are as follows: The construction steps of the recombinant knockout plasmid pK18mobsacB-FruR are the same as in Example 2; The preparation of Corynebacterium glutamicum SO30 competent cells was the same as in Example 1: Electroporation transformation and two homologous recombination screenings: 10 μg of recombinant plasmid pK18mobsacB-ΔFruR was mixed with 100 μL of SO30 competent cells, transformed by electroporation, and cultured under relaxation. The mixture was then plated on LB agar plates containing 12.5 mg / L spectinomycin to screen for the first homologous recombination positive strain. The single-exchange strain was cultured without antibiotics and then plated on LB agar plates containing 10% sucrose to screen for double-exchange candidate strains (those without spectinomycin resistance and capable of growing on sucrose plates), thus obtaining the third recombinant Corynebacterium glutamicum SO30-FruR.

[0038] Validation of SO30-FruR strain: Using genomic DNA from the double-crossover candidate strains as templates, PCR verification was performed using FruR-check-F (CGGAAAGACAGCATGCAATTG) and FruR-check-R (ATTGATGCCTTTACCACCTGC) primers, with strain SO30 serving as a control. The results are as follows: Figure 3 As shown, from Figure 3 As can be seen, the control group amplified the FruR gene-specific band, while the candidate strains did not have the corresponding band, thus confirming the successful construction of the third recombinant Corynebacterium glutamicum SO30-FruR.

[0039] Example 4: Shake Flask Fermentation The control strain Corynebacterium glutamicum SO30 and the recombinant Corynebacterium glutamicum prepared in Examples 1-3 were subjected to shake-flask fermentation, which specifically included the following steps: The control strain Corynebacterium glutamicum SO30 and three recombinant Corynebacterium glutamicum were activated and cultured on antibiotic-free LB plates. The bacteria on the plates were then transferred to 100 ml Erlenmeyer flasks containing 10 ml of LBG medium and cultured for 12 h in a shaker at 32 °C and 250 rpm.

[0040] The above LBG culture medium was inoculated at a 20% inoculation rate into a 250ml Erlenmeyer flask containing 20ml of seed culture medium. The culture temperature was 32℃, the shaking speed was 250rpm, and the culture time was 8h. The seed culture medium consisted of: corn steep liquor 10ml / L, yeast powder 10g / L, (NH4)2SO4 15 g / L, MgSO4 2.5 g / L, KH2PO4 1g / L, K2HPO4 0.5 g / L, Na2HPO4 0.5g / L, and glucose 30g / L. The seed culture medium was inoculated into a 250ml Erlenmeyer flask containing 20ml of fermentation medium at a 15% inoculation rate. Fermentation was carried out at 32℃ and 250rpm for 72 hours. Samples were then taken to test the L-ornithine yield. The results are as follows: Figure 4 As shown, the fermentation medium consists of: 8 g / L yeast extract, 50 g / L (NH4)2SO4, 2.5 g / L MgSO4, 1 g / L KH2PO4, 0.5 g / L K2HPO4, 0.5 g / L Na2HPO4, 0.02 g / L FeSO4, 0.02 g / L MnSO4, and 100 g / L glucose. From... Figure 4 As can be seen, the L-ornithine production of the four strains exhibits a clear stepwise difference: the original strain SO30 produced 33.10 g / L. This data seems different from the 47.64 g / L produced by strain SO30 in shake flasks with glucose-sucrose as the carbon source mentioned in the background document. However, due to different experimental conditions, this experiment used only glucose as the single carbon source in the shake flasks, eliminating the synergistic effect of sucrose and more accurately focusing on the independent impact of gene knockout on production. Therefore, 33.10 g / L can be considered the baseline production level without sucrose and without global regulatory modification. The SO30-SigD production with SigD knockout alone increased to 40.88 g / L, a 23.5% increase compared to the original strain. This result validates the regulatory role of the SigD gene. SigD is the σ factor in Corynebacterium glutamicum, which can bind to RNA polymerase to inhibit the transcription of key genes (argB, argC, argD, argJ) in L-ornithine synthesis. These genes encode acetylglutamate synthase and acetylglutamate kinase, which are core enzymes in the conversion of glutamate to L-ornithine. After SigD knockout, the inhibitory effect is relieved, directly accelerating the conversion of precursor substances into products. At the same time, SigD deficiency also enhances the activity of the pentose phosphate pathway, further ensuring the efficiency of product synthesis and ultimately achieving increased yield.

[0041] The SO30-FruR yield with FruR knockout reached 38.51 g / L, a 16.4% increase compared to the original strain. This is attributed to FruR's function as a global regulator of carbon metabolism. FruR originally limited carbon source uptake by inhibiting the expression of fructose transporter (PtsF) and glucose transporter (PtsG); at the same time, it slowed down carbon source decomposition by inhibiting the activity of key enzymes in the glycolysis pathway (phosphofructokinase and pyruvate kinase). After FruR knockout, the expression levels of PtsF and PtsG increased, the rate of glucose uptake by cells accelerated, the activity of the glycolysis pathway was enhanced, and the production of pyruvate increased. Pyruvate is the core carbon skeleton for the synthesis of glutamate (a precursor of L-ornithine).

[0042] The yield of the double-knockout strain SO30-SigD-FruR reached 51.88 g / L, an increase of 56.7% compared to the original strain, and far higher than the total yield of the two single-knockout strains (38.51 + 40.88 - 33.10 = 46.29 g / L). This demonstrates a significant synergistic effect between the knockout of SigD and FruR. The core mechanism lies in the fact that FruR knockout solves the problems of carbon source supply and precursor synthesis (sufficient glucose breakdown products and glutamate), while SigD knockout solves the problem of precursor-to-product conversion (relieving synthase inhibition and sufficient NADPH). The two form a closed loop of supply-conversion. If only FruR is knocked out, the precursor glutamate accumulates but the synthase activity is insufficient, and some precursors are converted into byproducts such as lactic acid and acetic acid. If only SigD is knocked out, the synthase activity increases but the precursor supply is insufficient, and the product synthesis lacks raw materials. After double knockout, the precursor supply and conversion efficiency are precisely matched, and the metabolic flux flows to L-ornithine to the maximum extent, ultimately achieving a leap in yield.

[0043] Figure 4 Medium biomass (OD) 600 Data showed that the growth status of recombinant Corynebacterium glutamicum was not significantly different from that of the control group (e.g., OD). 600 (Both were around 12-14), indicating that the knockout of the SigD and FruR genes did not affect the basic growth of the strain.

[0044] Example 55: Fermentation culture in a bioreactor The second recombinant Corynebacterium glutamicum SO30-SigD-FruR was fermented in a 5L bioreactor, specifically including the following steps: The second recombinant Corynebacterium glutamicum was activated and cultured on antibiotic-free LB plates; The bacteria on the LB plate were inoculated into an Erlenmeyer flask containing LBG medium and cultured at 32°C and 250 rpm for 12 h to obtain LBG solution. The obtained LGB solution was inoculated into the seed culture medium at an inoculation rate of 20%, and cultured at 32℃ and 250 rpm for 8 hours to obtain the seed culture medium. The seed culture medium consisted of: corn steep liquor 10 ml / L, yeast powder 10 g / L, (NH4)2SO4 15 g / L, MgSO4 2.5 g / L, KH2PO4 1 g / L, K2HPO4 0.5 g / L, Na2HPO4 0.5 g / L, and glucose 30 g / L. The seed culture was inoculated into a 5L bioreactor containing fermentation medium at an inoculation rate of 15%. The inoculation volume was controlled at 2L, with an aeration rate of 2L / min. The rotation speed was controlled at 500rpm for the first 12 hours, and then maintained at 650rpm thereafter. Residual sugar was sampled every 12 hours, with the concentration controlled below 10g / L. Fermentation was stopped after 72 hours of culture. L-ornithine production was continuously measured during fermentation, and the results are as follows: Figure 5 As shown, the fermentation medium consists of: 8 g / L yeast extract, 50 g / L (NH4)2SO4, 2.5 g / L MgSO4, 1 g / L KH2PO4, 0.5 g / L K2HPO4, 0.5 g / L Na2HPO4, 0.02 g / L FeSO4, 0.02 g / L MnSO4, and 100 g / L glucose. Figure 5 Based on Figure 4 The positive results were used to conduct pilot-scale validation of the optimal strain SO30-SigD-FruR. The experiment was conducted in a 5L bioreactor (a common piece of equipment for industrial fermentation). Figure 5 It can be seen that, Figure 5 The change in L-ornithine production over time can be divided into three stages, and the characteristics of each stage are closely related to strain metabolism and process parameters: Adaptation period (0-12h): Slow yield growth, with cell proliferation as the primary activity. During this stage, yield growth is gradual, accounting for only about 3% of the total yield over 72h (approximately 4.2g / L). The core reason is that after inoculation, cells need to adapt to the bioreactor environment (such as aeration, shear forces from stirring, and changes in culture medium composition). The metabolic focus is on synthesizing cellular structural substances (such as proteins and cell walls), rather than product synthesis. Simultaneously, the rotation speed is controlled at 500rpm before 12h, resulting in relatively low dissolved oxygen (approximately 20%-30%), while L-ornithine synthesis requires higher dissolved oxygen (NADPH generation depends on aerobic metabolism). Therefore, the product synthesis rate is slow. This stage is a necessary process for industrial fermentation, and the adaptability of the strain directly affects the stability of subsequent fermentation.

[0045] Rapid accumulation period (12-48h): Yield increases linearly, with metabolic focus shifting to product synthesis. After 12h, yield enters a rapid growth phase, reaching approximately 105g / L at 48h, accounting for 85.3% of the final yield. This explosive growth is due to the combined effects of process adjustments and strain metabolic activation: From a process perspective, after 12h, the rotation speed was increased to 650rpm, and the dissolved oxygen concentration increased to 40%-50%, meeting the needs of the pentose phosphate pathway (generating NADPH) and aerobic respiration (providing energy); simultaneously, residual sugar was monitored every 12h and controlled below 10g / L, avoiding the inhibition of carbon metabolism enzymes by high glucose concentrations (i.e., the glucose effect), ensuring a continuous and stable supply of carbon source. From the perspective of strain metabolism, after 12 hours, the cells enter the stationary phase, the growth rate slows down, and the metabolic focus shifts from cell proliferation to product synthesis: the increased carbon source absorption efficiency brought about by FruR knockout (high PtsG and PtsF activities) enables glucose to be continuously broken down into pyruvate and converted into glutamate; the increased synthase activity brought about by SigD knockout (high expression levels of argB, argC, etc.) enables glutamate to be efficiently converted into L-ornithine; with the synergy of the two, the metabolic flux is maximized towards the products, ultimately achieving rapid yield growth.

[0046] The plateau phase (48-72h): Yield growth slows and stabilizes. After 48h, the yield growth rate decreases significantly, reaching a peak of 123g / L at 60h. This stage is consistent with the general characteristics of industrial fermentation: on the one hand, the nitrogen source in the culture medium is gradually depleted, reducing the supply of raw materials for glutamate synthesis and leading to insufficient precursors; on the other hand, the concentration of L-ornithine in the fermentation broth increases, potentially causing some product inhibition (although the strain has been modified to improve tolerance, high product concentrations still slightly inhibit enzyme activity); furthermore, some cells enter a death phase, resulting in decreased metabolic activity and a reduced product synthesis rate. However, it is noteworthy that the yield did not decrease significantly during this stage, indicating that the strain can maintain metabolic activity even at high product concentrations, demonstrating excellent fermentation stability.

[0047] It is understood that those skilled in the art can make equivalent substitutions or modifications to the technical solution and inventive concept of the present invention, and all such substitutions or modifications should fall within the protection scope of the appended claims.

Claims

1. A method for constructing a recombinant Corynebacterium glutamicum that produces L-ornithine, characterized in that, Includes the following steps: The SigD gene was knocked out from Corynebacterium glutamicum SO30 to obtain the first recombinant Corynebacterium glutamicum, denoted as SO30-SigD. Based on the first recombinant Corynebacterium glutamicum, the FruR gene was knocked out to obtain the second recombinant Corynebacterium glutamicum, denoted as SO30-SigD-FruR.

2. The method for constructing recombinant Corynebacterium glutamicum producing L-ornithine according to claim 1, characterized in that, Both the SigD and FruR genes were obtained by knocking out the Corynebacterium glutamicum suicide plasmid pK18mobsacB.

3. A recombinant Corynebacterium glutamicum that produces L-ornithine, characterized in that, It was constructed using the method for constructing recombinant Corynebacterium glutamicum that produces L-ornithine as described in any one of claims 1-2.

4. The application of a recombinant Corynebacterium glutamicum that produces L-ornithine, characterized in that, The recombinant Corynebacterium glutamicum described in claim 3, which produces L-ornithine, is used for fermentation to produce L-ornithine.

5. The application according to claim 4, characterized in that, Including the following steps: The second recombinant Corynebacterium glutamicum was activated and cultured on antibiotic-free LB agar plates; The bacteria on the LB plate were inoculated into an Erlenmeyer flask containing LBG medium and cultured at 32°C and 250 rpm for 12 h to obtain LBG solution. The obtained LGB solution was inoculated into the seed culture medium at an inoculation rate of 20%, and cultured at 32℃ and 250 rpm for 8 hours to obtain the seed culture medium. The seed culture medium consisted of: corn steep liquor 10 ml / L, yeast powder 10 g / L, (NH4)2SO4 15 g / L, MgSO4 2.5 g / L, KH2PO4 1 g / L, K2HPO4 0.5 g / L, Na2HPO4 0.5 g / L, and glucose 30 g / L. The seed culture solution was inoculated into a 5L bioreactor containing fermentation medium at an inoculation rate of 15%. The volume after inoculation was controlled at 2L, the aeration rate was 2L / min, the rotation speed was controlled at 500rpm before 12h, and then maintained at 650rpm after 12h. Residual sugar was sampled every 12h and the residual sugar concentration was controlled below 10g / L until the culture time reached 72h, at which point fermentation was stopped. The fermentation medium consisted of: yeast powder 8g / L, (NH4)2SO4 50g / L, MgSO4 2.5g / L, KH2PO4 1g / L, K2HPO4 0.5g / L, Na2HPO4 0.5g / L, FeSO4 0.02g / L, MnSO4 0.02g / L, and glucose 100g / L.

Images