Protein glutaminase mutant with improved thermal stability and application thereof

By performing specific amino acid mutations on the parent sequence of protein glutaminase, its stability and enzyme activity at high temperatures were improved, overcoming the application limitations of wild-type enzymes in high-temperature environments, and making it suitable for food processing and feed production.

CN121574969APending Publication Date: 2026-02-27JIANGNAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511896975.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-16
Publication Date
2026-02-27

AI Technical Summary

Technical Problem

Wild-type protein glutaminase has poor thermal stability, which limits its application in high-temperature processing environments.

Method used

The parent sequence of protein glutaminase was modified by mutating amino acids at positions 30 and 108, including mutating serine at position 30 to phenylalanine or glutamine, and mutating serine at position 108 to glycine, alanine, methionine, threonine, aspartic acid, or glutamine. The resulting mutants showed higher thermal stability.

Benefits of technology

The mutant showed a 436.4% increase in residual enzyme activity at 60℃ compared to the wild type, and an 18.5% increase in the degree of deamidation of soybean protein at 55℃ compared to the wild type, significantly improving thermal stability and meeting the needs of high-temperature environments in industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121574969A_ABST
    Figure CN121574969A_ABST
Patent Text Reader

Abstract

The invention provides a protein glutaminase mutant with improved thermal stability and application thereof, and relates to the technical field of enzyme engineering. According to the invention, a female parent sequence of protein glutaminase is modified, the modification comprises saturated mutation and combinatorial mutation of 30th serine and 108th serine with the female parent sequence such as SEQ ID NO.1, the relative enzyme activity of the screened mutant and the residual enzyme activity after treatment at 60 DEG C are obviously improved compared with those of a wild type, and the mutant shows higher thermal stability. The residual enzyme activity of the combined mutant S30F / S108Q at the temperature of 60 DEG C is improved by 436.4% compared with that of a wild type, the deamidation degree of the combined mutant S30F / S108Q to soybean protein at the temperature of 55 DEG C is improved by 18.5% compared with that of the wild type, the problems that in the prior art, the thermal stability of protein glutaminase is poor, and industrial production and application cannot be met are solved, and the combined mutant S30F / S108Q has good application prospects in the fields of food processing, feed production and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of enzyme engineering technology, and in particular to a protein glutaminase mutant with improved thermal stability and its applications. Background Technology

[0002] Natural plant protein is an important source of dietary protein for humans, but its high content of glutamine and asparagine residues easily leads to protein aggregation and precipitation, significantly increasing processing difficulty. Deamidation, as an effective method, can not only improve the processability of plant protein but also enhance the taste of food while preserving its biological activity.

[0003] Protein-glutaminase (EC 3.5.1.44) plays a crucial role in this process. It specifically catalyzes the deamidation of glutamine residues in plant proteins, generating glutamate and releasing ammonia, thereby significantly improving the functional properties of proteins, including solubility, emulsifying properties, interfacial affinity, and gelling ability. Based on these advantages, this enzyme has been widely used in various fields such as food processing and the feed industry. In 2000, Yamaguchi and Yokoe first isolated and purified a protein deamidase with industrial application potential from the culture supernatant of *Chryseobacterium proteolyticum* 9670T, providing a new enzyme resource for related industries. However, wild-type protein-glutaminase suffers from poor thermostability, limiting its widespread use in high-temperature processing environments. Summary of the Invention

[0004] To solve the above-mentioned technical problems, the present invention modifies the parent sequence of protein glutaminase. The modification includes saturation mutation and combination mutation of serine at position 30 and position 108 of the parent sequence, such as SEQ ID NO.1. The mutant obtained by screening has significantly improved relative enzyme activity and residual enzyme activity after treatment at 60°C compared with the wild type of protein glutaminase, showing higher thermal stability.

[0005] The first objective of this invention is to provide a thermostable protein glutaminase mutant by modifying the amino acid sequence of the parent sequence as shown in SEQ ID NO.1 by any of the following modifications:

[0006] (1) The serine at position 30 is mutated to phenylalanine or glutamine;

[0007] (2) The serine at position 108 is mutated to glycine, alanine, methionine, threonine, glutamine, aspartic acid or glutamic acid.

[0008] Furthermore, the parent sequence of the amino acid sequence shown in SEQ ID NO.1 was modified: the serine at position 30 was mutated to phenylalanine or glutamine, and the serine at position 108 was mutated to glycine, alanine, methionine, threonine, glutamine, aspartic acid, or glutamic acid.

[0009] Furthermore, the parent sequence of amino acid sequence as shown in SEQ ID NO.1 was modified as follows:

[0010] (1) The 30th serine is mutated to phenylalanine, and the 108th serine is mutated to glycine;

[0011] (2) Serine at position 30 is mutated to phenylalanine, and serine at position 108 is mutated to glutamine;

[0012] (3) The serine at position 30 is mutated to phenylalanine, and the serine at position 108 is mutated to glutamic acid;

[0013] (4) Serine at position 30 is mutated to glutamine, and serine at position 108 is mutated to alanine;

[0014] (5) Serine at position 30 is mutated to glutamine, and serine at position 108 is mutated to glutamic acid;

[0015] (6) Serine at position 30 is mutated to glutamine, and serine at position 108 is mutated to threonine;

[0016] (7) Serine at position 30 is mutated to glutamine, and serine at position 108 is mutated to glutamine.

[0017] A second objective of this invention is to provide a gene encoding a mutant of the aforementioned protein glutaminase.

[0018] A third objective of this invention is to provide an expression vector containing the aforementioned genes.

[0019] In one embodiment of the present invention, the expression vector uses pP43NMK as its backbone.

[0020] A fourth objective of the present invention is to provide a host cell comprising the above-described protein glutaminase mutant, the above-described gene, or the above-described expression vector.

[0021] Furthermore, the host cell is a non-plant cell.

[0022] In one embodiment of the present invention, the host cell is Bacillus subtilis.

[0023] A fifth objective of this invention is to provide the application of the above-mentioned protein glutaminase mutant, the above-mentioned gene, the above-mentioned expression vector, or the above-mentioned host cell in protein deamidation.

[0024] The sixth objective of this invention is to provide a method for deamidating soybean protein by adding the above-mentioned protein glutaminase mutant to a reaction system containing soybean protein.

[0025] Furthermore, the soybean protein undergoes pretreatment, which involves stirring the soybean protein solution at room temperature and storing it at 0-4°C.

[0026] In one embodiment of the present invention, the concentration of the soybean protein solution is 10 mg / mL.

[0027] Furthermore, the reaction temperature is 50-100℃.

[0028] In one embodiment of the present invention, the reaction temperature is 55°C.

[0029] The beneficial effects of this invention are:

[0030] This invention involves single-point and combined mutations of the protein glutaminase S30 and S108, whose amino acid sequences are shown in SEQ ID NO.1. The resulting dual-site combined mutant S30F / S108Q exhibits a 436.4% higher residual enzyme activity at 60℃ compared to the wild type, and an 18.5% higher degree of deamidation of soybean protein at 55℃ compared to the wild type. This protein glutaminase mutant effectively improves the problem of insufficient thermal stability, enabling it to meet the requirements of high-temperature environments in industrial production, and shows good application prospects in food processing and feed production. Attached Figure Description

[0031] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings, wherein:

[0032] Figure 1 This is a schematic diagram of the structure of plasmid pP43NMK-PG expressing the protein glutaminase in Example 1 of the present invention;

[0033] Figure 2 The results of residual enzyme activity determination of wild-type WT and mutant protein glutaminase in Example 1 of the present invention after incubation at 60°C for 30 min;

[0034] Figure 3 The results of relative enzyme activity determination of fermentation supernatant of wild-type WT and mutant protein glutaminase in Example 1 of this invention;

[0035] Figure 4 The results show the relative enzyme activity and residual enzyme activity of the protein glutaminase 30S and 108S site combined mutant in Example 2 of this invention, after incubation at 60°C for 30 min.

[0036] Figure 5 The results of the determination of the degree of deamidation of soybean protein by wild-type WT and mutant S30F / S108Q protein glutaminase at 55°C are shown in Example 3 of this invention. Detailed Implementation

[0037] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0038] The amino acid sequence of the protein glutaminase is shown in SEQ ID NO.1. The mutation site S30 was obtained by virtual scanning of the whole protein of protein glutaminase using Rosetta Cartesian_ddg, and the mutation site S108 is a low-conserved amino acid site near the catalytic active site.

[0039] The culture media involved in the following examples are shown below:

[0040] LB liquid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, adjust pH to 7.2-7.4, autoclave at 121°C for 20 min.

[0041] LB solid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, 10 g / L agar, adjust pH to 7.2-7.4, autoclave at 121°C for 20 min.

[0042] TB liquid culture medium: peptone 12 g / L, yeast extract 24 g / L, glycerol 5 g / L, KH2PO4 2.31 g / L, K2HPO4 12.54 g / L, adjust pH to 7.2-7.4, autoclave at 115°C for 20 min.

[0043] The enzyme activity and deamidation degree detection methods involved in the following examples are as follows:

[0044] (1) Enzyme activity detection method:

[0045] The enzyme activity of protein glutaminase is defined as the amount of enzyme required to produce 1 μmol of ammonium ions by hydrolyzing the substrate Cbz-Gln-Gly (benzyloxycarboxyl-glutamine-glycine) for 30 min at 37℃ and pH=6.5. It is defined as one unit of protein glutaminase activity, denoted by U.

[0046] Weigh 0.314 g of NH4Cl and dry it in an oven for 1 h. Add water to make up to 1 L and dilute according to Table 1 to obtain ammonia standard solutions of different concentrations.

[0047] Table 1. Ammonia standard solutions of different concentrations

[0048] <![CDATA[NH4Cl(μL)]]> 0 80 160 240 320 400 <![CDATA[ddH2O(μL)]]> 2000 1920 1840 1760 1680 1600 Concentration µg / mL 0 4 8 12 16 20

[0049] Take 60 µL of ammonia solutions of different concentrations, add 240 µL of ddH2O, 300 µL of colorimetric solution A, 150 µL of colorimetric solution B, and 300 µL of colorimetric solution C respectively, mix thoroughly, and develop in a 37°C water bath for 20 min. Then, measure the absorbance at 630 nm using an ELISA reader. Plot a standard curve of ammonia with ammonium chloride concentration on the x-axis and absorbance on the y-axis based on the results.

[0050] Colorimetric solution A: Weigh 2.023 g of phenol and 7.5 mg of sodium nitrosoferricyanide, dissolve them in double-distilled water and bring the volume to 50 mL.

[0051] Colorimetric solution B: Weigh 2.5 g KOH, dissolve it in double-distilled water, and bring the volume to 50 mL.

[0052] Colorimetric solution C: Weigh 10.2 g of anhydrous K2CO3, dissolve it in double-distilled water, add 417 µL of NaClO solution, and dilute to 50 mL with water.

[0053] Substrate Cbz-Gln-Gly solution: Weigh 0.337 g of dipeptide Cbz-Gln-Gly, dissolve it in 0.176 mol / L PBS buffer (pH=6.5), and bring the volume to 100 mL.

[0054] Trichloroacetic acid solution (0.4 mol / L): Weigh 6.536 g of trichloroacetic acid and dissolve it in 90 mL of distilled water, then dilute to 100 mL.

[0055] Sample reaction: Incubate 1 mL of dipeptide Cbz-Gln-Gly solution in a 37°C water bath for 10 min. Add 100 µL of diluted fermentation supernatant, mix well, and react in a 37°C water bath for 30 min. After the reaction, add 1 mL of 0.4 mol / L trichloroacetic acid solution, mix well, and terminate the reaction. Take 60 µL of the reaction solution and mix thoroughly with 240 µL of distilled water, 300 µL of colorimetric solution A, 150 µL of colorimetric solution B, and 300 µL of colorimetric solution C. Incubate in a 37°C water bath for 20 min, cool, and measure the absorbance of the system at 630 nm.

[0056] Blank reaction: Take 100 µL of diluted fermentation broth and boil it at 100°C for 5 min as a blank group. The enzyme activity detection method is the same as above.

[0057] Enzyme activity (U / mL): ×Dilution factor

[0058] Where OD1 is the light absorbance of the experimental system, OD2 is the light absorbance of the control system, a is the slope of the ammonia solution standard curve, 30 is the reaction time in min, 2.1 / 0.1 is the volume ratio of the reaction solution to the enzyme solution, and 17.03 is the relative molecular mass of ammonia.

[0059] (2) Deamidation degree detection method:

[0060] The amount of ammonia released during deamidation was determined using the enzyme activity assay described above. The total ammonia content of natural soybean protein was determined by incubating it in 2 M HCl at 110°C for 2 h. The degree of deamidation (DD) was calculated by comparing the amount of ammonia produced by protein glutaminase treatment of soybean protein with the total ammonia content. The formula for calculating DD is as follows:

[0061]

[0062] Example 1: Construction of a single-point mutant library and verification of enzyme activity

[0063] (1) Construction of pP43NMK-PPG

[0064] Primer design (5'-3'):

[0065] PPG-F: GATTCAAATGGCAATCAAGAAATTAATGGCAAAG

[0066] PPG-R: TTAatgatgatgatgatgatgAAAGCCGCATGATGAAACATCCG

[0067] PT-F: CGGCTTTcatcatcatcatcatcatTAAtgatgaaagcttggcgtaatcatggtcatag

[0068] PT-R: TCTTGATTGCCATTTGAATCcgtacatccagcaagcaaaatcataagcag

[0069] Using pP43NMK as a vector, the protein glutaminase gene fragment was amplified and synthesized using primers PPG-F / PPG-R, and the pP43NMK vector fragment was amplified using primers PT-F / PT-R. Homologous recombination was then performed between the pP43NMK vector obtained in the previous step and the protein glutaminase gene fragment using a one-step cloning method to obtain the pP43NMK-PPG plasmid (plasmid structure shown in figure). Figure 1 (As shown).

[0070] (2) Construction of single-point mutants of protein glutaminase

[0071] Primer design (5'-3'):

[0072] 30F:GTGGAACATCAACAGCATCANNKCCGTGCATTACATTTAGATATCCGGTTGATG

[0073] 30R:TGATGCTGTTGATGTTCCACAACTTTGAT

[0074] 108F: CATTATTGATCCGTCATTATTTNNKTCAGGCCCGGTGACAGATACG

[0075] 108R:AAAATAATGACGGATCAATAATGCGTTTTCTGTTAC

[0076] CXF: CAAAACGGTTCCGGTTGGCATTG

[0077] Using pP43NMK-PPG plasmid as a template, reverse PCR was performed using primers 30F / 30R and 108F / 108R, respectively. The obtained DNA fragments were purified and transformed into E. coli JM109. Single clones from the plates were inoculated into fresh LB lysate for culture. Plasmids were extracted and sequenced using primer CXF to ensure that serine residues at positions 30 and 108 were mutated to 19 other amino acids. The S30 mutation reduced the protein's folding free energy, affecting its thermal stability; S108, a low-conserved amino acid located within 5 Å of the protein's catalytic active site, affected its catalytic activity. The obtained plasmids were named pP43NMK-PPG-30X (where X represents the mutated amino acid) and pP43NMK-PPG-108X.

[0078] (3) Enzyme activity of protein glutaminase and mutants

[0079] The verified plasmid constructed above was co-transformed into Bacillus subtilis 168 using the competent cell transformation method. Single colonies of the recombinant strain were picked and inoculated into 2 mL of LB broth containing 50 μg / mL kanamycin. The cultures were incubated at 37°C and 220 rpm for 12 h to obtain seed culture. Then, 1 mL of the seed culture was inoculated into 25 mL of TB broth and incubated at 37°C and 220 rpm for 36 h. The bacterial cells were centrifuged to obtain the supernatant. The activities of protein glutaminase and mutants were detected. The supernatant was incubated at 60°C for 30 min, then placed on ice for 10 min, and the activities of protein glutaminase and mutants were detected. Figure 2 The initial enzyme activity measured before 60°C incubation was taken as the highest enzyme activity, and the enzyme activity measured after 60°C incubation was taken as the residual enzyme activity. Figure 2 As shown, the residual enzyme activities of the protein glutaminase mutants S30F and S30Q were 31.5% and 24.1%, respectively, which were 310.2% and 214.4% higher than those of the wild type (WT, 7.7%). This indicates that the mutants S30F and S30Q have better thermostability at 60℃ than the wild type.

[0080] (4) Relative enzyme activity of protein glutaminase and mutants

[0081] The verified plasmid constructed above was co-transformed into Bacillus subtilis 168 using a competent transformation method. Single colonies of the recombinant strain were picked and inoculated into 2 mL of LB broth containing 50 μg / mL kanamycin. The cultures were incubated at 37°C and 220 rpm for 12 h to obtain a seed culture. Then, 1 mL of the seed culture was inoculated into 25 mL of TB broth and incubated at 37°C and 220 rpm for 36 h. The bacterial cells were centrifuged to obtain the supernatant, and the enzyme activities of protein glutaminase and mutants were detected. The relative enzyme activity of the mutant was calculated with the wild-type WT protein glutaminase activity as 100%. Figure 3 As shown, the enzyme activities of protein glutaminase mutants S108G, S108A, S108M, S108T, S108Q, S108D and S108E were increased by 31.2%, 28.4%, 20.5%, 47.5%, 34.3%, 45.3% and 29.1% respectively compared with WT.

[0082] Example 2: Construction and Enzyme Activity Verification of Combinatorial Mutants

[0083] (1) Construction of combined mutants

[0084] 30F-F:gtggaacatcaacagcatcatttccgtgcattacatttagatatccggttgatg

[0085] 30Q-F:gtggaacatcaacagcatcacaaccgtgcattacatttagatatccggttgatg

[0086] 30R: GATGCTGTTGATGTTCCACAACTTTGATTC

[0087] CXF: CAAAACGGTTCCGGTTGGCATTG

[0088] Using plasmids pP43NMK-PPG-108G, pP43NMK-PPG-108A, pP43NMK-PPG-108M, pP43NMK-PPG-108T, pP43NMK-PPG-108Q, pP43NMK-PPG-108D, and pP43NMK-PPG-108E as templates, reverse PCR was performed using primers 30F-F / 30R and 30Q-F / 30R. The obtained DNA fragments were purified and transformed into E. coli. JM109 was used to inoculate single clones from plates into fresh LB culture. Plasmids were extracted, and sequencing was performed using CXF primers. The obtained plasmids were named pP43NMK-PPG-S30F / S108G, pP43NMK-PPG-S30F / S108A, pP43NMK-PPG-S30F / S108M, pP43NMK-PPG-S30F / S108T, pP43NMK-PPG-S30F / S108Q, and pP43NMK-PPG-S30F / S108G. 08D, pP43NMK-PPG-S30F / S108E, pP43NMK-PPG-S30Q / S108G, pP43NMK-PPG-S30Q / S108A, pP43NMK-PPG-S30Q / S108 M, pP43NMK-PPG-S30Q / S108T, pP43NMK-PPG-S30Q / S108Q, pP43NMK-PPG-S30Q / S108D and pP43NMK-PPG-S30Q / S108E.

[0089] (2) Determination of relative enzyme activity and residual enzyme activity of the combined mutant

[0090] The verified plasmid constructed above was co-transformed into Bacillus subtilis 168 using competent transformation. Single colonies of the recombinant strain were picked and inoculated into 2 mL of LB broth containing 50 μg / mL kanamycin. The cultures were incubated at 37°C and 220 rpm for 12 h to obtain seed culture. Then, 1 mL of the seed culture was inoculated into 25 mL of TB broth and incubated at 37°C and 220 rpm for 36 h. The supernatant was obtained by centrifugation, and the enzyme activities of protein glutaminase and mutants were detected. The relative enzyme activity of the mutant was calculated with the wild-type WT protein glutaminase activity as 100%. Figure 4 The supernatant was incubated at 60°C for 30 min, then placed on ice for 10 min, and the residual enzyme activity of protein glutaminase and mutants was measured. The initial enzyme activity measured without 60°C incubation was taken as the highest enzyme activity, and the enzyme activity measured with 60°C incubation was taken as the residual enzyme activity.

[0091] The results are as follows Figure 4 As shown, the relative enzyme activities of the protein glutaminase mutants S30F / S108A, S30F / S108Q, S30F / S108D, S30Q / S108A, S30Q / S108E, S30Q / S108T, and S30Q / S108Q were not reduced compared to WT, and were 110.4%, 107.5%, 101.8%, 120.2%, 114.6%, 117.5%, and 100.3% of WT, respectively. After purification of the supernatant, SDS-PAGE analysis was performed to obtain the protein glutaminase and the combined mutants S30F / S108A, S30F / S108Q, S30F / S108D, S30Q / S108A, S30Q / S108E, S30Q / S108T, and S30Q / S108Q. The residual enzyme activities after incubation at 60℃ for 30 min were 32.0%, 41.3%, 35.6%, 15.7%, 36.1%, 12.8%, and 26.0%, respectively, all of which were higher than those of wild-type WT (7.7%). Among them, the residual enzyme activity of pP43NMK-PPG-S30F / S108Q was the most significantly improved compared to WT, increasing by 436.4% compared to wild-type. This indicates that the relative enzyme activity of the above combined mutants is better than that of wild-type WT, and they also have better thermostability at 60℃ than wild-type WT.

[0092] Example 3: Determination of the effect of protein glutaminase mutant on deamidation of soybean protein

[0093] Using Bacillus subtilis strain 168 containing the pP43NMK-PPG plasmid as the control group, and recombinant strains carrying pP43NMK-PPG-S30F / S108Q, 2 mL of a single colony was picked and cultured in LB broth at 37°C and 220 rpm for 12 h to obtain seed culture. Then, 1 mL of seed culture was inoculated into 25 mL of TB broth and cultured at 37°C and 220 rpm for 36 h. The bacterial cells were centrifuged to obtain the supernatant, which was purified and detected by SDS-PAGE to obtain the protein glutaminase and the combined mutant S30F / S108Q.

[0094] Soy protein was treated with stirring at room temperature for 2 h and stored overnight at 4℃ to prepare a 10 mg / mL substrate solution. The obtained protein glutaminase and the combined mutant S30F / S108Q were incubated with the 10 mg / mL soy protein solution at 55℃ with shaking for 2 h, followed by a heating step (100℃ for 10 min) to terminate the reaction. The sample was appropriately diluted, and 60 μL of the diluted sample was reacted with a colorimetric reagent. The absorbance was measured at 630 nm. The 10 mg / mL soy protein solution was incubated in 2 M HCl at 110℃ for 2 h, and the total ammonia content was measured. The degree of deamidation of the soy protein after treatment with the protein glutaminase and the combined mutant was calculated. Figure 5 As shown, the combined mutant S30F / S108Q significantly improved the degree of deamidation of soybean protein compared to the control group, with S30F / S108Q increasing the degree of deamidation of soybean protein by 18.5% compared to WT-treated soybean protein.

[0095] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A protein glutaminase mutant with improved thermal stability, characterized in that, The parent sequence of the amino acid sequence shown in SEQ ID NO. 1 is modified as follows: (1) the 30th serine is mutated to phenylalanine or glutamine; (2) the 108th serine is mutated to glycine, alanine, methionine, threonine, glutamine, aspartic acid or glutamic acid.

2. The protein glutaminase mutant according to claim 1, characterized in that, The parent sequence of the amino acid sequence shown in SEQ ID NO. 1 is modified as follows:

3. The protein glutaminase mutant according to claim 2, characterized in that, (1) the 30th serine is mutated to phenylalanine, and the 108th serine is mutated to glycine; (2) the 30th serine is mutated to phenylalanine, and the 108th serine is mutated to glutamine; (3) the 30th serine is mutated to phenylalanine, and the 108th serine is mutated to glutamic acid; (4) the 30th serine is mutated to glutamine, and the 108th serine is mutated to alanine; (5) the 30th serine is mutated to glutamine, and the 108th serine is mutated to glutamic acid; (6) the 30th serine is mutated to glutamine, and the 108th serine is mutated to threonine; (7) the 30th serine is mutated to glutamine, and the 108th serine is mutated to glutamine.

4. A gene encoding the glutaminase mutant of any one of claims 1-3.

5. An expression vector comprising the gene of claim 4.

6. A host cell comprising the glutaminase mutant of any one of claims 1-3, the gene of claim 4 or the expression vector of claim 5.

7. Use of the glutaminase mutant of any one of claims 1-3, the gene of claim 4, the expression vector of claim 5 or the host cell of claim 6 in protein deamidation. The glutaminase mutant of any one of claims 1-3 is added to a reaction system containing soybean protein.

8. A method of deamidating soy protein, characterized by: The soybean protein is pretreated by stirring the soybean protein solution at room temperature and storing at 0-4°C.

9. The method of claim 8, wherein: The temperature of the reaction is 50-100°C.

10. The method of claim 8, wherein: ​