Screening method and application of floating moss endogenous constitutive promoter

Abstract

The invention discloses a screening method and application of a floating moss endogenous constitutive promoter, and belongs to the technical field of gene engineering. A floating moss endogenous constitutive promoter is screened out through experiments such as screening verification of candidate constitutive promoters, a plant expression vector of which a reporter gene started by the promoter is positioned in a cell nucleus is constructed, and floating moss is transformed to obtain a transgenic plant. The fluorescence intensity of the reporter gene driven by the promoter is higher than that of other common constitutive promoters, such as CaMV35S and the like, and meanwhile, when fluorescence expression of transgenic plants is observed, it is found that the reporter gene can be stably expressed in thalli, scales, various different types of cells of the thalli and the scales and the like. The invention provides an efficient and universal core tool for floating moss gene function research, genetic manipulation, biotechnology application and the like, and has a certain application prospect.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and relates to a screening method and application of a constitutive promoter endogenous to Ricciocarpus natans, in particular to a screening method and application of a constitutive strong promoter of Ricciocarpus natans. BACKGROUND

[0002] A promoter is a core element of gene expression regulation, is located at the upstream of the 5' end transcription initiation site of a gene, contains a binding site of an RNA polymerase and a transcription factor, and determines the starting position, efficiency and direction of transcription by specific recognition and combination of a regulatory factor. The function thereof depends on the accessibility of an open chromatin region, and the promoter is one of key factors influencing the expression efficiency of an exogenous gene in genetic engineering.

[0003] Ricciocarpus natans is a water-land amphibious bryophyte with worldwide distribution, belongs to the genus Ricciocarpos of the family Ricciaceae of the order Marchantiales of the class Marchantiopsida, and belongs to the class Marchantiopsida together with the emerging model plant Marchantiapolymorpha. However, the Ricciocarpus natans has a single layer of scales and other advantages, and is more conducive to exploring the formation and development of organelles from the perspective of cell biology, so the Ricciocarpus natans is developing into an emerging model species like the Marchantiapolymorpha.

[0004] In the research of gene functions, a constitutive promoter can enable an exogenous gene to be expressed in a plant in a high-efficiency, sustained and stable manner for a long time, and is conducive to the function of the exogenous gene. At present, in plant genetic engineering, a constitutive strong promoter (such as a cauliflower mosaic virus CaMV35S promoter) is widely used to drive sustained and efficient expression of an exogenous gene, so as to improve agronomic traits or produce a recombinant protein. However, the activity of an existing promoter in the Ricciocarpus natans is limited, and it is difficult to drive expression of a gene of the Ricciocarpus natans, so it is urgent to explore a new type of high-efficiency and broad-adaptability promoter to meet the needs of the research of the Ricciocarpus natans. Therefore, it is of great significance and value to find a promoter endogenous to the Ricciocarpus natans and capable of stable expression, to research gene functions of the Ricciocarpus natans, to construct a subcellular fluorescence localization system of the Ricciocarpus natans, to construct a CRISPR / Cas9 system of the Ricciocarpus natans, and to perfect a genetic manipulation system of the Ricciocarpus natans. SUMMARY

[0005] In order to solve the problems in the prior art, the application provides a screening method and application of a constitutive promoter endogenous to Ricciocarpus natans.

[0006] Based on the existing genomics, transcriptome, culture system, and genetic transformation system of *Lycoperdon perlatum* in our laboratory, this invention conducted experiments such as screening and verification of candidate constitutive promoters, and screened out an endogenous constitutive promoter of *Lycoperdon perlatum*. Furthermore, a plant expression vector for the reporter gene *mCherry*, driven by this promoter and located in the cell nucleus, was constructed and transformed into *Lycoperdon perlatum*. Experiments of this invention demonstrated that the fluorescence intensity of the reporter gene driven by this promoter was higher than that of common constitutive promoters such as CaMV35S and UBQ10. Through screening, the pro7 promoter, an endogenous constitutive promoter of *Lycoperdon perlatum*, was obtained. Simultaneously, observation of the fluorescence expression of PBI121-pro7-RnH2B-mCherry transgenic plants revealed that it could be stably expressed in various types of thallus, scales, and both thallus and scales.

[0007] This invention provides a method for screening constitutive promoters endogenously derived from algae, the screening method comprising the following steps:

[0008] 1. Using existing moss transcriptome data, genes highly expressed in moss itself were screened, and the functions of these genes were predicted using a liverwort database to identify housekeeping genes.

[0009] 2. Using the housekeeping gene screened in step 1, select the first 1800bp to 2200bp of the housekeeping gene sequence as a candidate endogenous constitutive promoter sequence for the floating algae, construct a plasmid, and obtain positive plants through genetic transformation.

[0010] 3. In order to screen out the constitutive promoters endogenous to the floating algae, the fluorescence intensity and transformation efficiency of the positive plants obtained in step 2 are statistically analyzed to screen out the preferred constitutive promoters endogenous to the floating algae.

[0011] 4. Simultaneously, fluorescence observation is performed on the positive plants that have been transferred to the selected constitutive promoters of the preferred endogenous algae in step 3 to observe whether their fluorescence can be widely expressed.

[0012] 5. Fluorescence observation in step 4 revealed that the selected endogenous constitutive promoters of the preferred algae selected in step 3 were stably expressed in organelles and / or cells.

[0013] In step 1, the genes highly expressed by the floating moss are the top 100 genes highly expressed by the floating moss itself.

[0014] In the step 1, 10 housekeeping genes (as shown in Table 1, the gene label is independently named by the laboratory) are screened out, wherein the 10 housekeeping genes include Rn2g2147, Rn3g1583, Rn3g0156, Rn5g0254, Rn5g1218, Rn8g1343, Rn7g1365, Rn7g1354, Rn1g0213 and Rn4g0193.

[0015] In the step 2, the candidate constitutive promoter of the leaflike liverwort endogenous includes one or more of pro1, pro2, pro3, pro4, pro5, pro6, pro7, pro8, pro9 and pro10.

[0016] In the step 2, the plasmid includes PBI121-promoter-RnH2B-mCherry plasmid and the like, wherein the PBI121-promoter-RnH2B-mCherry plasmid takes pBI121 as a basic vector, contains the promoter as the leaflike liverwort self promoter, the mCherry as a reporter gene, and the RnH2B as a leaflike liverwort nuclear localization gene B and the like.

[0017] In the step 2, the pro promoter includes one or more of pro1, pro2, pro3, pro4, pro5, pro6, pro7, pro8, pro9 and pro10.

[0018] In the step 2, the genetic transformation method is specifically as follows:

[0019] 1) Leaf thallus powder crushing: Leaf thallus was broken into pieces by mechanical homogenization, i.e. using a homogenizer at 24000 rpm for about 15 s to make the leaf thallus uniform fragmentation, and using a 100 μm cell filter to filter the crushed leaf thallus pieces. 2) Pre-culture of explants: The homogenized leaf thallus pieces were inoculated on pre-culture medium (1 / 2B5 medium 1.605 g / L, sucrose 10 g / L, agar 10 g / L, pH = 5.7) for pre-culture for 5 d. 3) Obtaining of Agrobacterium containing plasmid: 2 μl of constructed plasmid was added to 100 μl of EHA105 Agrobacterium, and then placed on ice for 5 min, in liquid nitrogen for 5 min, in a 37 °C water bath for 5 min, and then added with 200 μl of LB liquid medium, and cultured in a 37 °C, 220 rpm shaker for 2 h, and then spread on LB solid medium (rifampicin 100 mg / L + plasmid resistance kanamycin 50 μg / ml), and single colonies were picked and stored by shaking. 4) Agrobacterium expansion culture: The stored Agrobacterium liquid was added to 5 ml of LB liquid medium (rifampicin 100 mg / L + plasmid resistance kanamycin 50 μg / ml), and cultured in a 28 °C, 220 rpm shaker; 1 ml of turbid bacterial liquid was expanded in 100 ml of LB liquid medium (rifampicin 100 mg / L + plasmid resistance kanamycin 50 μg / ml) at a ratio of 1:100, and cultured in a 28 °C, 220 rpm shaker overnight for about 14 h; 5) Agrobacterium activation: when the OD600 of Agrobacterium was about 2.0, it was dispensed into 50 ml centrifuge tubes, centrifuged at 5000 rpm for 6 min, and the bacterial bodies were resuspended with 100 ml of Agrobacterium infection liquid (1 / 2MS liquid medium containing 3% sucrose, 100 μm acetosyringone, pH = 5.2), and activated in a 25 °C, 110 rpm shaker for 30 min. 6) Infection and co-culture: the leaf thallus pieces were immersed in the Agrobacterium infection liquid for 2 h, and then the leaf thallus pieces were filtered out by a cell filter, and placed in co-culture medium (1 / 2MS solid medium containing 3% sucrose, agar 10 g / L, 100 μm acetosyringone, pH = 5.7) for dark culture for 3 d, to obtain co-cultured explants. 7) First screening culture: the co-cultured leaf thallus pieces were transferred to antibiotic-containing screening medium (1 / 2B5 medium 1.605 g / L, sucrose 10 g / L, agar 10 g / L, cefotaxime sodium 100 μg / ml, and antibiotics such as hygromycin 10 μg / ml or kanamycin 50 μg / ml selected according to the resistance gene of the transferred vector), and cultured in a constant temperature light incubator for 3-4 weeks. 8) Second screening culture: the newly grown green tissues on the first screening medium were transferred to new antibiotic-containing screening medium for the second screening, for 3-4 weeks.

[0020] Wherein, after the first screening, the small dark green leafy body tissue is visible on the screening plate, and the magnified observation shows that there are many rhizoids on the leafy body. The appearance of rhizoids on the tissue fragments is considered as a reliable indicator of the success of the transformation event.

[0021] Wherein, the surviving and regenerated plants are subjected to a second round of antibiotic selection to ensure that false positives are eliminated, and after the second screening, the plants are transferred to normal medium for rapid propagation.

[0022] Wherein, the 1 / 2B5 medium comprises: B5 medium powder Phytotechlab 1.605g / L (1 / 2B5), sucrose 10g / L, agar 10g / L, and the pH is adjusted to 5.7.

[0023] Wherein, the LB solid medium comprises: tryptone 10g / L, sodium chloride 10g / L, yeast extract 5g / L, agar powder 15g / L, and the pH is 8.0.

[0024] Wherein, the LB liquid medium comprises: tryptone 10g / L, sodium chloride 10g / L, yeast extract 5g / L, and the pH is 8.0.

[0025] Wherein, the Agrobacterium infection solution comprises: MS medium powder 2.215g / L (1 / 2MS), sucrose 30g / L, 100μm acetosyringone, and the pH is 5.2.

[0026] Wherein, the co-culture medium comprises: MS medium powder 2.215g / L (1 / 2MS), sucrose 30g / L, 100μm acetosyringone, agar 10g / L, and the pH is 5.7.

[0027] Wherein, the normal medium for rapid propagation is 1 / 2B5 medium.

[0028] In step 3, the preferred constitutive promoter includes pro7 promoter, etc.

[0029] In step 3, the transformation efficiency = total number of positive plants / total number of screened plants.

[0030] In step 4, the organelle and / or cell are various types of organelles and / or cells, including leafy bodies, scales, etc., and / or various types of cells in leafy bodies and / or scales, etc.

[0031] In one specific embodiment, the method of the present application specifically comprises the following steps:

[0032] 1. Using the existing transcriptome data of the floating moss, the top 100 self-highly expressed genes of the floating moss were screened, and the functions of the genes were predicted through the database of the liverwort, the housekeeping genes were screened, and 10 genes were screened (as shown in Table 1, the gene label is independently named by the laboratory).

[0033] 2. The sequence of about 2000bp of the gene selected in the step 1 is selected as the promoter of the gene, the promoters are respectively named as pro1, pro2, pro3, pro4, pro5, pro6, pro7, pro8, pro9 and pro10, the PBI121-promoter-RnH2B-mCherry plasmid is constructed, and the positive plants of the five promoters of pro3, pro4, pro7, pro9 and pro10 are obtained through genetic transformation.

[0034] 3. In order to screen the endogenous constitutive promoter of the floating moss, the average fluorescence intensity of the scales of different promoters is counted by using the ImageJ software, the fluorescence intensity of different promoters is subjected to significance analysis, the fluorescence intensity of different floating moss constitutive promoters is compared, and whether there is a significant difference between the fluorescence intensity of the common constitutive promoter CaMV35S and the UBQ10 finger fluorescence intensity is compared, the transformation efficiency of the positive strains of different promoters is also compared, and the effective endogenous constitutive promoter of the floating moss, i.e., the pro7 promoter, is screened by integrating the two.

[0035] 4. In order to further determine that the pro7 promoter can drive the extensive expression of the fluorescent protein, the positive strains of pBI121-pro7-RnH2B-mCherry are observed by using the fluorescence microscope, and whether the fluorescent protein is extensively expressed in the various types of cells of the thallus, the scale and the thallus and the scale is observed.

[0036] 5. Through the observation and shooting of the fluorescence microscope, the fluorescent protein driven by the pro7 promoter can be extensively expressed in different development periods and different types of cells, and can be used as an endogenous stable and extensive expression promoter of the floating moss to start other genes, and has application value.

[0037] The application also provides a promoter, which comprises the endogenous constitutive promoter of the floating moss.

[0038] The application also provides a nucleotide, which comprises mCherry and the like.

[0039] The present application also provides a nucleotide comprising RnH2B, etc.

[0040] The present application also provides a recombinant vector comprising one or more of the promoter as described above, or the nucleotide of any one of the above, etc.

[0041] Specifically, the basic vector of the recombinant vector comprises PBI121, etc.; preferably, PBI121.

[0042] In one specific embodiment, the recombinant vector is a PBI121-promoter-RnH2B-mCherry plasmid; wherein the PBI121-promoter-RnH2B-mCherry plasmid takes pBI121 as the basic vector, and comprises the promoter as the pro promoter, the mCherry as the reporter gene, and the RnH2B as the nucleolus positioning gene B of the float algae, etc.; wherein the pro promoter comprises one or more of pro1, pro2, pro3, pro4, pro5, pro6, pro7, pro8, pro9, pro10, etc.

[0043] The present application also provides a host cell comprising one or more of the promoter as described above, or the nucleotide of any one of the above, or the recombinant vector as described above, etc.

[0044] Specifically, the host cell comprises Agrobacterium, etc.; preferably, Agrobacterium.

[0045] The present application also provides a primer comprising one or more of pro1g519-F, pro1g519-R, pro2g1666-F, pro2g1666-R, pro3g8803-F, pro3g8803-R, pro4g6822-F, pro4g6822-R, pro5g7759-F, pro5g7759-R, pro6g3427-F, pro6g3427-R, pro7g5337-F, pro7g5337-R, pro8g5348-F, pro8g5348-R, pro9g11098-F, pro9g11098-R, pro10g17634-F, pro10g17634-R, etc.

[0046] The application further provides a primer pair, which comprises one or more of pro1g519-F / pro1g519-R, pro2g1666-F / pro2g1666-R, pro3g8803-F / pro3g8803-R, pro4g6822-F / pro4g6822-R, pro5g7759-F / pro5g7759-R, pro6g3427-F / pro6g3427-R, pro7g5337-F / pro7g5337-R, pro8g5348-F / pro8g5348-R, pro9g11098-F / pro9g11098-R, pro10g17634-F / pro10g17634-R, and the like.

[0047] The application further provides a plasmid, which comprises one or more of pBI121-pro1-RnH2B-mCherry, pBI121-pro2-RnH2B-mCherry, pBI121-pro3-RnH2B-mCherry, pBI121-pro4-RnH2B-mCherry, pBI121-pro5-RnH2B-mCherry, pBI121-pro6-RnH2B-mCherry, pBI121-pro7-RnH2B-mCherry, pBI121-pro8-RnH2B-mCherry, pBI121-pro9-RnH2B-mCherry, pBI121-pro10-RnH2B-mCherry, and the like, and the specific contents are shown in Table 1.

[0048] The application further provides application of the screening method, the promoter, the nucleotide, the recombinant vector, the host cell, the primer, the primer pair, or the plasmid as described above in gene editing, gene function research, genetic transformation, construction of a floating alga subcellular fluorescence localization system, establishment and system optimization of a floating alga gene editing system, stable and efficient floating alga CRISPR / Cas9 gene editing system, and construction of a perfect floating alga genetic manipulation system.

[0049] In the application, the floating alga endogenous constitutive promoter in the screening method, the promoter, the nucleotide, the recombinant vector, the host cell, the primer, the primer pair, and the plasmid as described above is a pro promoter, which comprises one or more of pro1, pro2, pro3, pro4, pro5, pro6, pro7, pro8, pro9, pro10, and the like; and / or,

[0050] The nucleotide sequence of the pro7 promoter comprises one of the following sequences:

[0051] (a) the nucleotide sequence as shown in SEQ ID NO: 1 ;

[0052] (b) a nucleotide sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity to the nucleotide sequence as shown in SEQ ID NO: 1 ;

[0053] (c) a nucleotide sequence having equivalent functionality to the nucleotide sequence as shown in SEQ ID NO: 1, formed by substitution, deletion or addition of one or more nucleic acid bases;

[0054] (d) a nucleotide sequence which hybridizes to the nucleotide sequence as defined in (a), (b) or (c), or the full-length complement thereof, under stringent conditions; or,

[0055] (e) a nucleotide sequence which differs from the nucleotide sequence as defined in (a), (b), (c), (d) due to the degeneracy of the genetic code; and / or,

[0056] The nucleotide of the pro1g519-F, pro1g519-R, pro2g1666-F, pro2g1666-R, pro3g8803-F, pro3g8803-R, pro4g6822-F, pro4g6822-R, pro5g7759-F, pro5g7759-R, pro6g3427-F, pro6g3427-R, pro7g5337-F, pro7g5337-R, pro8g5348-F, pro8g5348-R, pro9g1 1098-F, pro9g1 1098-R, pro10g17634-F, pro10g17634-R respectively comprises one of the following sequences:

[0057] (a) the nucleotide sequences as shown in SEQ ID NOs: 2-21, in order;

[0058] (b) a nucleotide sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity to the nucleotide sequence as defined in (a);

[0059] (c) a nucleic acid sequence that forms an equivalent function to the nucleotide sequence as defined in (a) by substitution, deletion or addition of one or more nucleic acid bases;

[0060] (d) a nucleotide sequence that hybridizes to the nucleotide sequence as defined in (a), (b) or (c), or the full-length complement thereof under stringent conditions; or,

[0061] (e) a nucleotide sequence that differs from the nucleotide sequence as defined in (a), (b), (c), (d) due to the degeneracy of the genetic code; and / or,

[0062] The nucleotide sequence of the mCherry comprises one of the following sequences:

[0063] (a) a nucleotide sequence as set forth in SEQ ID NO: 22;

[0064] (b) a nucleotide sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 22;

[0065] (c) a nucleic acid sequence that forms an equivalent function to the nucleotide sequence as defined in (a) by substitution, deletion or addition of one or more nucleic acid bases;

[0066] (d) a nucleotide sequence that hybridizes to the nucleotide sequence as defined in (a), (b) or (c), or the full-length complement thereof under stringent conditions; or,

[0067] (e) a nucleotide sequence that differs from the nucleotide sequence as defined in (a), (b), (c), (d) due to the degeneracy of the genetic code; and / or,

[0068] The nucleotide sequence of the RnH2B comprises one of the following sequences:

[0069] (a) a nucleotide sequence as set forth in SEQ ID NO: 23;

[0070] (b) a nucleotide sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 23;

[0071] (c) a nucleic acid sequence having equivalent functionality to the nucleotide sequence shown in SEQ ID NO: 23 with one or more nucleic acid bases replaced, deleted or added;

[0072] (d) a nucleotide sequence that hybridizes to the nucleotide sequence defined in (a), (b) or (c) or the full-length complement thereof under stringent conditions; or,

[0073] (e) a nucleotide sequence that differs from the nucleotide sequence defined in (a), (b), (c) or (d) due to the degeneracy of the genetic code.

[0074] Compared with the prior art, the beneficial effects of the present application are embodied in that there is no constitutive promoter of floating algae itself at present, and the present application obtains a constitutive promoter with higher fluorescence intensity in floating algae than the existing commonly used promoters (such as CaMV35S) by screening the housekeeping genes of floating algae. The core advantage is that the expression of the constitutive promoter in floating algae is stronger (experimental data prove that the fluorescence intensity is higher than CaMV35S); the constitutive promoter can be widely expressed in floating algae, that is, it can be stably expressed in various cell types of thallus, scale and the space between them, and provides an efficient, reliable and widely applicable core tool for gene function analysis, genetic manipulation and biotechnological application (such as synthetic biology and metabolic engineering) of floating algae. BRIEF DESCRIPTION OF DRAWINGS

[0075] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings needed in the embodiment description will be briefly introduced as follows. Obviously, the drawings in the following description are some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor on the basis of these drawings.

[0076] Figure 1 In order to utilize floating algae genetic transformation to screen the constitutive promoter of floating algae endogenous. (A) The schematic diagram of pBI121-promoter (pro1-pro10)-RnH2B-mCherry constructed; (B) The PCR identification of mCherry gene in the obtained positive strain.

[0077] Figure 2 In order to utilize floating algae genetic transformation to screen the constitutive promoter of floating algae endogenous. (A) The schematic diagram of pBI121-promoter (pro1-pro10)-RnH2B-mCherry constructed; (B) The PCR identification of mCherry gene in the obtained positive strain.

[0078] Figure 3For fluorescence observation of different types of cells in the thallus and scale of the Bryopsis sp. transformed with pBI121-pro7-RnH2B-mCherry. (A) Fluorescence observation of oil bodies and surrounding light and nuclei in the thallus of the Bryopsis sp.; (B) Fluorescence observation of nuclei in different stages of the scale of the Bryopsis sp., wherein P1, P2 and P3 are the development stages of the scale of the Bryopsis sp., P1 is the early development stage of the scale, P2 is the middle development stage of the scale, and P3 is the mature stage of the scale; (C) Fluorescence observation of nuclei in different stages of the scale of the Bryopsis sp., including oil body cells, teeth cells and surrounding photosynthetic cells. The bar is 30 microns. DETAILED DESCRIPTION

[0079] The present application is further described in conjunction with the following specific examples and accompanying drawings. The processes, conditions, experimental methods and the like used in the present application are those conventionally known in the art, unless specifically mentioned otherwise, and are not particularly limited by the present application. The following description of at least one exemplary embodiment is merely illustrative in nature and is in no way intended to limit the application or its application or uses. Based on the examples in the present application, all other examples obtained by those of ordinary skill in the art without creative work are within the scope of protection of the present application. In all examples shown and discussed herein, any specific value should be interpreted as merely exemplary, rather than limiting. Therefore, other examples of exemplary embodiments can have different values.

[0080] The present application discloses a screening method and application of a constitutive promoter endogenous to Bryopsis sp., and belongs to the technical field of genetic engineering. Through screening verification of candidate constitutive promoters, the present application screens a constitutive promoter endogenous to Bryopsis sp., constructs a plant expression vector with the reporter gene positioned in the nucleus driven by the promoter, and transforms Bryopsis sp. to obtain transgenic plants. The fluorescence intensity of the reporter gene driven by the promoter disclosed by the present application is higher than that of other common constitutive promoters, such as CaMV35S, and the stable expression of the reporter gene in the thallus, scale and various types of cells of the thallus and scale is observed. The present application provides an efficient and universal core tool for the genetic function research, genetic manipulation and biotechnological application of Bryopsis sp., and has a certain application prospect.

[0081] The test materials used in the examples are conventional biochemical reagents unless otherwise specified.

[0082] The present application proposes a constitutive promoter sequence endogenous to Bryopsis sp. The purpose of the present application is to make up for the fact that there is no efficient and stable promoter of Bryopsis sp. itself, and to provide a constitutive promoter of Bryopsis sp. The screening of the promoter and its application are as follows:

[0083] Example 1

[0084] 1. Screening housekeeping genes from existing transcriptome database of floating moss

[0085] Based on the transcriptome data and floating moss database obtained in the laboratory, in order to screen the endogenous constitutive promoter of floating moss, the expression of the transcriptome data was analyzed, the floating moss genes were screened from high to low according to the expression, the function of the floating moss genes was predicted by using the liverwort database, and then the widely expressed housekeeping genes were selected. The specific method is as follows:

[0086] 1) According to the FPKM value of different gene expression obtained by transcriptome, the top 100 highly expressed genes were screened from high to low.

[0087] 2) Using the liverwort database Marchantia polymorpha genome database (https: / / marchantia.info / ), the function of the floating moss genes was predicted by using the liverwort database in the screened genes, and the highly expressed housekeeping genes were selected;

[0088] 3) Through the local database of floating moss, 10 highly expressed housekeeping genes were selected according to the floating moss gene ID named by the laboratory, and the sequence of about 2000 base pairs (bp) size of 5'UTR of the genes was selected as the promoter sequence (as shown in Table 1).

[0089] Table 1 Constitutive promoter of candidate floating moss

[0090]

[0091] 2. Cloning of promoter

[0092] The specific primers of the upper and lower of the promoter obtained in step 1 were designed by using Snap Gene software, pro1g519-F, pro1g519-R, pro2g1666-F, pro2g1666-R, pro3g8803-F, pro3g8803-R, pro4g6822-F, pro4g6822-R, pro5g7759-F, pro5g7759-R, pro6g3427-F, pro6g3427-R, pro7g5337-F, pro7g5337-R, pro8g5348-F, pro8g5348-R, pro9g11098-F, pro9g11098-R, pro10g17634-F, pro10g17634-R (see Table 2 for specific sequence information), and the DNA of the floating algae was used as a template, and the phanta enzyme instruction (PhantaFlash Super-Fidelity DNA Polymerase, Novozyme P521) was used for PCR amplification of the promoter, and the amplification product was verified by 1% agarose gel electrophoresis, and then purified and recovered by using the agarose gel DNA recovery kit (enhanced) (DP219) of Tiangen Biosciences Co., Ltd., to obtain the pro1-pro10 promoter target fragments.

[0093] Table 2: Summary of primer sequences related to the present application, all primers are synthesized by Bioengineering (Shanghai) Co., Ltd.

[0094]

[0095]

[0096] 3. Vector construction of pBI121-promoter (pro1-pro10)-RnH2B-mCherry

[0097] 1) Obtaining linearized vector fragments by double enzyme digestion

[0098] The plasmid pBI121-CaMV35s-RnH2B-mCherry preserved in the experiment was cut by using Hind III and BamH I restriction endonuclease (full form gold), and the 35s promoter was cut, and then the enzyme cutting product was verified by using 1% agarose gel electrophoresis, and the linearized vector was recovered by using the gel recovery box, and the enzyme cutting system was 50 μl.

[0099] 2) Recombination reaction and transformation of recombinant product

[0100] According to the instructions of the ClonExpress II One Step Cloning Kit (Novagen C112), the linearized vector fragment obtained in step 1) was ligated with the pro1-pro10 promoter target fragments obtained in step 2). The ligation system was 10 μl. After 37°C reaction for 30 min, it was cooled at 4°C or immediately placed on ice. 10 μl of the recombination product was added to 100 μl of TOP10 competent cells for recombination product transformation, and then coated on LB solid plates (containing kanamycin) and cultured at 37°C overnight to obtain recombinant strains. Single colonies were picked and verified by colony PCR, and then shaken.

[0101] The formula of the LB solid plate is as follows: tryptone 10 g / L, sodium chloride 10 g / L, yeast extract 5 g / L, agar powder 15 g / L, kanamycin 50 μg / ml, and pH = 8.0.

[0102] 3) Single colony for testing

[0103] The recombinant strains obtained in step 2) were picked as single colonies and sequenced by Qiaseq. Ten plasmids of pBI121-promoter (pro1-pro10)-RnH2B-mCherry with correct sequences were obtained.

[0104] 4. Screening of endogenous constitutive promoters in floating moss

[0105] 1) The plasmids obtained in step 3) were genetically transformed into floating moss to obtain positive plants of the promoters pro3, pro4, pro7, pro9 and pro10. The DNA of different positive plants was extracted, and the primers mCherry-seqF: ATGGTGAGCAAGGGCGAGG (SEQ ID NO: 24) and mCherry-seqR: CATGGACGAGCTGTACAAGT (SEQ ID NO: 25) were designed to perform PCR identification on the mCherry gene of the positive plants, as shown in Figure 1 .

[0106] 2) The fluorescence intensity of the positive plants was statistically analyzed using the imageJ software to screen the strongest constitutive promoter, and the fluorescence intensity driven by the common constitutive promoters CaMV35s and UBQ10 was compared. The results are shown in Figure 2 A, and the fluorescence intensity of the screened promoter is higher than that of CaMV35S and UBQ10.

[0107] 3) The transformation efficiency of the positive plant strains of different promoters was compared, and the results are shown in Figure 2As shown in B, the pro7 promoter, a constitutive promoter of the floating algae, was screened out.

[0108] The transformation efficiency = total positive plants / total screened plants.

[0109] The method for genetic transformation of the floating algae is specifically:

[0110] 1) The thallus of the floating algae was crushed by mechanical homogenization, i.e. using a homogenizer at 24000 rpm for about 15 s to make the floating algae uniformly fragmented, and a 100 μm cell filter was used to filter the crushed floating algae fragments. 2) The explants were pre-cultured: the crushed floating algae fragments were inoculated on 1 / 2B5 medium for pre-culture for 5 d. 3) Agrobacterium containing the plasmid was obtained: 2 μl of the constructed plasmid was added to 100 μl of EHA105 Agrobacterium, and then placed on ice for 5 min, in liquid nitrogen for 5 min, and in a 37℃ water bath for 5 min, and then 200 μl of LB liquid medium was added, and the mixture was cultured in a 37℃, 220 rpm shaker for 2 h, and then the bacterial solution was spread on LB solid medium (rifampicin 100 mg / L + plasmid resistance kanamycin 50 μg / ml), and single colonies were picked and stored by shaking. 4) Agrobacterium was expanded and cultured: the stored Agrobacterium solution was added to 5 ml of LB liquid medium (rifampicin 100 mg / L + plasmid resistance kanamycin 50 μg / ml), and cultured in a 28℃, 220 rpm shaker; 1 ml of the turbid bacterial solution was expanded and cultured in 100 ml of LB liquid medium (rifampicin 100 mg / L + plasmid resistance kanamycin 50 μg / ml) at a ratio of 1:100, and cultured overnight at 28℃, 220 rpm for about 14 h; 5) Agrobacterium was activated: when the OD600 of the Agrobacterium reached 0.6-0.8, the Agrobacterium was activated by adding 0.1% acetosyringone to the medium, and the mixture was cultured for 2 h. 600After 2.0, aliquot into 50 ml centrifuge tube, centrifuge at 5000 rpm for 6 min, resuspend the pellet with 100 ml of Agrobacterium infection solution, and activate at 25 °C, 110 rpm for 30 min. 6) Infection and co-culture: immerse the thallus fragments in Agrobacterium infection solution for 2 h, filter out the thallus fragments with a cell filter after the infection is completed, and place them in co-culture medium for dark culture for 3 d to obtain co-cultured explants. 7) First screening culture: transfer the thallus fragments after co-culture to a screening medium containing antibiotics (1 / 2B5 medium 1.605 g / L, sucrose 10 g / L, agar 10 g / L, cefotaxime sodium 100 μg / ml, and an antibiotic selected according to the resistance gene of the introduced vector, such as hygromycin 10 μg / ml or kanamycin 50 μg / ml), and culture in a constant-temperature light incubator for 3-4 weeks. 8) Second screening culture: transfer the green tissues newly grown on the first screening medium to a new screening medium containing antibiotics (the composition of the screening medium containing antibiotics is the same as in step 7), and perform the second screening for 3-4 weeks.

[0111] Among them, after the first screening, small green thallus tissues with obvious small pieces of root-like structures on the thallus can be observed on the screening plate, and the thallus has many root-like structures. The appearance of root-like structures on the tissue fragments is considered to be a reliable indicator of the success of the transformation event.

[0112] Among them, the surviving and regenerated plants with transformed tissues are subjected to a second round of antibiotic selection to ensure that false positives are eliminated, and after the second screening, the plants are transferred to normal medium for rapid propagation to obtain positive plants.

[0113] Among them, the composition of 1 / 2B5 medium is: B5 medium powder Phytotechlab 1.605 g / L (1 / 2B5), sucrose 10 g / L, agar 10 g / L, and the pH is adjusted to 5.7.

[0114] Among them, the composition of LB solid medium is: tryptone 10 g / L, sodium chloride 10 g / L, yeast extract 5 g / L, agar powder 15 g / L, and pH=8.0.

[0115] Among them, the composition of LB liquid medium is: tryptone 10 g / L, sodium chloride 10 g / L, yeast extract 5 g / L, and pH=8.0.

[0116] Among them, the composition of Agrobacterium infection solution is: MS medium powder 2.215 g / L (1 / 2MS), sucrose 30 g / L, 100 μm acetosyringone, and pH=5.2.

[0117] The composition of the co-culture medium is: MS culture medium powder 2.215 g / L (1 / 2MS), sucrose 30 g / L, 100 μm acetyl-syringone, agar 10 g / L, pH = 5.7.

[0118] The normal culture medium for the rapid propagation is 1 / 2B5 medium.

[0119] 5. Fluorescence observation of the reporter gene plasmid driven by the pro7 promoter

[0120] Whether the fluorescence expression of pro7 is extensive is determined by observing the fluorescence expression sites of the scale cells of the leaf-like body of the positive plant obtained in step 4, that is, the oil body cells and the surrounding photosynthetic cells of the leaf-like body of the pBI121-pro7-RnH2B-mCherry positive strain are observed by using a fluorescence microscope, and whether the oil body cells, the teeth cells and the surrounding photosynthetic cells of the scale of the liverwort at different times have fluorescence is observed, and the results are shown in Figure 3 Figure 3 A indicates that the oil body, the surrounding photosynthetic cells and the cells in the leaf-like body of the positive strain all have nuclear fluorescence; Figure 3 B is the observation of nuclear fluorescence of the scale of the liverwort at different times, wherein P1, P2 and P3 are the development stages of the scale of the liverwort, P1 is the early development stage of the scale, P2 is the middle development stage of the scale, and P3 is the mature stage of the scale, and the scale at different development stages can be observed to have fluorescence; Figure 3 C The nuclear fluorescence of the oil body cells, the teeth cells and the surrounding photosynthetic cells of the scale of the liverwort at different times can be observed, that is, the fluorescence protein can be stably expressed in the leaf-like body, the scale and various cell types therebetween of the transgenic plant, and the pro7 promoter is a constitutive promoter of the liverwort itself which can stably express.

[0121] In this embodiment, the nucleotide sequence of the pro7 promoter is shown as SEQ ID NO: 1, the nucleotide sequence of the mCherry is shown as SEQ ID NO: 22, and the nucleotide sequence of the RnH2B is shown as SEQ ID NO: 23.

[0122] In the present application, the genetic sequence information is as follows:

[0123] > pro7 (SEQ ID NO: 1)

[0124] AATCCCCGAGAGGTTATCTTGATCACTCACTTAATAGATGTTTAGAAGCCGATAAAGCTAATTAGGGTACTTAGGAA

[0125] ​GGGATGGAGAAGAATTTGAGGAGTTTGTTTTAACGTCCATAAACTCAAGCTTTGAGACTAGGAGAGTGCCTAAAG

[0126] TGAGATTAGAAAGGTGGTTGCATGAGAGTGTTCACGCCTCTAGAAGCAATAAGATGTTAAAGTATGGATTCACATAT

[0127] GAAAGTCCTCATATCTCTATCAATAAAAATCTGTGTAGCTCACTTAAGAATAGTGTGAGCTTCTCCTATTAGTTAGGA

[0128] GATTATCCTTGTAGCAACGCCATGTAATACAAGTTTCTATAAACTCAAACACTAGTCCTTGTGGATTAGTGTTGGTAG

[0129] AAGAAAGATAAACCTAGTCTATGCTGGAGCAAAATCATTTTGACCAGAGGTTGACACATAGAGTTACATCCACGAT

[0130] GTATCCTTTTATCTTTTCATTTTCTTTTATTCTAACAATAAGTTTTTCTCATTATATTGATAATTAATGATTTTTTAAATA

[0131] AATTAAAGTTTAAAATCATAAAGGTTTTATGATAAAGGATCTATAATTGATTATTTTTATGATTAGGATAGTAACCAAA

[0132] AAAATTGAAACGATGGTCCAACTTCATATGTAACTGTGTCACCAACAGCAGCATCTCAAGTCACTCCTAGTGATTC

[0133] ATAGTAATGCAACATGAGAAGAAAGATGAGGTTCGCTTTCACTGATTCATAATAATGCAACAGAAGAAGAAACCTT

[0134] TTGTGCATCGTAAGATATAGAAGAGGACGCGTCCCTCGGAAATGTAACTATAACTATCACAACGGATTGAACGGAA

[0135] GTCACCCTTTCCGTCCAATCCGTTGTGAACCGTTGGGATCAATCCGTCGATAAGGAAAGTACCATCTCCAAAGCGC

[0136] TCAAGATGGTTACACCGTAAAATTCAGTTGACCTCACTGAGGTTGCGCTCCATATCACACGGTAAATTGTAGAGCT

[0137] CAGGGTAATAACTATACGTGAACTTCTCTTCGTTCAATCTCAGCGAAGAATGCACTAACAGCGTCCATGTCCTAATG

[0138] GCCTTCAATCTTCGTCACTCGAGCCGTGTACAAAATCTCTTTCGAGAGCAACTACGAGACGGCTTTGTGAAGACGT

[0139] ACGGGACACCTTCGTGCCATCTTATTAAGATACGGAGACACAAACACAGCAGTTATCTCCTATCTGGAGACCACCA

[0140] AATTCGACGACTTGTGGACAATGCGATTGTCTGTAGTTTCATGTCAGTGTTCTCGCATTCAGTACAAACTATGATGA

[0141] AAGCCGGTAGAGCGGGCCCTGTTCTGCAATTTCCCGATAGCTCAACCAAAACAGGATAATGTAATTGCCTTTACAC

[0142] CTAAAGCAACCGGCGCACAGGGAATGCTGCTTAGTCATAAGACCACTCCGCTCACACTGTTTGAATACCTCGAAGC

[0143] AGGGTTCCAACGAATTCCATGGACTTTAGATCGACGCTCAGGATTTAGATCGACGCTCAGGACAAGCAACTAATCA

[0144] GAAACTCCGTCCGAAACACAGCGGCGAAAATAGAAACTCGAGAAGAAATGCATTTTATGCACTGAGTCCGATGAC

[0145] GAACGTGAGCCAAATCCCAGCGCCTGGAAGCTTCACATAATACGGCGCAGTTTGCCTGTCAAAACTTGGGCCCAC

[0146] ATTTGATTTGGTAGTTCTCAAGTTGCTCAAGGCATTCATGTTAGTGTAAAACCATTCCACGGTCTGACAAAGTAGAA

[0147] CAACGGTTTTTCCCCTTAATCTATGTCACCTTTACAGGTTCCTGAAATTATTCTTGTATGGAATGGTTCTTGTATGAAA

[0148] TAAGTAAGTCTGAAAACGTATCTCACCCATAACCTAGATCGGACGGCAAGAAAGCCCTACATCACGCATCAGACGC

[0149] GAGAGCTCCCGGAAAGAAGTTTTAGGGTTTTCTATTAGAAGCGGAATTGGAGAAAACTTAGTCCTTTCTCAGTGTC

[0150] GCGGTAGGCCGCGAGCCAAGCAACGAAGGAACGAGTCTGGAGCATTGGAATCGCCTGCCTAAGCAAATTTGCGCA

[0151] TTGAGAGTCCTACAAG

[0152] >mCherry (SEQ ID NO: 22):

[0153] ATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGC

[0154] TCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAA

[0155] GCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAA

[0156] GGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCG

[0157] CGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTA

[0158] CAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGG

[0159] CCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGAC

[0160] GGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAA

[0161] CGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGG

[0162] CCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGT

[0163] >RnH2B (SEQ ID NO: 23):

[0164] ATGGCGCCCAAGGCAGCAGTCGACGCTGAGAACAAGGCCGGGAAGGGGAAGGGAGAGAAGAAGCCCCGAGGA

[0165] AGACCGAAGGCCGAGAAGAAGCCGGCGAAGGAAGGTGGTGCGAAGGAAGGATCGACGAAGAAGAAGAAGGCC

[0166] AAGAGAGGAATCGAGACCTACAAGATCTACATTTACAAGGTGTTGAAGCAAGTTCATCCCGAGTTTGGAATTTCGT

[0167] CTAAGGCGATGGGAATTATGAACTCGTTCATAAACGACATTTTCGAGAAATTGGCGCAAGAGGCCGCGAGACTGG

[0168] CCCGGTACAACAAGAAACCCACGATCGCTTCTCGAGAGATCCAAACGGCGGTGAGGCTAATTTTGCCTGGCGAGC

[0169] TTGCCAAGCATGCTGTATCTGAGGGAACCAAAGCAGTGACGAAATTCACAAGCGCT

[0170] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used in the description of the application herein is for describing particular embodiments only and is not intended to be limiting of the application.

[0171] As used in this application, the terms "comprises," "comprising," "includes," "including," "has," "having" or any other variation thereof, are intended to cover a non-exclusive inclusion. For example, a process, method, article, or apparatus that comprises a list of elements is not necessarily limited to only those elements but can include other elements not expressly listed or inherent to such process, method, article, or apparatus.

[0172] As used herein, the term "and / or," includes any and all combinations of one or more of the associated listed items.

[0173] As used herein, the term "about" when applied to a value indicates that slight deviations from the exact value are acceptable (approximate or reasonably close to the value; nearly). If for some reason the inexactness indicated by "about" is not understood in the art, then "about" as used herein means at least the variability that would be expected by measurement or by use of conventional methods to measure such parameters.

[0174] The above merely describes the preferred embodiments of the present application, and it should be pointed out that the above preferred embodiments should not be regarded as a limitation to the present application, and the protection scope of the present application should be defined by the scope of the claims. For those skilled in the art, several improvements and refinements can be made without departing from the spirit and scope of the present application, and these improvements and refinements should also be regarded as the protection scope of the present application.

Claims

1. A method for screening endogenous constitutive promoters in algae, characterized in that, The screening method includes the following steps: The first step is to use existing moss transcriptome data to screen for genes that are highly expressed in moss itself, and then use the liverwort database to predict the function of these genes and screen out housekeeping genes among them. The second step involves selecting the housekeeping gene identified in the first step, choosing the first 1800bp to 2200bp sequence of the housekeeping gene as a candidate constitutive promoter sequence for endogenous algae, constructing a plasmid, and obtaining positive plants through genetic transformation. The third step is to screen out the constitutive promoters endogenous to the floating moss, and to screen out the preferred constitutive promoters endogenous to the floating moss by statistically analyzing the fluorescence intensity and transformation efficiency of the positive plants obtained in the second step. Fourth, the positive plants that have been transferred to the constitutive promoters of the preferred endogenous algae selected in the third step are subjected to fluorescence observation to see if their fluorescence can be widely expressed. Fifth, through fluorescence observation in the fourth step, it was found that the constitutive promoters of the preferred endogenous algae selected in the third step could be stably expressed in organelles and / or cells.

2. The screening method as described in claim 1, characterized in that, In the first step, the genes highly expressed by the algae are the top 100 genes highly expressed by the algae; and / or, Ten steward genes were selected through comprehensive screening.

3. The screening method as described in claim 2, characterized in that, The 10 housekeeping genes include Rn2g2147, Rn3g1583, Rn3g0156, Rn5g0254, Rn5g1218, Rn8g1343, Rn7g1365, Rn7g1354, Rn1g0213, and Rn4g0193.

4. The screening method as described in claim 1, characterized in that, In the second step, the candidate endogenous constitutive promoters of algae include one or more of the following promoters: pro1, pro2, pro3, pro4, pro5, pro6, pro7, pro8, pro9, and pro10; and / or, The plasmid includes the PBI121-promoter-RnH2B-mCherry plasmid; wherein the PBI121-promoter-RnH2B-mCherry plasmid is based on pBI121, and contains the promoter as the algae self-promoter, the mCherry as a reporter gene, and the RnH2B as the algae nuclear localization gene B; and / or, The genetic transformation method includes: 1) crushing of floating moss thallus, 2) pre-culture of explants, 3) obtaining Agrobacterium plasmids, 4) amplification culture of Agrobacterium, 5) activation of Agrobacterium, 6) infection and co-culture, 7) first screening culture, and 8) second screening culture.

5. The screening method as described in claim 4, characterized in that, The promoter is a pro promoter, which includes one or more of the following promoters: pro1, pro2, pro3, pro4, pro5, pro6, pro7, pro8, pro9, and pro10.

6. The screening method as described in claim 1, characterized in that, In the third step, the preferred constitutive promoter includes the pro7 promoter; and / or, The conversion efficiency = total number of positive plants / total number of screened plants.

7. The screening method as described in claim 1, characterized in that, In the fourth step, the organelles and / or cells are different types of organelles and / or cells, including thallus, scales and / or multiple different types of cells of thallus and / or scales.

8. The substance described in any one of the following claims, characterized in that, The substance includes: (1) A promoter comprising a constitutive promoter endogenously derived from algae; (2) A nucleotide comprising mCherry; (3) A nucleotide, said nucleotide comprising RnH2B; (4) A recombinant vector comprising one or more of the promoter as described in (1) or the nucleotides as described in any one of (2)-(4); (5) A host cell comprising one or more of the promoter as described in (1), or the nucleotide as described in any one of (2)-(4), or the recombinant vector as described in (5); (6) A primer comprising one or more of the following: pro1g519-F, pro1g519-R, pro2g1666-F, pro2g1666-R, pro3g8803-F, pro3g8803-R, pro4g6822-F, pro4g6822-R, pro5g7759-F, pro5g7759-R, pro6g3427-F, pro6g3427-R, pro7g5337-F, pro7g5337-R, pro8g5348-F, pro8g5348-R, pro9g11098-F, pro9g11098-R, pro10g17634-F, and pro10g17634-R; (7) A primer pair, said primer pair comprising one or more of the following: pro1g519-F / pro1g519-R, pro2g1666-F / pro2g1666-R, pro3g8803-F / pro3g8803-R, pro4g6822-F / pro4g6822-R, pro5g7759-F / pro5g7759-R, pro6g3427-F / pro6g3427-R, pro7g5337-F / pro7g5337-R, pro8g5348-F / pro8g5348-R, pro9g11098-F / pro9g11098-R, and pro10g17634-F / pro10g17634-R; (8) A plasmid comprising one or more of pBI121-pro1-RnH2B-mCherry, pBI121-pro2-RnH2B-mCherry, pBI121-pro3-RnH2B-mCherry, pBI121-pro4-RnH2B-mCherry, pBI121-pro5-RnH2B-mCherry, pBI121-pro6-RnH2B-mCherry, pBI121-pro7-RnH2B-mCherry, pBI121-pro8-RnH2B-mCherry, pBI121-pro9-RnH2B-mCherry, and pBI121-pro10-RnH2B-mCherry.

9. The screening method as described in any one of claims 1-7, or the substance as described in claim 8, in gene editing, gene function research, genetic transformation, construction of a subcellular fluorescence localization system for moss, establishment and optimization of a moss gene editing system, a stable and efficient moss CRISPR / Cas9 gene editing system, and the construction of a sound moss genetic manipulation system.

10. The screening method, substance, or application as described in any one of claims 1-9, characterized in that, The constitutive promoter of the endogenous algae is a pro promoter, which includes one or more of the following promoters: pro1, pro2, pro3, pro4, pro5, pro6, pro7, pro8, pro9, and pro10; and / or, The nucleotide sequence of the pro7 promoter includes one of the following sequences: (a) The nucleotide sequence shown in SEQ ID NO: 1; (b) A nucleotide sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 1; (c) A nucleic acid sequence with the same function as the nucleotide sequence shown in SEQ ID NO: 1, formed by replacing, deleting or adding one or more nucleic acid bases; (d) A nucleotide sequence that hybridizes under stringent conditions to the nucleotide sequence defined in (a), (b), or (c), or its full-length complement; or, (e) Nucleotide sequences that differ from the nucleotide sequences defined in (a), (b), (c), and (d) due to the degeneracy of the genetic codon; and / or, The nucleotides of pro1g519-F, pro1g519-R, pro2g1666-F, pro2g1666-R, pro3g8803-F, pro3g8803-R, pro4g6822-F, pro4g6822-R, pro5g7759-F, pro5g7759-R, pro6g3427-F, pro6g3427-R, pro7g5337-F, pro7g5337-R, pro8g5348-F, pro8g5348-R, pro9g11098-F, pro9g11098-R, pro10g17634-F, and pro10g17634-R each include one of the following sequences: (a) Nucleotide sequences as shown in SEQ ID NO: 2-21; (b) A nucleotide sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the nucleotide sequence defined in (a); (c) Nucleic acid sequences with equivalent functions formed by substitution, deletion or addition of one or more nucleic acid bases in the nucleotide sequences defined in (a); (d) A nucleotide sequence that hybridizes under stringent conditions to the nucleotide sequence defined in (a), (b), or (c), or its full-length complement; or, (e) Nucleotide sequences that differ from the nucleotide sequences defined in (a), (b), (c), and (d) due to the degeneracy of the genetic codon; and / or, The nucleotide sequence of the mCherry includes one of the following sequences: (a) A nucleotide sequence as shown in SEQ ID NO: 22; (b) A nucleotide sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 22; (c) A nucleic acid sequence with the same function as the nucleotide sequence shown in SEQ ID NO: 22, formed by substitution, deletion or addition of one or more nucleic acid bases; (d) A nucleotide sequence that hybridizes under stringent conditions to the nucleotide sequence defined in (a), (b), or (c), or its full-length complement; or, (e) Nucleotide sequences that differ from the nucleotide sequences defined in (a), (b), (c), and (d) due to the degeneracy of the genetic codon; and / or, The nucleotide sequence of the RnH2B includes one of the following sequences: (a) A nucleotide sequence as shown in SEQ ID NO: 23; (b) A nucleotide sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 23; (c) A nucleic acid sequence with the same function as the nucleotide sequence shown in SEQ ID NO: 23, formed by substitution, deletion or addition of one or more nucleic acid bases; (d) A nucleotide sequence that hybridizes under stringent conditions to the nucleotide sequence defined in (a), (b), or (c), or its full-length complement; or, (e) A nucleotide sequence that is distinct from the nucleotide sequences defined by (a), (b), (c), and (d) due to the degeneracy of the genetic codon.

Images