Application of apolipoprotein ApApoD2 in regulation and control of pea aphid lipid synthesis

Abstract

The invention relates to application of apolipoprotein ApApoD2 in regulation and control of pea aphid lipid synthesis, the research finds that the ApApoD2 is specifically expressed in the epidermis of pea aphid, and after the ApApoD2 gene is effectively silenced by injecting the dsRNA of the ApApoD2, the epidermis lipid coating of the ApApoD2 gene is obviously reduced, the drying tolerance of the ApApoD2 gene is obviously reduced, and the apolipoprotein ApApoD2 can be applied to regulation and control of pea aphid lipid synthesis. By combining transcriptome and non-targeted metabolome analysis, it is found that the ApApoD2 gene regulates horny layer lipid synthesis of the pea aphid and accumulation of various nutrient substances, and the apApoD2 gene is very important for maintaining the lipid homeostasis of the body wall. By inhibiting the expression of the ApApoD2 gene, the lipid synthesis of the pea aphid can be effectively inhibited, so that the drying tolerance of the pea aphid is remarkably reduced, and a new thought and a new method are provided for green prevention and treatment of the pea aphid.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the application of apolipoprotein ApApoD2 in regulating lipid synthesis in pea aphids. Background Technology

[0002] Insects rely on a specialized epidermal lipid barrier as their first line of defense against external environmental stresses such as dryness and pathogen invasion. This barrier is mainly composed of lipids, such as epidermal hydrocarbons, and its integrity depends on the synthesis, transport, and deposition of lipids, indicating that the lipid transport system is crucial for insect water balance.

[0003] Apolipoprotein D (ApoD) is a small lipid-binding protein (a member of the lipid transporter superfamily) that binds small hydrophobic ligands within its β-barrel pocket. Initially discovered in human plasma HDL, ApoD has since been found to play a wide range of roles in lipid metabolism and stress resistance across various species. In Drosophila melanogaster, two paralogs of ApoD, Glial Lazarillo (GLaz) and Neural Lazarillo (NLaz), have distinct but overlapping functions. GLaz is primarily expressed in glial cells and protects against oxidative damage; loss-of-function GLaz mutants exhibit reduced resistance to oxidative stress, shortened lifespan, and accelerated neurodegenerative changes (Sanchez et al. 2006). NLaz is secreted by neurons, induced by stress signals, and is essential for stress-induced metabolic adaptation. NLaz deficiency leads to decreased stress tolerance and shortened lifespan, while overexpression of NLaz prolongs lifespan and improves survival under oxidative or starvation conditions (Hull-Thompson et al., 2009). Therefore, both GLaz and NLaz contribute to the longevity and stress recovery of fruit flies. Besides fruit flies, other insects also exhibit similar responses in their ApoD-like genes. In the silkworm (Bombyx mori), BmApoD1 is significantly upregulated under oxidative and nutritional stress, and the recombinant protein can protect cells from peroxide-induced oxidative damage and apoptosis (Zhou et al., 2018, 2020). A second silkworm homolog, BmApoD2, plays a crucial role in wing lipid metabolism, suggesting a tissue-specific function in lipid homeostasis (Jia et al., 2024). The brown planthopper (Nilaparvata lugens) genome even encodes 10 ApoD-related proteins, and functional studies have shown they have non-redundant roles—for example, one ApoD (NlApoD2) is essential for survival, while another affects reproduction or stress response (Lu et al., 2024). These studies demonstrate that insect ApoD proteins play multiple key roles in vivo.

[0004] The pea aphid (Acyrthosiphon pisum) is a globally prevalent pest of legumes, causing significant yield losses by sucking sap and spreading plant viruses (Wang & Blanc 2021). However, over-reliance on chemical pesticides to control pea aphids has led to increasing resistance among aphid populations, causing serious environmental and food safety issues. Pea aphids rely on a waxy hydrocarbon layer on their epidermis to prevent drying; disrupting this protective lipid barrier can impair their survival. Researching the lipid barrier biosynthetic pathways in pea aphids and developing green methods for aphid control is crucial for achieving environmentally sustainable aphid pest control. Summary of the Invention

[0005] This invention discovered the specific expression of ApApoD2 in the epidermis of the pea aphid. Effective silencing of the ApApoD2 gene by injecting ApApoD2 dsRNA resulted in a significant reduction in the lipid coating of the aphid epidermis and a significant decrease in dryness tolerance. Further analysis using transcriptomics (RNA-seq) and non-targeted metabolomics (LC-MS) comprehensively assessed the molecular changes caused by ApApoD2 deficiency. The results showed that in aphids with ApApoD2 silence, genes involved in cuticle lipid biosynthesis were widely downregulated, while genes related to stress response pathways were upregulated. Metabolomics analysis revealed a decrease in cuticle lipids and an increase in the accumulation of polar osmotic protectants (such as trehalose), indicating that the ApApoD2 gene can regulate cuticle lipid synthesis and the accumulation of various nutrients in pea aphids, which is crucial for maintaining body wall lipid homeostasis. Inhibiting ApApoD2 gene expression can effectively suppress lipid synthesis in pea aphids, thereby significantly reducing their dryness tolerance, providing a new approach and method for the green control of pea aphids.

[0006] This invention provides the application of ApApoD2 in regulating lipid synthesis in pea aphids, wherein the amino acid sequence of ApApoD2 is shown in SEQ ID NO:3.

[0007] Furthermore, the nucleotide sequence encoding ApApoD2 is shown in SEQ ID NO:2.

[0008] Furthermore, ApApoD2 regulates lipid synthesis in pea aphids by downregulating the expression of epidermal proteins cp10, LOC100164113 and LOC100572470 and / or cuticle protein LOC100159024.

[0009] Furthermore, ApApoD2 regulates lipid synthesis in pea aphids by promoting the accumulation of myristoyl lysophosphatidylethanolamine, a lipid metabolite, and inhibiting the accumulation of tetradecanoic acid, hexadecanoic acid, (-)-trans-caryophyllene, and / or γ-ylangolene.

[0010] The present invention also provides a method for controlling pea aphids, comprising: inhibiting the expression of the ApApoD2 gene of pea aphids or reducing the function or activity of its protein, inhibiting lipid synthesis of pea aphids, thereby achieving the purpose of controlling pea aphids, wherein the amino acid sequence of ApApoD2 is shown in SEQ ID NO:3.

[0011] Furthermore, the expression of the ApApoD2 gene in the pea aphid or the function or activity of its protein can be reduced through one or more of the following methods: gene knockout, gene silencing, gene mutation, and / or introduction of substances that inhibit the expression level of the ApApoD2 gene.

[0012] Furthermore, the substance that inhibits the expression level of the ApApoD2 gene is dsRNA or a DNA molecule encoding the dsRNA or an expression cassette, recombinant vector, recombinant bacteria or transgenic cell line containing the DNA molecule, wherein the dsRNA sequence is a double-stranded RNA composed of the nucleotides shown in SEQ ID NO:4 and the nucleotides shown in their reverse complementary sequences.

[0013] The present invention also provides a dsRNA or a DNA molecule encoding the dsRNA or an expression cassette, recombinant vector, recombinant bacteria or transgenic cell line containing the DNA molecule, wherein the dsRNA sequence is a double-stranded RNA composed of the nucleotides shown in SEQ ID NO:4 and the nucleotides shown in their reverse complementary sequences.

[0014] The present invention also provides the use of the above-mentioned dsRNA or DNA molecule encoding said dsRNA or expression cassette, recombinant vector, recombinant bacteria or transgenic cell line containing said DNA molecule in any of the following: a1) Control of pea aphids; a2) Prepare products for controlling pea aphids; a3) Inhibits lipid synthesis in pea aphids; a4) Prepare products that inhibit lipid synthesis in pea aphids; a5) Inhibit ApApoD2 gene expression; a6) Prepare products that inhibit ApApoD2 gene expression; a7) is an inhibitor of the ApApoD2 gene.

[0015] Beneficial Effects: This invention discovered the specific expression of ApApoD2 in the epidermis of the pea aphid. Effective silencing of the ApApoD2 gene by injecting ApApoD2 dsRNA resulted in a significant reduction in the epidermal lipid coating and a marked decrease in tolerance to dryness. Transcriptomic analysis (RNA-seq) and non-targeted metabolomic analysis (LC-MS) were used to comprehensively assess the molecular changes caused by ApApoD2 deficiency. The results showed that in aphids with ApApoD2 silence, genes involved in cuticle lipid biosynthesis were widely downregulated, while genes related to stress response pathways were upregulated. Metabolomics analysis revealed a decrease in cuticle lipids and an increase in the accumulation of polar osmotic protectants (such as trehalose), indicating that the ApApoD2 gene can regulate cuticle lipid synthesis and the accumulation of various nutrients in pea aphids, which is crucial for maintaining body wall lipid homeostasis. Inhibiting the expression of the ApApoD2 gene can effectively suppress lipid synthesis in pea aphids, thereby significantly reducing their dryness tolerance, providing a new target for the green control of pea aphids and showing broad application prospects. Attached Figure Description

[0016] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1 The localization and transcript analysis of ApApoD2 in this embodiment of the invention are as follows: Figure A shows the localization of ApApoD2 in the epidermal cells of pea aphids by fluorescence in situ hybridization; Figure B shows the ApApoD2 transcript levels in the silent group and the control group aphids measured by qRT-PCR.

[0018] Figure 2 Transcriptome analysis of ApApoD2 RNAi silencing and control aphids in this embodiment of the invention: Figure A shows principal component analysis (PCA) of whole genome gene expression profiles (RNA-seq; 3 replicates per treatment); Figure B shows a volcano plot of differentially expressed genes (DEGs) between ApApoD2-silenced aphids and control aphids; Figure C shows the gene ontology (GO) enrichment analysis of DEGs, with a bubble plot showing the GO entries enriched by genes altered by ApApoD2 silencing (y-axis), the bubble size corresponding to the number of DEGs associated with each GO entry, and the x-axis representing the enrichment factor (the ratio of the number of observed DEGs to the total number of genes in that GO category).

[0019] Figure 3Metabolomics analysis (non-targeted LC-MS) of ApApoD2 silencing and control aphids in this embodiment of the invention: Figure A shows principal component analysis (PCA) of the metabolite profiles (8 biological replicates per group), with ellipses representing the 95% confidence intervals for each group; Figure B is a volcano plot of differentially accumulated metabolites (DAMs) between the ApApoD2 silencing group and the control group; Figure C is a KEGG pathway enrichment analysis of metabolites affected by ApApoD2 silencing. The bubble plot shows the pathways enriched by the significantly changed metabolite sets (y-axis). Bubble size represents the number of changed metabolites mapped to each pathway, and bubble color represents the significance of enrichment.

[0020] Figure 4 The integrated transcriptome-metabolome analysis of the ApApoD2 silencing effect in this embodiment of the invention is visualized using a nine-quadrant plot. This scatter plot compares the log2 fold changes in transcript abundance (x-axis, RNA-seq) and metabolite abundance (y-axis, LC–MS) between ApApoD2 dsRNA-treated aphids and the control group.

[0021] Figure 5 This is the functional enrichment of integrated response categories in the nine-quadrant analysis of this invention: Figure A shows the gene ontology (GO) enrichment of selected transcript-metabolite response sectors, and the bubble chart shows the corresponding functional enrichment. Figure 4 Figure A shows the GO entries significantly enriched in a specific sector of the nine-quadrant diagram (y-axis); Figure B shows the KEGG pathway enrichment for the corresponding integrated response category. Similar to Figure A, this bubble plot shows the KEGG pathways enriched in the gene / metabolite sets in sections 1, 2, 4, 6, and 8 (x-axis labels) (y-axis). The bubble area represents the number of ApApoD2 response features (genes and / or metabolites) mapped to each pathway, and the color represents the significance of enrichment.

[0022] Figure 6 The O2PLS integration analysis and related pathway enrichment of transcriptomic and metabolomic changes in this embodiment of the invention are as follows: Figure A is a joint load plot from bidirectional orthogonal partial least squares (O2PLS) analysis, which captures shared variations between gene expression and metabolite profiles. The left figure shows the transcript joint load of the first two O2PLS joint components, and the right figure shows the metabolite joint load. Figure B shows the KEGG pathway enrichment of key transcripts and metabolites identified by O2PLS. The bubble plot lists the pathways significantly enriched in the high-load gene / metabolite combination set (y-axis). The bubble size corresponds to the number of ApApoD2 response features (genes or metabolites) associated with each pathway, and the bubble color reflects the significance of enrichment.

[0023] Figure 7The WGCNA co-expression network analysis and module functional enrichment of aphid transcripts under ApApoD2 silencing and control conditions in this embodiment of the invention are as follows: Figure A is a gene clustering dendrogram of weighted gene co-expression network analysis (WGCNA), where genes are clustered according to expression similarity; dynamic tree cutting is used to cut branches into discrete modules, and each module (co-expressed gene cluster) is assigned a color (horizontal color bar below the dendrogram) – a total of seven modules were identified (cyan, blue, brown, yellow, green, red, and black), and genes not assigned to any module are marked in gray; Figure B is a module-trait correlation heatmap, showing the relationship between each module and the ApApoD2 silencing phenotype, with rows corresponding to module characteristic genes (the first principal component expressed in each module) and columns corresponding to treatments (ApApoD2 silencing vs. control). Muslta control); Figure C is a network heatmap showing the topological overlap matrix (TOM) between genes, sorted according to the module tree diagram in A; Figure D shows the KEGG pathway enrichment of genes in the cyan module (most severely suppressed by ApApoD2 silencing, related to lipid and metabolic functions), and the bubble diagram shows the enriched pathways (y-axis) in the cyan module gene list. The bubble area represents the number of cyan module genes annotated to each pathway, and the color represents the significance of enrichment.

[0024] Figure 8 This is a scanning electron microscope (SEM) image showing the results of observing the abdominal epidermis of aphids after injecting dsRNA in an embodiment of the present invention. Detailed Implementation

[0025] The following embodiments are only used to more clearly illustrate the technical solutions of the present invention, and are therefore merely examples and should not be used to limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning understood by those skilled in the art. Unless specifically stated, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field. Unless specifically stated, the reagents and materials used in the following embodiments are commercially available.

[0026] Example 1: ApApoD2 gene localization and RNAi treatment in pea aphids The pea aphids (A. pisum) used in this study were collected from Gansu Province, China, and reared on broad bean (Vicia faba L.) seedlings under controlled laboratory conditions (18°C, 16:8 light-dark cycle, 70% relative humidity). The aphid population was maintained for multiple generations on healthy host plants to provide a stable source of experimental insects.

[0027] The mRNA sequence of the ApApoD2 gene of the pea aphid is shown in SEQ ID NO:1, the CDS sequence is shown in SEQ ID NO:2, and the encoded protein sequence is shown in SEQ ID NO:3.

[0028] (1) Fluorescence in situ hybridization (FISH) To detect the tissue localization of ApApoD2 mRNA in aphids, digoxigenin (DIG)-labeled RNA probes were prepared for fluorescence in situ hybridization. The specific sequence (45 nt) of the ApApoD2 gene transcript from the pea aphid was used as the target for probe design (probe sequence: 5'-CGGCCTGGTAGTTGAGTACAGATTTGCTTTTCGATACAAAGGGTCG-3'). A non-specific, out-of-order probe (5′-UUGUACUACACAAAAGUACUG-3′) was synthesized as a negative control. Using a DIG RNA labeling kit (Roche, Mannheim, Germany), digoxigenin-UTP was incorporated into the probe via in vitro transcription to obtain the DIG-labeled RNA fragment.

[0029] For FISH sample preparation, the abdomen of an adult female aphid was taken and immediately fixed at room temperature for 3 hours with 4% paraformaldehyde (prepared with PBS). After dehydration with graded ethanol (30%–100%), the sample was embedded in paraffin. 5 μm thick serial sections were prepared using a microtome and attached to poly-L-lysine-coated slides. After dewaxing and hydration, proteins were digested with proteinase K (10 μg / mL, 37°C for 15 minutes) to enhance probe permeability.

[0030] The slides were placed in prehybridization buffer (50% formamide, 5×SSC, 50 μg / mL heparin, 0.1% Tween-20, 0.1 mg / mL salmon sperm DNA) and incubated at 60°C for 1 hour to block non-specific sites. 100 μL of hybridization buffer containing DIG-labeled probes was added to each slide, covered with a coverslip, and incubated overnight at 60°C in a humidified chamber. After hybridization, high-strength elution was performed sequentially with 2×SSC (60°C) and 0.5×SSC (60°C) to remove unbound probes. For probe signal detection, HRP-labeled mouse anti-DIG monoclonal antibody was added and incubated overnight at 4°C. Cy3-tyramine working solution was then added, and the reaction was carried out in the dark for 10-30 minutes. The fluorescence signal was amplified using the TSA method. The enzyme reaction was then stopped by immersing a slide in 2x SSC. Cell nuclei were counterstained with DAPI for 5 minutes, and the slides were mounted with anti-quenching mounting medium. The fluorescence signal was observed using a laser confocal microscope; the Cy3 signal (red) indicated ApApoD2 mRNA localization, and DAPI (blue) labeled the cell nucleus. The signal specificity was verified using a disordered probe group as a control.

[0031] like Figure 1 As shown in Figure A, fluorescence in situ hybridization (FISH) analysis revealed that ApApoD2 mRNA was specifically expressed in the epidermal cells of the pea aphid. Analysis of abdominal cross sections showed that the antisense probe targeting ApApoD2 produced a strong red fluorescent signal in the epidermal cell layer (below the cuticle), while the control section using a nonsense probe (non-targeted) showed only negligible background signal. DAPI nuclear staining clearly indicated the location of the cell nuclei. The merged images confirmed that ApApoD2 mRNA was primarily localized in epidermal cells, and this expression pattern is consistent with its hypothetical role in cuticle-related functions such as lipid transport or stability maintenance, which are crucial for maintaining the insect's water resistance and desiccation tolerance.

[0032] (2) ApApoD2 gene RNAi treatment and qRT-PCR verification To induce RNAi of the ApApoD2 gene, a 300 bp fragment of the ApApoD2 coding sequence was amplified by PCR and cloned into a plasmid containing the T7 promoter for in vitro transcription. A double-stranded RNA targeting ApApoD2 (dsApApoD2) was synthesized in vitro using the T7 RiboMAX™ Express RNAi system (Promega). A 193 bp fragment of mouse lymphotoxin-α (GenBank XM_006536550.2) was used as a negative control to synthesize dsMuslta, a sequence that showed no homology to the aphid gene.

[0033] The dsApApoD2 sequence is specifically: ccccgatggaacgtcatacaaagtacatattggaacgaaaaatagaataacgggaaacccgaatatattttccggaatggcgacccttgtatcgaaaagcaaatctgtactcaactaccaggccgaaagtcgactacccggtt tgttttcacgcatgatacctaccactggtctgtattacatcatgtacacggattaccacaactatacaattctgtggtcttgtacaagttttggtcttttccacacagatattatttggattttgggaagagaacgagatctcacggcgacatctcg (seq ID NO:4) Third-instar aphid nymphs were fixed on ice, and approximately 202.4 nL of dsRNA solution was injected using a fine glass capillary needle and a microsyringe. In the RNAi treatment group, each aphid was injected with 202.4 nL of dsApApoD2 (6 µg / µL concentration, 1.21 µg dsRNA per aphid). Control aphids were injected with an equal volume of control dsMuslta solution. After injection, the aphids were gently transferred back to broad bean seedlings and recovered under the same rearing conditions as described above. Aphid survival and behavior were monitored, and surviving individuals were collected three days after injection for downstream analysis.

[0034] Quantitative RT-PCR (qRT-PCR): Aphid samples were collected 3 days after injection. Three aphids were randomly selected from each group as one biological replicate, with 5 replicates. Total RNA was extracted using RNAiso Plus reagent (TaKaRa), and genomic DNA contamination was removed by DNase I digestion. RNA concentration and purity were assessed using a NanoDrop One spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). 800 ng of total RNA was reverse transcribed into cDNA using the PrimeScript RT kit (TaKaRa). Using cDNA as a template, amplification was performed on a real-time quantitative PCR instrument using the SYBR Green method (TB Green Premix Ex Taq kit). Three technical replicates were performed for each sample. Using the ApApoD2 transcript as the target, 2... –ΔΔCt The relative expression level of ApApoD2 in aphids injected with dsApApoD2 was calculated relative to that in aphids injected with control dsRNA. The silencing efficiency was expressed as the percentage reduction in mRNA levels in the treatment group compared to the control group.

[0035] like Figure 1 As shown in Figure -B, quantitative RT-PCR results revealed that, compared with aphids injected with control dsRNA, aphids injected with ApApoD2 dsRNA exhibited significantly reduced ApApoD2 transcription levels, with a silencing efficiency of approximately 65.4%. This indicates that the subsequent observed phenotypic and molecular changes can be attributed to the loss of ApApoD2 function.

[0036] On the third day after dsRNA injection, scanning electron microscopy (SEM) was performed on the abdominal epidermis of aphids. The results showed that, compared with the control group, aphids with lost ApApoD2 function had a significantly reduced epidermal lipid coating, significantly decreased tolerance to desiccation, and a significantly lower survival rate over time. Figure 8 Further combined transcriptomic analysis (RNA-seq) and non-targeted metabolomic analysis (LC-MS) to comprehensively assess the molecular changes induced by ApApoD2 loss.

[0037] Example 2: Analysis of the functional network of the ApApoD2 gene based on transcriptomics and metabolomics. (1) RNA-seq and differential expression analysis RNA-seq sample processing: ApApoD2 silencing and control aphid groups were collected three days after dsRNA injection, with three biological replicates per group (20–30 aphids per replicate). After flash freezing in liquid nitrogen, total RNA was extracted using RNAiso Plus reagent, and purity and integrity were tested using NanoDrop™ One and Agilent 2100 Bioanalyzer. Libraries were constructed using the Illumina TruSeq Stranded mRNA library construction kit. mRNA was enriched and fragmented using polyA, and double-stranded cDNA was synthesized and ligated with index adapters. After PCR amplification, appropriate insert fragments (300 bp) were selected and sent to Wuhan Metawell Biotechnology Co., Ltd. for sequencing. Paired-end sequencing (2 x 150 bp reads) was performed on the Illumina NovaSeq 6000 platform, yielding tens of millions of high-quality reads per sample to comprehensively cover the transcriptome.

[0038] The raw sequencing data underwent quality control and filtering. FastP (v0.19.3) was used to prune adapter sequences and low-quality bases, removing sequences shorter than 50 bp and low-quality reads (Q<20). The splice-sensing aligner HISAT2 (v2.2.1) was used to align clean reads with the pea aphid reference genome (International Aphid Genomics Consortium assembly). The featureCounts tool was used to calculate gene expression counts, which were then normalized to FPKM values. DESeq2 (v1.38.0) was used to analyze differential gene expression between ApApoD2-silenced and control aphids, identifying genes with a corrected p-value (FDR) <0.05 as differentially expressed genes (DEGs). The magnitude of differential expression was also considered; for ease of description, the fold change in expression of each gene from the silencing group to the control group was calculated. DESeq2 analysis results were used to generate MA plots (log2 fold change versus mean abundance) and volcano plots (-log10 p-value versus log2 fold change) to visualize the distribution of gene expression changes. These analyses effectively identified transcripts that were significantly upregulated and downregulated after ApApoD2 silencing. All sequence data processing and analysis scripts were run in the R environment (v4.2) to ensure the reproducibility of the RNA-seq analysis workflow. Pearson correlation analysis showed that the correlation coefficients between biological replicates within the group were all greater than 0.95, indicating good data reproducibility.

[0039] like Figure 2 As shown, principal component analysis (PCA) of the whole genome gene expression profile revealed a clear separation between the dsApApoD2 treatment group and the control group. The three biological repeats of dsApApoD2 were tightly clustered and clearly separated from the three dsMuslta control samples, demonstrating that ApApoD2 silencing induced global transcriptome remodeling. Figure 2 -A). Differential expression analysis identified a large number of genes significantly altered by ApApoD2 silencing. Volcano plots revealed hundreds of differentially expressed genes (DEGs) between silencing and control conditions. A large number of transcripts were upregulated after ApApoD2 silencing, while another large group was downregulated, indicating that ApApoD2 deletion triggered activation and repression of different gene sets. Many DEGs showed high-amplitude changes (typically >2-fold) and strong statistical significance, reflecting the significant impact of ApApoD2 on multiple genetic pathways. Figure 2 -B). A total of 133 genes showed significant expression changes, with 92 downregulated and 41 upregulated in ApApoD2-silenced aphids. Gene ontology enrichment analysis of these DEGs revealed functional overrepresentation associated with membrane components, extracellular regions, defense responses, phagocytosis, cysteine-type peptidase activity, and neural injury responses. Figure 2 Specifically, the expression of epidermal proteins (cp10, LOC100164113, and LOC100572470) and keratin (LOC100159024) was significantly downregulated. These results indicate that ApApoD2 deletion triggers strong transcriptional adjustments, particularly in genes related to epidermal integrity, lipid biosynthesis, and stress response.

[0040] (2) Metabolomics analysis Untargeted metabolomics analysis was used to assess biochemical changes following ApApoD2 silencing. Using the same bioreproducible samples as those collected by RNA-seq, metabolites were extracted by grinding in liquid nitrogen and adding pre-chilled 80% methanol (containing 0.1% formic acid) (1 mL solvent per 50 mg tissue). After vortexing, the samples were incubated on ice for 30 min, centrifuged at 12000 × g for 10 min at 4 °C, and the supernatant was filtered through a 0.22 μm filter. Analysis was performed using ultra-high performance liquid chromatography combined with high resolution mass spectrometry (UHPLC-HRMS): C 18A 2.1 × 100 mm, 1.7 μm column was used with a mobile phase of 0.1% formic acid (A) and acetonitrile (B), using gradient elution (5% → 95% B, 10–15 min), followed by a 5 min hold. Full scans in ESI positive and negative ion modes (m / z 100–1000) were performed to effectively distinguish the fine isotopic structures of metabolites. Typical source parameters included a capillary voltage of 3.5 kV, a desolvation temperature of 300 °C, and a spray gas (nitrogen) flow rate adjusted for optimal spray stability. In addition to MS1 scans, data-dependent MS / MS fragmentation of the strongest ions was performed to obtain structural information for metabolite identification. Instrument calibration and tuning were checked using standard reference compounds to ensure quality accuracy within a few ppm.

[0041] Raw LC-MS data underwent peak identification, retention time correction, and peak integration across the entire dataset using the XCMS software package (Bioconductor platform). First, peak detection was performed in each chromatogram using XCMS's centWave algorithm, identifying characteristic peaks by mass-to-charge ratio (m / z) and retention time. Subsequently, retention time correction was used to align peaks detected in at least one sample across all samples. After alignment, a feature table was generated, where each feature is defined by a unique retention time and m / z, and includes its corresponding peak area (ionic intensity) in each sample. The characteristic peak areas were log2 transformed and normalized to correct for any systematic errors. Features that may originate from contaminants or noise (e.g., signals appearing in blank samples or with extremely low intensity) were removed and not used for subsequent analysis. The final result is a data matrix containing the abundance of hundreds of metabolite features for each sample, used for inter-group statistical comparisons.

[0042] To identify metabolites significantly altered by ApApoD2 inhibition, univariate statistical analysis was performed on the treated characteristic data. For each metabolite characteristic, the mean intensity was compared between the ApApoD2-dsRNA group and the control group (8 samples per group). A two-tailed Student's t-test was used for each characteristic to assess differences between the two treatments. Multiple test corrections were applied to the p-values ​​obtained from these tests using Benjamini-Hochberg FDR correction to reduce the false positive rate. Metabolite characteristics with corrected p-values ​​< 0.05 were considered differentially accumulated metabolites (DAMs) in response to ApApoD2 silencing. The magnitude of change for each characteristic (fold change in mean intensity from the silencing group to the control group) was also recorded. Volcano plots (plotted as -log10 (p-value) versus log2 fold change) were generated to visualize the metabolomics changes and highlight those characteristics that met the significance criteria.

[0043] like Figure 3As shown, principal component analysis of the metabolite profile revealed a clear separation between the ApApoD2 silencing group and the control group, indicating that gene silencing induces targeted perturbations of specific metabolic pathways. Targeted comparisons of individual metabolites identified numerous differentially accumulated metabolites (DAMs) resulting from ApApoD2 silencing. A volcano plot of metabolite changes highlighted approximately 108 significantly altered metabolites (p < 0.05, fold change ≥ 1.5). Among these, 52 compounds showed particularly strong changes. In ApApoD2-silenced aphids, the levels of 20 metabolites were higher than in the control group, including various carbohydrates, amino acids (and their derivatives), and certain organic acids. Conversely, the levels of 32 metabolites were reduced in ApApoD2-silenced aphids, encompassing nucleotides and their derivatives, lipids, ketone bodies, and other organic acids. Specifically, the lipid metabolite MEDN368 (Lysope 14:0, myristoyl lysophosphatidylethanolamine) was significantly accumulated, while the levels of MEDN604 (tetradecanedioic acid), MEDN658 (hexadecanoic acid), MEDP531 ((-)-trans-Caryophyllene), and MEDP579 (gamma-Muurolene, γ-ylangolene) were significantly reduced. KEGG pathway enrichment analysis indicated that these affected metabolites are mainly involved in signal transduction, inflammatory responses, glucose transport and metabolism, lysosomal function, secondary metabolite synthesis, and the ABC transporter pathway, with the ABC transporter primarily associated with glucose transport.

[0044] (3) Transcriptome-metabolome integrated analysis To systematically analyze the association between the transcriptome and metabolome of the pea aphid after ApApoD2 silencing, this study employed a strategy combining two-way orthogonal partial least squares (O2PLS) and nine-quadrant plot analysis. Integrated modeling was implemented using the R language OmicsPLS, with parameters set to a=3, orthogonality component number nx=0 for the X matrix, and orthogonality component number ny=1 for the Y matrix, to minimize prediction error. Furthermore, the nine-quadrant plot was used to categorize transcriptomic and metabolomic variables into three levels: significantly elevated, insignificant, and significantly decreased. Samples distributed across the nine quadrants reflected different biological patterns, aiding in the identification of potential relationships between variables.

[0045] A nine-quadrant scatter plot was constructed based on the log2 fold change of genes and metabolites (silent group vs. control group). Figure 4The results showed that most gene-metabolite pairs were distributed near the origin (without significant changes), however, some distinct points fell in the upper right quadrant (transcriptors and metabolites were simultaneously upregulated), and similarly, some points fell in the lower left quadrant (transcriptors and metabolites were simultaneously downregulated). These coordinated changes indicate that ApApoD2 silencing induces co-regulation and downregulation in specific biological pathways, meaning that genes and their associated metabolites are either elevated or suppressed together.

[0046] To gain a deeper understanding of these integration patterns, we performed functional enrichment analysis on gene-metabolite subsets corresponding to different regions in the nine-quadrant diagram. Figure 5 -A and Figure 5 -B summarizes the gene ontology (GO) and KEGG pathway enrichment results for the main response categories (corresponding to quadrants 1, 2, 4, 6, and 8 in the figure). In quadrant 1 (elevated metabolite levels and decreased transcript levels), ApApoD2 silencing led to a significant downregulation of genes involved in proteolytic activity, immune defense (antibacterial response), and phagocytosis, and inhibited key signaling pathways including Ras, Rap1, HIF-1, and PI3K-Akt. Correspondingly, this region accumulated some specific metabolites, such as benzamide compounds and L-cystathionine (…). Figure 5 Benzamides are plant-derived defensive compounds synthesized and accumulated by host plants under attack from herbivorous insects or other stresses. These molecules can inhibit the activity of insect digestive enzymes (proteases, amylases), thereby reducing nutrient uptake and delaying insect growth and development. The detection of benzamide compounds in ApApoD2-silenced aphids suggests that feeding on RNAi-affected aphids may induce a defensive response in the host plant, leading to the uptake of these compounds. L-cystathionine, a key intermediate in sulfur amino acid metabolism (the synthesis of methionine and cysteine ​​via the transsulfurization pathway), also accumulates in ApApoD2-silenced aphids. The accumulation of this metabolite suggests disruption of normal methionine / cysteine ​​metabolism, a pathway crucial for insect protein synthesis, antioxidant (glutathione) production, and detoxification. These changes indicate that ApApoD2 silencing not only affects cuticle lipids and stress signaling but also has downstream effects on nutrient and amino acid metabolism processes.

[0047] Furthermore, this invention employs bidirectional orthogonal partial least squares (O2PLS) modeling to identify shared variants between transcriptome and metabolome datasets. Joint O2PLS loading plot ( Figure 6-A) describes how individual genes and metabolites contribute to common underlying factors distinguishing the silencing group from the control group. This O2PLS model captures a significant proportion of the covariance: joint variances (R2X and R2Y) explain 0.76% of the total transcript variance and 0.73% of the total metabolite variance, respectively. This analysis identified the top 25 genes and top 25 metabolites that contribute most to the ApApoD2 silencing phenotype. KEGG pathway enrichment analysis of these high-load features showed that the top-ranked differentially expressed metabolites are primarily associated with AMPK signaling pathway-mediated glycerol ester metabolism disorders, while the top-ranked transcripts are functionally diverse, with no single pathway dominating.

[0048] (4) Co-expression network analysis To explore gene co-expression patterns and identify gene modules associated with ApApoD2 silencing, weighted gene co-expression network analysis (WGCNA) was performed on RNA-seq data. This analysis identified several highly co-expressed gene modules. A phylogenetic dendrogram of all expressed genes is shown below. Figure 7 -A) depicts seven distinct gene modules, each color-coded (cyan, blue, brown, yellow, green, red, black), with genes not assigned to any module categorized in gray. In the dendrogram, genes belonging to the same module cluster into the same branch of the tree, reflecting highly correlated expression profiles. These distinct color-coded branches suggest that ApApoD2 silencing triggers synergistic behavior in specific gene groups, hinting that each module may correspond to a common regulatory effect or biological function. Module sizes range from 34 genes (black module) to 193 genes (cyan module), with other modules containing 51 (red), 109 (blue), 69 (brown), 53 (green), and 65 (yellow) genes, respectively; an additional 172 genes were unclassified (gray).

[0049] Further analysis was conducted on the relationship between each co-expression module and the ApApoD2 silencing phenotype. A module-trait heatmap was generated by associating module characteristic genes (the first principal component of each module's expression profile) with treatment conditions (silencing group vs. control group). Figure 7 -B). Several modules showed a strong and significant correlation with ApApoD2 silencing. The red module showed a near-perfect negative correlation with ApApoD2 silencing (r = –0.96, p = 7 × 10⁻⁶). –9 This indicates that the genes in this module were significantly repressed when ApApoD2 was silenced. The largest gene cluster, the cyan module, also showed a strong negative correlation (r = -0.82, p = 1 × 10⁻⁶). –4The yellow module was significantly positively correlated with the silencing trait (r = 0.70, p = 0.003). In contrast, other modules (green, brown, blue, and black) showed weaker or no significant associations with treatment conditions. These results precisely pinpointed the gene networks most sensitive to ApApoD2 deletion: the red and cyan modules likely contain key downstream targets or effectors of ApApoD2 (as they are strongly repressed in ApApoD2 deletion), while the yellow module encompasses genes induced by ApApoD2 silencing. The high strength of these module-trait correlations highlights the biological relevance of these gene sets within the context of ApApoD2 function, as they represent pathways and processes significantly perturbed by gene silencing.

[0050] Generate a topological overlap matrix (TOM) heatmap to visualize gene connectivity within and between modules. Figure 7 -C). In this network heatmap, genes are ordered by module allocation, so genes within the same module are arranged diagonally adjacent. We consistently observed dark, high-intensity blocks corresponding to each module on the diagonal, indicating high topological overlap (strong interconnectivity) between genes within the same module. This is particularly evident in larger modules (such as cyan and red), which form prominent dark squares reflecting a densely interconnected gene network. In contrast, off-diagonal regions (genes belonging to different modules) are lighter in color, indicating low overlap between modules and sparse co-expression links. This stark contrast between diagonal and off-diagonal regions confirms that the aphid transcriptome under ApApoD2 silencing is divided into relatively independent co-expression modules. Each module forms a tightly coordinated gene cluster with abundant internal connections but sparse inter-module connections. This modular structure reinforces the idea that different gene sets (such as genes in red or cyan modules) work synergistically and may collectively contribute to specific aspects of the ApApoD2 silencing phenotype, such as weakened stratum corneum barrier function (due to downregulation of stratum corneum and lipid metabolism genes) or activation of compensatory stress response pathways (due to upregulation of defense genes such as heat shock proteins).

[0051] Functional characterization of these modules further supports their role in the silencing phenotype. KEGG pathway analysis of the cyan-green module (the module most strongly suppressed by ApApoD2 deletion) genes showed a significant enrichment of metabolic pathways, including those related to lipid metabolism and amino acid biosynthesis. Figure 7 -D). The results showed that ApApoD2 silencing impaired cuticle lipid production and triggered widespread metabolic disorders. The enrichment of lipid and amino acid-related pathways in the cyan-green gene cluster suggests that ApApoD2 normally helps maintain metabolic homeostasis, and its silencing disrupts these basic physiological processes in aphids.

[0052] The above detailed embodiments describe the implementation of the present invention; however, the present invention is not limited to the specific details described in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

Claims

1. The application of ApApoD2 in regulating lipid synthesis in pea aphids, characterized in that, The amino acid sequence of ApApoD2 is shown in SEQ ID NO:

3.

2. The application according to claim 1, characterized in that, The nucleotide sequence encoding ApApoD2 is shown in SEQ ID NO:

2.

3. A method for controlling pea aphids, characterized in that, include: Inhibiting the expression of the ApApoD2 gene in pea aphids or reducing the function or activity of its protein, thereby inhibiting lipid synthesis in pea aphids, achieves the purpose of controlling pea aphids, wherein the amino acid sequence of ApApoD2 is shown in SEQ ID NO:

3.

4. The method according to claim 3, characterized in that, The expression of the ApApoD2 gene in the pea aphid or the function or activity of its protein can be reduced through one or more of the following methods: gene knockout, gene silencing, gene mutation, and / or introduction of substances that inhibit the expression level of the ApApoD2 gene.

5. The method according to claim 4, characterized in that, The substance that inhibits the expression level of the ApApoD2 gene is dsRNA or a DNA molecule encoding the dsRNA or an expression cassette, recombinant vector, recombinant bacteria or transgenic cell line containing the DNA molecule. The dsRNA sequence is a double-stranded RNA composed of the nucleotides shown in SEQ ID NO:4 and the nucleotides shown in their reverse complementary sequences.

6. A dsRNA or a DNA molecule encoding said dsRNA, or an expression cassette, recombinant vector, recombinant bacteria, or transgenic cell line containing said DNA molecule, characterized in that, The dsRNA sequence is a double-stranded RNA consisting of the nucleotides shown in SEQ ID NO:4 and the nucleotides shown in their reverse complementary sequence.

7. The use of the dsRNA of claim 6, or the DNA molecule encoding the dsRNA, or the expression cassette, recombinant vector, recombinant bacteria, or transgenic cell line containing the DNA molecule, in any of the following: a1) Control of pea aphids; a2) Prepare products for controlling pea aphids; a3) Inhibits lipid synthesis in pea aphids; a4) Prepare products that inhibit lipid synthesis in pea aphids; a5) Inhibit ApApoD2 gene expression; a6) Prepare products that inhibit ApApoD2 gene expression; a7) is an inhibitor of the ApApoD2 gene.

Images