Mechanism for improving cold resistance of peach fruits by IAA16 gene and application of mechanism
By treating peaches with exogenous β-ionone and regulating the expression of the IAA16 gene, the antioxidant capacity of both enzyme and non-enzyme systems was enhanced, solving the chilling injury problem caused by low-temperature storage and improving the cold resistance and antioxidant capacity of the fruit.
Patent Information
- Application Number
- CN202511633490.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-10
- Publication Date
- 2026-02-27
AI Technical Summary
Chilling injury caused by low-temperature storage manifests as browning of peach flesh, softening of texture, and loss of nutrients. The main cause is excessive accumulation of reactive oxygen species (ROS). Current technologies have not yet effectively addressed the impact of exogenous β-ionone on the cold resistance of postharvest peaches, and its mechanism of action remains unclear.
Treatment of peach fruits with exogenous β-ionone regulates the expression of the IAA16 gene, increases the activity of enzyme systems (SOD, CAT, and POD) and non-enzyme systems (AsA, GSH, and phenolic substances), and regulates the AsA-GSH cycle to enhance antioxidant capacity.
It significantly improved the peach fruit's resistance to chilling injury, maintained firmness, slowed down browning, and increased DPPH, ABTS, and FRAP indices, thus extending the fruit's shelf life.
Smart Images

Figure CN121574997A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of agricultural science and engineering, and specifically relates to a mechanism by which the IAA16 gene enhances the cold resistance of peach fruit and its application. Background Technology
[0002] Peaches (Prunus persica) are highly susceptible to rotting in hot and humid seasons, especially when improperly stored, which accelerates spoilage. Among the many factors causing peach spoilage, temperature plays a crucial role in post-harvest quality. Low-temperature storage is a widely used and effective method for storing peaches, primarily because it inhibits respiration, slows nutrient depletion, reduces senescence, and decreases the risk of microbial infection, ultimately mitigating spoilage. However, prolonged storage at low temperatures (2.2°C to 7°C) can cause chilling injury (CI), a physiological disorder characterized by browning of the flesh, softening, nutrient loss, and flavor degradation. Therefore, finding strategies to mitigate chilling injury is vital for the peach processing industry.
[0003] One of the main causes of chilling injury is the excessive accumulation of reactive oxygen species (ROS), which mainly include O2· - ROS, along with substances like H2O2, can cause oxidative damage at the cellular level. Maintaining a balance between ROS production and scavenging is crucial for preventing oxidative stress. Under cold stress, ROS production often exceeds the capacity of the plant's antioxidant defense system, leading to its over-accumulation. During evolution, plants have developed complex antioxidant mechanisms to counteract this oxidative stress. Under cold stress, plants maintain oxidative homeostasis by activating both enzymatic and non-enzymatic antioxidant systems. Enzymatic systems scavenge ROS through a cascade of enzymes such as superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD), while non-enzymatic systems scavenge ROS by directly neutralizing it with non-enzymatic antioxidants (ascorbic acid (AsA), the glutathione cycle (GSH), and phenolic compounds) and by regenerating AsA and GSH through the AsA-GSH cycle.
[0004] β-Ionone is a degradation product of β-carotene and is widely found in fruits and vegetables. As a natural plant growth regulator, β-ionone has a wide range of physiological functions, including promoting plant growth and development and enhancing stress resistance. Recent studies have shown that β-ionone can improve plant tolerance to abiotic stresses by regulating the antioxidant system, but the effects of exogenous β-ionone on the cold tolerance of postharvest peach fruits and its mechanism of action remain unclear.
[0005] Therefore, exploring the effects of exogenous β-ionone on the cold resistance of postharvest peach fruit and its mechanism of action is of great significance for extending the shelf life of peach fruit during low-temperature storage. Summary of the Invention
[0006] This invention provides a mechanism by which the IAA16 gene enhances the cold resistance of peach fruit and its application. Through treatment of peach fruit with exogenous β-ionone, this invention discovered that the IAA16 gene can simultaneously improve the cold resistance of peach fruit during low-temperature storage by regulating both enzyme and non-enzymatic systems. The enzyme regulation system enhances the ability to scavenge reactive oxygen species (ROS) by increasing the activity of SOD, CAT, and POD. The non-enzymatic regulation system includes increasing the content of AsA, GSH, and phenolic substances to directly neutralize ROS, and regulating the efficiency of AsA-GSH cycling to regenerate AsA and GSH to scavenge ROS. This invention provides a theoretical basis for improving fruit preservation strategies and offers a novel and feasible technology for fruit preservation.
[0007] This invention provides the use of the IAA16 gene in preparing a formulation to improve the cold resistance of peach fruit, wherein the nucleotide sequence of the IAA16 gene is shown in SEQ ID NO.1.
[0008] Furthermore, the cold resistance of peach fruit is improved by increasing the expression of the IAA16 gene; the improvement of the cold resistance of peach fruit includes increasing the content of AsA, GSH and phenolic substances, increasing the activity of SOD, CAT and POD, and regulating the efficiency of the ASA-GSH cycle.
[0009] The aforementioned cold resistance refers to the ability to resist chilling injury. One of the main causes of chilling injury is the excessive accumulation of reactive oxygen species (ROS), which mainly include O2· - Including H2O2, this leads to oxidative damage at the cellular level. Under cold stress, plants maintain oxidative homeostasis by activating enzymatic and non-enzymatic antioxidant systems. Enzymatic systems rely on a cascade of enzymes such as superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD) to scavenge ROS, while non-enzymatic systems directly neutralize ROS through non-enzymatic antioxidants (ascorbic acid (AsA), the glutathione cycle (GSH), and phenolic compounds) and scavenge ROS by regenerating AsA and GSH through the AsA-GSH cycle.
[0010] Prolonged storage at low temperatures (2.2℃ to 7℃) can cause chilling injury in peaches, characterized by browning of the flesh, softening of the texture, loss of nutrients, and loss of flavor. This invention involves storing peaches treated with exogenous β-ionone and control peaches simultaneously at 4℃. During storage, the firmness, degree of browning, and indicators such as DPPH, FRAP, and ABTS were measured. The results showed that, compared to the control, β-ionone-treated peaches maintained higher firmness and exhibited less browning, with increases in DPPH, ABTS, and FRAP. These data indicate that β-ionone treatment can enhance the antioxidant capacity of peaches, thereby improving their resistance to chilling injury; however, the specific mechanism by which this resistance is regulated remains unclear. Therefore, this invention further screened the transcriptomes of peaches treated with exogenous β-ionone and control peaches after low-temperature storage, and selected the gene IAA16, which is most likely to participate in improving the cold damage resistance of peaches, from many transcriptional regulation-related genes with the most significant changes in abundance. Furthermore, a series of experiments were conducted to verify that this gene can simultaneously regulate the enzyme system and non-enzyme system to improve the cold damage resistance of peaches.
[0011] Furthermore, increasing the expression of the IAA16 gene can increase the expression levels of any one or more genes among PMM, GMP, GME, and GPP, while decreasing the expression levels of any one or more genes among AO-1, AO-2, and AO2, thereby increasing AsA content. Increasing the expression of the IAA16 gene can also increase the expression levels of any one or more genes among GSH1 and GSH2, thereby increasing GSH content. Furthermore, increasing the expression of the IAA16 gene can increase the expression level of the PAL gene while decreasing the expression level of the PPO gene, thereby increasing phenolic content.
[0012] In some studies, upregulating the expression of the IAA16 gene in peach fruit significantly upregulated ascorbic acid (ASA) synthesis-related genes PMM, GMP, GME, and GPP, while significantly downregulating ASA degradation-related genes AO-1, AO-2, and AO2, thus increasing ASA and T-ASA levels. ASA can directly neutralize ROS, and its increased content enhances the chilling resistance of peach fruit.
[0013] In some studies, upregulating the expression of the IAA16 gene in peach fruit significantly upregulated glutathione (GSH) synthesis-related genes GSH1 and GSH2, thus increasing GSH content. GSH can directly neutralize ROS, and its increased content enhances the cold damage resistance of peach fruit.
[0014] In some studies, upregulating the expression of the IAA16 gene in peach fruit significantly upregulated the phenol synthesis-related gene PAL, while significantly downregulating the phenol degradation gene PPO, thus increasing the total phenol content. Phenolic substances can directly neutralize ROS, and their increased content enhances the peach fruit's resistance to chilling injury.
[0015] Furthermore, increasing the expression of the IAA16 gene can increase the expression levels of CAT, SOD, and POD genes, thereby enhancing their activities. Increasing the expression of the IAA16 gene can also increase the expression levels of MDHAR, DHAR2, and GR genes, while decreasing the expression level of the APX-1 gene, thereby regulating the ASA-GSH cycle efficiency.
[0016] In some studies, upregulating the expression of the IAA16 gene in peach fruit significantly upregulated the synthetic genes of three enzymes: SOD, CAT, and POD, thereby increasing the activities of SOD, CAT, and POD. These three enzymes scavenge ROS through a cascade reaction, thus enhancing the peach fruit's resistance to chilling injury.
[0017] The AsA-GSH cycle is a key antioxidant defense mechanism in plants, playing a central role in scavenging ROS (mainly H2O2) and maintaining intracellular redox homeostasis through the coordinated action of key enzymes (ascorbate peroxidase (APX), monodehydroascorbate reductase (MDHAR), dehydroascorbate reductase (DHAR), and glutathione reductase (GR)).
[0018] The most crucial step in the AsA-GSH cycle's removal of ROS (mainly H2O2) is that APX uses AsA as an electron donor to reduce H2O2 to H2O, while simultaneously oxidizing AsA to MDHA. Other enzymes in the AsA-GSH cycle (MDHAR, DHAR, and GR) only play a supporting role in the regeneration of AsA and GSH. After the APX reaction consumes AsA, subsequent reactions involve MDHAR catalyzing the regeneration of MDHA to AsA, DHAR catalyzing the regeneration of DHA (a further oxidation product of MDHA) to AsA, and GSH being oxidized to GSSG, while GR catalyzes the regeneration of GSSG to GSH.
[0019] In some studies, upregulating IAA16 gene expression in peach fruit significantly upregulated the expression levels of the synthetic genes for the three key enzymes MDHAR, DHAR, and GR in the ASA-GSH cycle, while significantly downregulating the expression level of the APX-1 gene, which synthesizes APX. Consequently, the activities of MDHAR, DHAR, and GR increased, while the activity of APX decreased. Combined with the significant increase in ASA content when IAA16 gene expression was upregulated in peach fruit, even with decreased APX activity, the high concentration of ASA could maintain the APX-catalyzed H2O2 scavenging rate through the "substrate saturation effect." Furthermore, the decrease in APX activity is an adaptive regulation; moderately reducing APX activity can decrease the rate of ASA consumption. Combined with the high activities of MDHAR and DHAR, this can maintain a "high reserve" state of ASA (ASA is both a substrate for APX and a non-enzymatic antioxidant that directly scavenges ROS).
[0020] Furthermore, the nucleotide sequences of the PMM, GMP, GME, GPP, AO-1, AO-2 and AO2 genes are shown in SEQ ID NO. 2-5, 9-11; the nucleotide sequences of the GSH1 and GSH2 genes are shown in SEQ ID NO. 12-13; and the nucleotide sequences of the PAL and PPO genes are shown in SEQ ID NO. 14-15.
[0021] Furthermore, the nucleotide sequences of the SOD, POD, and CAT genes are shown in SEQ ID NO. 16–18; and the nucleotide sequences of the MDHAR, DHAR2, GR, and APX-1 genes are shown in SEQ ID NO. 19–22.
[0022] On the other hand, the present invention provides the use of an overexpression vector of the IAA16 gene for preparing a preparation to improve the cold resistance of peach fruit, wherein the overexpression vector contains a nucleotide sequence such as SEQ ID NO.1.
[0023] In another aspect, the present invention provides a preparation for improving the cold resistance of peach fruit, including an overexpression vector of the IAA16 gene.
[0024] Furthermore, the overexpression vector contains a nucleotide sequence such as SEQ ID NO.1.
[0025] In another aspect, the present invention provides a method for improving the cold resistance of peach fruit, wherein the method comprises applying the preparation described above to the peach fruit.
[0026] The present invention has the following beneficial effects:
[0027] 1. This invention discovers that β-ionone treatment of peach fruit can simultaneously improve its resistance to chilling injury during low-temperature storage by regulating both enzyme and non-enzyme systems (including increasing the content of non-enzyme antioxidants and regulating the AsA-GSH cycle);
[0028] 2. The specific mechanism by which overexpression of the IAA16 gene in peach fruit regulates the enzyme system to improve cold damage resistance is as follows: The expression of the SOD, CAT, and POD genes is upregulated to increase their activities, thereby enhancing the scavenging of O2· through a cascade reaction. - The ability to react with H2O2;
[0029] 3. This invention demonstrates the specific mechanism by which overexpression of the IAA16 gene in peach fruit regulates the content of non-enzymatic antioxidants to improve cold damage resistance: ASA synthesis-related genes PMM, GMP, GME, and GPP are all upregulated, while ASA degradation-related genes AO-1, AO-2, and AO2 are all significantly downregulated, thus increasing ASA and T-ASA content; GSH synthesis-related genes GSH1 and GSH2 are both significantly upregulated, thus increasing GSH content; phenol synthesis-related gene PAL is significantly upregulated, while phenol degradation gene PPO is significantly downregulated, thus increasing total phenol content.
[0030] 4. This invention demonstrates that the specific mechanism by which overexpression of the IAA16 gene in peach fruit regulates the AsA-GSH cycle to maintain a high concentration of ASA and improve cold damage resistance is as follows: the expression levels of the MDHAR, DHAR2, and GR genes are significantly upregulated, while the expression level of the APX-1 gene, which synthesizes APX, is significantly downregulated. As a result, the enzyme activities of MDHAR, DHAR, and GR are increased, while the enzyme activity of APX is decreased.
[0031] 5. This invention provides a theoretical basis for the development of fruit preservation strategies to improve preservation technology, and provides a novel and feasible technology for fruit preservation. Attached Figure Description
[0032] Figure 1 A shows the changes in the pulp of peaches in the β-ionone treatment group and the control group after storage at 4°C in Example 1.
[0033] Figure 1 BC shows the changes in chilling injury index and firmness of peaches in the β-ionone treatment group and the control group after storage at 4℃ in Example 1.
[0034] Figure 2 AB represents the H2O2 content and O2·m2 content of peaches in the β-ionone treatment group and the control group after storage at 4℃ in Example 1. - Changes in generation rate;
[0035] Figure 3AC represents the changes in DPPH, ABTS, and FRAP levels in peaches from the β-ionone treatment group and the control group after storage at 4°C in Example 1.
[0036] Figure 4 AB shows the changes in SOD activity and PpSOD gene expression in peach fruits of the β-ionone treatment group and the control group after storage at 4℃ in Example 2.
[0037] Figure 4 CD represents the changes in POD activity and PpPOD gene expression in peach fruits of the β-ionone treatment group and the control group after storage at 4℃ in Example 2.
[0038] Figure 4 EF shows the changes in CAT activity and PpCAT gene expression in peach fruits of the β-ionone treatment group and the control group after storage at 4℃ in Example 2.
[0039] Figure 5 The mechanism by which β-ionone treatment enhances the cold resistance of peach fruit;
[0040] Figure 6 AD represents the changes in the contents of T-AsA, AsA, GSH, and GSSG in peach fruits of the β-ionone treatment group and the control group after storage at 4℃ in Example 2.
[0041] Figure 7 AB shows the changes in GalLDH activity and PpGalLDH gene expression in peach fruits of the β-ionone treatment group and the control group after storage at 4℃ in Example 2.
[0042] Figure 7 CD represents the changes in MDHAR activity and PpMDHAR gene expression in peach fruits of the β-ionone treatment group and the control group after storage at 4℃ in Example 2.
[0043] Figure 7 EF represents the changes in DHAR activity and PpDHAR gene expression in peach fruits of the β-ionone treatment group and the control group after storage at 4℃ in Example 2.
[0044] Figure 7 GH represents the changes in GR activity and PpGR gene expression in peach fruits of the β-ionone treatment group and the control group after storage at 4℃ in Example 2.
[0045] Figure 7 IJ shows the changes in APX activity and PpAPX gene expression in peach fruits of the β-ionone treatment group and the control group after storage at 4℃ in Example 2.
[0046] Figure 8The changes in total phenolic content, PPO activity, and PpPPO gene expression in peaches from the AC β-ionone treatment group and the control group after storage at 4℃ were recorded in Example 2.
[0047] Figure 9 This is an example of the changes in IAA16 gene expression in peaches of the β-ionone treatment group and the control group after storage at 4℃ in Example 3.
[0048] Figure 10 Example 4: ASA and T-ASA content in peach fruit after transient overexpression of the IAA16 gene;
[0049] Figure 11 The relative expression levels of ASA synthesis-related genes after transient overexpression of the IAA16 gene in peach fruit in Example 4;
[0050] Figure 12 The relative expression levels of ASA cycling and degradation-related genes after transient overexpression of the IAA16 gene in peach fruit in Example 4;
[0051] Figure 13 Example 4: GSH and GSSG content in peach fruit after transient overexpression of the IAA16 gene;
[0052] Figure 14 The relative expression levels of GSH metabolism-related genes after transient overexpression of the IAA16 gene in peach fruit in Example 4;
[0053] Figure 15 Example 4: ASA and T-ASA content of peach fruit after transient silencing of the IAA16 gene;
[0054] Figure 16 The relative expression levels of ASA synthesis-related genes after transient silencing of the IAA16 gene in peach fruit in Example 4;
[0055] Figure 17 The relative expression levels of ASA cycling and degradation-related genes after transient silencing of the IAA16 gene in peach fruit in Example 4;
[0056] Figure 18 Example 4: GSH and GSSG content in peach fruit after transient silencing of the IAA16 gene;
[0057] Figure 19 The relative expression levels of GSH metabolism-related genes after transient silencing of the IAA16 gene in peach fruit in Example 4;
[0058] Figure 20 The SGRNA sequence of the peach callus tissue in Example 5, which inhibits the expression of the IAA16 gene;
[0059] Figure 21Example 5: ASA and T-ASA content in peach callus tissue after overexpression of the IAA16 gene;
[0060] Figure 22 The relative expression levels of ASA synthesis-related genes after overexpression of the IAA16 gene in peach callus tissue in Example 5;
[0061] Figure 23 The relative expression levels of ASA cycling and degradation-related genes after overexpression of the IAA16 gene in peach callus tissue in Example 5;
[0062] Figure 24 Example 5: ASA and T-ASA content in peach callus tissue after IAA16 gene inhibition;
[0063] Figure 25 The relative expression levels of ASA synthesis-related genes after IAA16 gene inhibition in peach callus tissue in Example 5;
[0064] Figure 26 The relative expression levels of ASA cycling and degradation-related genes in peach callus tissue after IAA16 gene inhibition in Example 5;
[0065] Figure 27 The levels of GSH and GSSG in peach callus tissue after overexpression and inhibition of IAA16 gene expression, respectively, in Example 5;
[0066] Figure 28 The relative expression levels of GSH metabolism-related genes after overexpression of the IAA16 gene in peach callus tissue in Example 5;
[0067] Figure 29 The relative expression levels of GSH metabolism-related genes in peach callus tissue after IAA16 gene inhibition in Example 5;
[0068] Figure 30 The relative expression levels of phenol metabolism-related genes after overexpression of the IAA16 gene in peach callus tissue in Example 5;
[0069] Figure 31 The relative expression levels of phenol metabolism-related genes after IAA16 gene inhibition in peach callus tissue in Example 5;
[0070] Figure 32 The relative expression levels of genes related to enzyme system synthesis after overexpression of the IAA16 gene in peach callus tissue in Example 5;
[0071] Figure 33 This represents the relative expression levels of genes related to enzyme system synthesis after inhibition of the IAA16 gene in peach callus tissue in Example 5. Detailed Implementation
[0072] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be noted that the embodiments described below are intended to facilitate the understanding of the present invention and do not limit it in any way.
[0073] Example 1: Effect of β-ionone treatment on cold resistance of postharvest peach fruit
[0074] The invention team discovered that postharvest treatment of peaches with β-ionone significantly improved their resistance to chilling injury. The most direct and observable changes resulting from this improved resistance were a slower decline in firmness and a slower rate of browning. Furthermore, the peaches' resistance to chilling injury was reflected in their ability to scavenge reactive oxygen species (ROS), primarily O2·4·4·4·20°C. - And H2O2, the O2· of peach fruit - A decrease in the formation rate and H2O2 content indicates an improved resistance to chilling injury. Furthermore, DPPH, FRAP, and ABTS are recognized indicators of antioxidant capacity and are important standards for assessing changes in fruit quality and the degree of chilling injury. Increased DPPH, FRAP, and ABTS levels in peaches at low temperatures indicate improved resistance to chilling injury.
[0075] The experimental subject in this embodiment was the peach variety "Lakeview," collected from an orchard in Ningbo, China, 120 days after pollination. Peaches of uniform maturity, without mechanical damage, and similar size were randomly divided into two groups of 66 each: a treatment group and a control group. The treatment group was soaked in a 10 mM β-ionone solution for 20 minutes, while the control group was soaked in sterile water for the same amount of time. The samples were then removed, air-dried, and bagged, subsequently stored at 4°C for 35 days. During this period, eight peaches were collected from each group every seven days to measure firmness and assess chilling injury index. After measuring firmness and assessing chilling injury index, the eight peaches from each sampling point were ground into powder in liquid nitrogen and stored in an ultra-low temperature freezer to detect their O2 content. - The generation rate, H2O2 content, and indicators of DPPH, FRAP, and ABTS.
[0076] The method for measuring hardness was to use a TMS Touch mass spectrometer from FTC (Fruit Test Corporation, USA). The test parameters were: probe diameter 7.5 mm, detection speed 60 mm / min, pulp type variable set to 15%, and initial force set to 0.375 N. Six fruits were selected, and approximately 1 mm thick peels were removed along the equator for hardness measurement. Measurements were repeated three times, and the results were expressed in N.
[0077] The chilling injury index was assessed by evaluating the degree of lignification and browning of the fruit peel caused by chilling injury. The mid-section of two groups of fruit at each sampling point was observed (eight fruits per sampling point per group), and the damage was scored using a five-point scale: 0 indicates no chilling injury (0%), 1 indicates mild chilling injury (1-20%), 2 indicates moderate chilling injury (21-40%), 3 indicates more severe chilling injury (41-60%), and 4 indicates severe chilling injury (>61%). The chilling injury index was calculated as [∑(chilling injury score × number of fruits receiving that score)] / (4 × total number of fruits in the treatment group / control group), with eight independent replicates per sampling point per group.
[0078] The O2· - The formation rate was determined using the method described in the paper "Inhibitory effects of propylgallate on browning and its relationship to active oxygen metabolism inpericarp of harvested longan fruit" (Lin,Y.,Lin,Y.,Lin,H.,Zhang,S.,Chen,Y.,&Shi,J.(2015).LWT-Food Science and Technology,60(2),1122–1128.https: / / doi.org / 10.1016 / j.lwt.2014.10.008).
[0079] The H2O2 content was detected using the H2O2 assay kit from Nanjing Jiancheng Bioengineering Institute.
[0080] The detection of DPPH and ABTS indicators specifically refers to the method in the paper "β-ionone treatment enhances the antioxidant capacity in postharvest broccoli (Brassica oleracea L. var. Italica) by maintaining the levels of bioactive substances" (Zhang, F., Cao, M., Shen, L., Shi, L., Chen, W., & Yang, Z. (2025). Foods, 14(5), 762. https: / / doi.org / 10.3390 / foods14050762), where the absorbance of the DPPH mixture and the ABTS mixture were measured at 517 nm and 734 nm, respectively.
[0081] The detection method for the FRAP index is as follows: 0.3 mol L... -1 Sodium acetate solution, 20 mmol / L -1 FeCl3 aqueous solution and 10 mmol L -1 A 2,4,4,2-6-pyridine-s-triazine (TPTZ) solution was mixed in the dark at a ratio of 10:1:1 to obtain the FRAP working solution; 0.1 g of peach fruit sample was weighed into 1 mL of distilled water, homogenized, sonicated, and centrifuged; 20 μL of the supernatant was transferred to a 96-well plate containing 180 μL of the FRAP working solution, and the absorbance was measured at 593 nm; the reducing power was determined using a calibration curve of ascorbic acid; FRAP values were expressed in g / kg. -1 Fw indicates.
[0082] Hardness measurement results are as follows Figure 1 As shown in Figure C, the firmness of the fruit in the control group steadily decreased during refrigeration, while the fruit treated with β-ionone maintained significantly higher firmness between days 21 and 35.
[0083] The results of the cold damage index assessment are as follows: Figure 1 As shown in AB. Figure 1 A shows that β-ionone treatment can alleviate browning in fruits after 28 days of storage. Figure 1 B showed that, compared with the control group, β-ionone treatment significantly inhibited the progression of chilling injury in the fruit. By day 35, the chilling injury index of the β-ionone-treated fruit was about 50% lower than that of the control group.
[0084] O2· - Generation rate detection results are as follows Figure 2 Figure B shows the O2· of peach fruit treated with β-ionone. - Productivity was significantly lower than the control group at both 21 and 28 days. The results of H2O2 content detection are as follows: Figure 2 As shown in Figure A, the H2O2 levels in both groups remained relatively constant during the first 7 days of storage, but after 14 days, the H2O2 level in the treated group was significantly lower than that in the control group. This indicates that the H2O2 level in peaches treated with β-ionone is significantly lower than that in the control group during low-temperature storage. - The decrease in the formation rate and H2O2 content indicates that peach fruit is less susceptible to O2· - The increased ability to remove H2O2 reflects its improved resistance to cold damage.
[0085] The test results for DPPH, ABTS, and FRAP indicators are as follows: Figure 3 As shown. Figure 3AB showed that the antioxidant capacity of the two groups of peaches, measured by DPPH and ABTS, continued to decline throughout the storage process. However, after 21 days of storage, the antioxidant capacity of peaches treated with β-ionone was consistently higher than that of untreated peaches. Figure 3 C showed that the FRAP activity in the control group remained relatively stable over time, while the β-ionone treatment group showed an initial increase followed by a gradual decrease. After 14 days, the FRAP activity of the treated peach fruit was significantly higher than that in the control group.
[0086] The test data on hardness, chilling injury index, DPPH, ABTS and FRAP indicators show that β-ionone treatment improves the chilling injury resistance of peach fruits during low-temperature storage.
[0087] Example 2: Effects of β-ionone treatment on postharvest peach fruits on regulatory enzyme and non-enzyme systems.
[0088] 1. Effects of exogenous β-ionone treatment on postharvest peach fruit on regulatory enzyme systems
[0089] O2· - H2O2 is a major reactive oxygen species (ROS) in plants. Studies have shown that one of the ways plants scavenge ROS is by activating enzyme systems to maintain oxidative homeostasis. These enzyme systems rely on a cascade of enzymes such as superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD) to scavenge ROS. Example 1 shows that β-ionone treatment of peach fruit can reduce O2· during low-temperature storage. - The formation rate and H2O2 content decreased. Therefore, this example investigates whether β-ionone treatment of postharvest peaches enhances their ability to scavenge ROS by activating the enzyme system.
[0090] 1. Enzyme activity assay: Peach fruit powder stored in an ultra-low temperature freezer as described in Example 1 was used to determine the enzyme activities of SOD, POD, and CAT using a kit from Suzhou Keming Biotechnology Co., Ltd.
[0091] 2. Total RNA extraction and cDNA synthesis: Weigh approximately 0.02 g of frozen fruit sample (peach fruit powder stored in an ultra-low temperature freezer in Example 1) and extract RNA using the ONREN Plant RNA Extraction Kit; detect the quality of RNA using a nucleic acid protein analyzer and an agarose gel electrophoresis analyzer; then, synthesize reverse transcribed first-strand cDNA according to the instructions of the Vazyme SuperRT cDNA First-Strand Synthesis Kit.
[0092] 3. Real-time quantitative PCR (q-PCR) gene expression analysis: According to the ChamQ Universal SYBR qPCR Master Mix reagent instructions provided by Nanjing Novizan Biotechnology Co., Ltd., the genes of SOD, POD, and CAT were detected using a CFX96 real-time quantitative PCR instrument (Bio-Rad, USA). Four biological replicates were set up for each sample, and the relative gene expression was calculated and analyzed using the 2-ΔCT method. The primer sequences for detecting SOD, POD, and CAT are shown in Table 1 below.
[0093] Table 1. Primer sequences for q-PCR detection of relative expression levels of SOD, POD, and CAT genes
[0094]
[0095] The enzyme activity detection results of SOD, POD, and CAT and the relative expression levels of PpSOD, PpPOD, and PpCAT are as follows: Figure 4 As shown.
[0096] Figure 4 A showed that the enzyme activity of SOD in the treatment group and the control group did not change significantly in the first 14 days of storage, but the enzyme activity in the control group decreased significantly after 21 days, while the enzyme activity in the treatment group remained high. Figure 4 B showed that the relative expression levels of PpSOD in the two groups remained stable for the first 7 days; however, starting from day 14, the expression level in the treated group increased compared to the control group, and a significant difference was observed after 35 days of storage. This indicates that β-ionone treatment of peach fruit increased the relative expression level of the PpSOD gene, thereby increasing the enzyme activity of SOD. SOD's role is to catalyze O2· - Disproportionation produces H2O2 and O2, and the increased enzyme activity accelerates the O2· - The rate of clearance.
[0097] Figure 4 C showed that there was no significant difference in POD activity between the treated and control groups of peaches during the first 14 days of storage, but the POD activity in the treated group was significantly increased thereafter. Figure 4 D showed that no significant changes in PpPOD gene expression were observed in either group during the first 7 days. However, starting from day 14, the treated peaches consistently exhibited higher expression levels than the control group. This indicates that β-ionone treatment of peaches increased the relative expression of the PpPOD gene, thereby enhancing the enzymatic activity of POD. POD's role includes catalyzing the reaction of H2O2 with electron donors to reduce H2O2 to harmless H2O; its increased enzymatic activity accelerates the rate of H2O2 scavenging.
[0098] Figure 4E showed that CAT activity in both the treatment and control groups gradually decreased during storage; however, significantly higher CAT activity was observed in the peaches of the treatment group starting from day 21 of storage. Figure 4 The F-test showed that there was no significant difference in the relative expression level of the PpCAT gene between the two groups during the first 14 days. However, after 21 days, the relative expression level of the PpCAT gene in the treated group was significantly higher than that in the control group. This indicates that β-ionone treatment of peach fruit increased the relative expression level of the PpCAT gene, thereby increasing the enzymatic activity of CAT. CAT's role is to rapidly decompose H2O2 into H2O and O2; its increased enzymatic activity accelerates the rate of H2O2 scavenging.
[0099] 2. Effects of exogenous β-ionone treatment on the regulation of non-enzymatic systems in postharvest peach fruits
[0100] In addition to maintaining oxidative homeostasis through activated enzyme systems, plants can also utilize non-enzymatic systems. These non-enzymatic systems directly neutralize ROS through ascorbic acid (AsA), glutathione (GSH), and phenolic substances, or scavenge ROS through the AsA-GSH cycle. Therefore, this embodiment first determines whether β-ionone treatment affects the non-enzymatic system by detecting changes in AsA, GSH, and total phenolic content in peach fruits from the β-ionone-treated group and the control group during low-temperature storage.
[0101] (1) Effects of exogenous β-ionone treatment on the content of AsA and GSH in peach fruits
[0102] Peach fruit powder stored in an ultra-low temperature freezer in Example 1 was taken, and the contents of total ascorbic acid (T-AsA), ascorbic acid (AsA), glutathione (GSH), and oxidized glutathione (GSSG) were detected.
[0103] The T-AsA and AsA content detection methods are as follows: Collect approximately 0.02 g of frozen sample and store it in liquid nitrogen for thorough grinding; then, extract the homogenate using 1 mL of 5% (w / v) trichloroacetic acid (TCA); then, centrifuge the extract at 12000 g for 15 minutes at 4°C; then, use the resulting transparent upper layer for AsA quantification. In addition, 0.2 mL of the above transparent upper layer was carefully measured and then mixed with 0.1 mL of 60 mM dithiothreitol; the pH of the mixture was then adjusted to 7-8 with a solution of 2 M Na2HPO4 and 1.2 M NaOH; after reacting at room temperature for 10 minutes, the pH of the mixture was adjusted to 1-2 by adding about 0.1 mL of 20% (w / v) TCA, and 0.2 mL of anhydrous ethanol was added and shaken well; then 0.1 mL of 0.4% phosphate ethanol solution, 0.2 mL of 0.5% o-phenanthroline ethanol solution and 0.1 mL of 0.03% ferric chloride ethanol solution were added sequentially; finally, the solution was reacted at 30 °C for 60 minutes, and the amounts of AsA and T-AsA in 1 mL of the reaction system were measured at OD534.
[0104] The detection methods for GSH and GSSG are as follows: Glutathione (GSH) and oxidized glutathione (GSSG) levels were determined using kits manufactured by Solarbio (Solarbio, Beijing, China).
[0105] The results of T-AsA, AsA, GSH and GSSG content detection are as follows: Figure 6 As shown.
[0106] Figure 6 AB analysis showed that the levels of T-AsA and AsA in peaches from both the treated and control groups peaked early in the storage process and then gradually decreased as storage progressed. However, in contrast, the decline in T-AsA and AsA levels in peaches treated with β-ionone was more gradual during cold storage. After 21 days of storage, the levels of both compounds in the treated group were significantly higher than those in the control group. AsA is one of the most potent non-enzymatic antioxidants in plants and can directly reduce ROS. The increased levels of T-AsA and AsA in peaches treated with β-ionone indicate an enhanced ability to scavenge ROS.
[0107] Figure 6CD analysis showed that the levels of GSH and GSSG in peach fruits of both the treated and control groups typically decreased over time; however, β-ionone treatment significantly mitigated this decline. After 14 days of storage, the GSH level in the treated group remained significantly higher than that in the control group. After 21 days of storage, the mean GSSG level in the treated group was also significantly higher than that in the control group. GSH is also an important non-enzymatic antioxidant in plants and can participate in the direct scavenging of ROS. The increased GSH level in β-ionone-treated peach fruits indicates enhanced ROS scavenging ability. Furthermore, GSSG is the oxidized form of GSH, and the simultaneous increase in both levels may be an indirect manifestation of the efficient activation of the AsA-GSH cycle, suggesting that β-ionone treatment in peach fruits may also affect the AsA-GSH cycle.
[0108] Furthermore, L-galactosyl-1,4-lactone dehydrogenase (GalLDH) is a key enzyme involved in AsA biosynthesis. To further investigate whether β-ionone treatment of peach fruit affects GalLDH enzyme activity by regulating the GalLDH gene, thereby affecting the AsA synthesis content, this experiment also detected the GalLDH enzyme activity of peach fruit powder stored in an ultra-low temperature freezer in Example 1 and detected the relative expression level of the GalLDH gene by real-time PCR (the detection method is the same as in Example 2, and the detection primers are shown in Table 2 below).
[0109] Table 2. Primers for q-PCR detection of relative expression levels of the GalLDH gene
[0110]
[0111] The enzyme activity of GalLDH and the relative expression level of the GalLDH gene, such as Figure 7 As shown in AB. Figure 7 A showed that during storage, the GalLDH enzyme activity in peaches of both the treatment and control groups remained unchanged for the first 7 days. However, starting from day 14, the β-ionone treatment group showed enhanced GalLDH activity, and throughout the subsequent storage period, the GalLDH activity in the treatment group was consistently higher than that in the control group. Figure 7 B showed that there was no significant difference in PpGalLDH gene expression between the treatment group and the control group in the first 7 days. From day 14 onwards, the PpGalLDH gene expression in the treatment group increased significantly. This indicates that β-ionone treatment upregulated the expression level of the PpGalLDH gene in peaches, thereby increasing the activity of GalLDH enzyme. Since GalLDH is a key enzyme involved in AsA biosynthesis, its increased activity enhances the peach fruit's ability to synthesize AsA.
[0112] (2) Effect of exogenous β-ionone treatment on the content of phenolic substances in peach fruit
[0113] Phenolic compounds are ubiquitous secondary metabolites in plants. Studies have shown that they enhance the antioxidant activity of fruits and vegetables by directly scavenging reactive oxygen species (ROS) and help them maintain better color and flavor. Therefore, this experiment investigates whether β-ionone treatment of peach fruits increases their ability to scavenge ROS by increasing the content of phenolic compounds, ultimately improving their resistance to chilling injury.
[0114] The total phenol content of peach fruit powder stored in the ultra-low temperature freezer in Example 1 was tested.
[0115] The method for determining the total phenol content is as follows: 0.5 g of ground plant tissue sample was extracted by ultrasonication at 100% power for 10 minutes in 10 mL of 80% methanol solution, followed by centrifugation at 10000 g for 5 minutes. The total phenol content was then determined using the upper extract. After reacting 0.5 mL of the extraction solution with 2.5 mL of Folin-Ciocalteu reagent, the mixture was added and allowed to stand at room temperature for 2 minutes. Subsequently, 2 mL of 75 g / L Na2CO3 solution was added, and the mixture was reacted in the dark at 50 °C for 5 minutes. The next step was to detect the light absorption of the sample at 760 nm. Finally, a standard curve was plotted using gallic acid as a standard solution, and the total phenol content in the sample was calculated.
[0116] The results of the total phenol content test are as follows: Figure 8 As shown in Figure A, the total phenolic content of peaches in both the treated and control groups generally showed a continuous decreasing trend during low-temperature storage. In contrast, the total phenolic content of the β-ionone-treated group was higher than that of the control group starting at 14 days and remained relatively high throughout the storage process. This indicates that β-ionone treatment increased the total phenolic content of peaches, thereby enhancing their ability to scavenge ROS.
[0117] Polyphenol oxidase (PPO) is a core catalytic enzyme in the metabolism and transformation of phenolic secondary metabolites. It can co-catalyze the oxidation of phenols to produce quinones, which further polymerize into brown polymers, leading to browning of fruits and vegetables. In Example 1, the chilling injury index assessment results showed that β-ionone treatment of peaches alleviated browning after 28 days of storage. Therefore, this experiment further investigated whether β-ionone treatment of peaches affected the enzyme activity of PPO. The specific experimental method was as follows: the enzyme activity of PPO was measured using a kit from Suzhou Kemin Biotechnology Co., Ltd., and the relative expression level of the PPO gene was detected by quantitative real-time PCR (the detection method was the same as in Example 2, and the detection primers are shown in Table 3 below).
[0118] Table 3. Primers for q-PCR detection of relative expression levels of the PPO gene
[0119]
[0120] The enzyme activity of PPO and the relative expression level of the PPO gene, such as Figure 8 As shown in BC. Figure 8 B shows that the PPO activity in both the treatment and control groups gradually increased with storage time; in contrast, the PPO activity in the peaches of the β-ionone treatment group remained stable for the first 7 days, and the increase slowed down from the 14th day; it is worth noting that after 14 days, the PPO activity in the treatment group was always lower than that in the control group. Figure 8 C shows that the expression of the PpPPO gene was downregulated in the β-ionone-treated group starting at storage 14 days. This indicates that β-ionone treatment of peaches reduces PPO enzymatic activity by downregulating PpPPO gene expression, thereby decreasing the catalytic oxidation of phenolic substances to form quinones and ultimately reducing the degree of browning in the peaches. Furthermore, it also reflects that the decreased PPO enzymatic activity leads to a reduction in the amount of phenolic substances catalyzed to form quinones, resulting in an increase in total phenolic content.
[0121] (3) Effects of exogenous β-ionone treatment on peach fruit on the AsA-GSH cycle
[0122] The results of the above experiment (1) showed that the contents of GSH and GSSG in peach fruits treated with β-ionone increased synchronously during low-temperature storage, suggesting that β-ionone treatment of peach fruits also affected the AsA-GSH cycle. The AsA-GSH cycle is a key antioxidant defense mechanism in plants, which plays a core role in scavenging ROS (mainly H2O2) and maintaining intracellular redox homeostasis through the coordinated action of key enzymes (ascorbate peroxidase (APX), monodehydroascorbate reductase (MDHAR), dehydroascorbate reductase (DHAR), and glutathione reductase (GR)).
[0123] Peach fruit powder stored in an ultra-low temperature freezer in Example 1 was used to detect the enzyme activities of APX, GR, MDHAR and DHAR, and the relative expression levels of APX, GR, MDHAR and DHAR genes were detected by real-time PCR (the detection method is the same as in Example 2, and the detection primers are shown in Table 4 below).
[0124] The enzyme activity detection method for APX is as follows: Sample (1g) is prepared using 10mL of 0.1mol / L solution. -1 Homogenize with PBS (pH 7.0) and centrifuge (10000g, 4℃) for 12 minutes, collecting the supernatant; the reaction system consists of 0.2 mL of supernatant and 4.6 mL of 0.1 mol / L PBS. - 1 PBS, 0.1 mL 9 mmol L -1The enzyme was composed of ascorbic acid and 0.1 mL of 3% H2O2; the absorbance of APX was measured at 290 nm; a change in absorbance of 0.01 μL / min was designated as one unit of enzyme activity (U), and the result was expressed as U kg. -1 .
[0125] The enzyme activity detection methods for GR, MDHAR, and DHAR are as follows: Sample (1.0 g) is placed in 3.0 mL of 50 mmol / L... - 1 PBS (pH 7.8, containing 2.0 mmol L) -1 AsA, 0.2 mmol / L -1 EDTA and 2.0g L -1 Grind in PVP, then centrifuge (10000g, 4℃) for 15 minutes and collect the supernatant; add 0.2 mL of the supernatant to 3.0 mL of 100 mmol L. -1 PBS (pH 7.5), 30 μL 3.0 mmol L -1 Nicotinamide adenine dinucleotide phosphate (NADPH) and 0.1 mL 5.0 mmol L -1 The absorbance of GR was measured at 340 nm in a solution of oxidized glutathione (GSSG); 1.7 mL of 50 mmol L-100 solution was added to 0.2 mL of the supernatant. -1 PBS (pH 7.5), 200 μL, 2.0 mmol / L -1 AsA and 100 μL 4.0 mmol L -1 The absorbance of MDHAR was measured at 340 nm in a solution of NADPH; 0.2 mL of the supernatant was added to 1.6 mL of 0.1 mol / L solution. -1 4-Hydroxyethylpiperazine ethanesulfonic acid, 100 μL 20 mmol L -1 Glutathione (GSH) and 100 μL 8.0 mmol L -1 The absorbance of DHAR in docosahexaenoic acid solution was measured at 265 nm; a change in absorbance of 0.01 μL / min was designated as one unit of enzyme activity (U), and the result was expressed as U kg. -1 .
[0126] Table 4. Primers for q-PCR detection of the relative expression levels of key enzyme genes in the AsA-GSH cycle
[0127]
[0128] The results of the detection of MDHAR enzyme activity and PpMDHAR gene relative expression are as follows: Figure 7 CD shown. Figure 7C indicates that the enzyme activity of the treated and control groups of MDHAR did not show any significant difference during the first 14 days of storage; however, substantial changes occurred after 21 days, with the treated peaches exhibiting higher enzyme activity levels compared to the control group. Figure 7 Data showed that the expression of the PpMDHAR gene remained unchanged in both the treatment and control groups during the first 14 days. However, starting from day 21, the expression of the PpMDHAR gene in the treatment group was upregulated compared to the control group. This trend was consistent with the changes in MDHAR enzyme activity, indicating that β-ionone treatment of peach fruit increases MDHAR enzyme activity by upregulating the PpMDHAR gene. MDHAR's role is to reduce the AsA oxidation product MDHA back to AsA using NADPH as an electron donor. In the AsA-GSH cycle, increasing MDHAR enzyme activity can accelerate the reduction of MDHA back to AsA.
[0129] The results of DHAR enzyme activity and relative expression of the PpDHAR gene are as follows: Figure 7 As shown in EF. Figure 7 E showed that there was no significant difference in DHAR activity between the treated and control peaches during the first 21 days of storage; however, the DHAR activity in the treated group increased significantly after 21 days. Figure 7 F showed that no significant changes in PpDHAR gene expression were observed in either the treatment or control groups during the initial 21 days; after 21 days, peaches in the treatment group consistently showed higher PpDHAR gene expression levels than those in the control group. The upregulation of PpDHAR gene expression in the treatment group was consistent with the trend of changes in DHAR enzyme activity, indicating that β-ionone treatment of peaches increases DHAR enzyme activity by upregulating the PpDHAR gene. DHAR's role is to use GSH as an electron donor to reduce DHA back to AsA, while simultaneously oxidizing GSH to GSSG. In the AsA-GSH cycle, increasing DHAR enzyme activity can accelerate the rate of DHA reduction back to AsA and the oxidation of GSH to GSSG.
[0130] The results of the detection of GR enzyme activity and PpGR gene relative expression are as follows: Figure 7 As shown in GH. Figure 7 G indicates that during storage, the GR activity of both the treatment and control groups showed an initial increase followed by a decrease. In the first 14 days of storage, there was no significant difference in GR activity between the two groups, but from day 21 onwards, the GR activity of peaches in the treatment group was higher than that in the control group. Figure 7H showed no significant difference in PpGR gene expression between the treated and control groups during the first 14 days of storage. From day 21 onwards, the relative expression of the PpGR gene in the treated group was significantly higher than that in the control group. The upregulation of PpGR gene expression in the treated group was consistent with the trend of GR enzyme activity changes, indicating that β-ionone treatment of peach fruit increases GR enzyme activity by upregulating the PpGR gene. GR's role is to reduce GSSG back to GSH using NADPH as an electron donor. In the AsA-GSH cycle, increasing GR enzyme activity can accelerate the reduction of GSSG back to GSH.
[0131] The results of APX enzyme activity and relative expression of the PpAPX gene are as follows: Figure 7 As shown in IJ. Figure 7 The results showed that APX activity in peaches from both the treatment and control groups remained relatively stable during storage, but from day 21 of storage onwards, APX activity in the treatment group was significantly higher than that in the control group. Figure 5 J showed that there was no significant difference in PpAPX expression between the treated and control groups during the first 7 days of storage. However, starting from day 14, the expression of the PpAPX gene was upregulated in the treated group. The upregulation of PpAPX gene expression in the treated group was consistent with the trend of APX enzyme activity changes, indicating that β-ionone treatment of peach fruit increases APX enzyme activity by upregulating the PpAPX gene. APX functions by using AsA as an electron donor to reduce H2O2 to H2O and simultaneously oxidize AsA to MDHA. In the AsA-GSH cycle, increasing APX enzyme activity can accelerate the reduction of H2O2 to H2O and the oxidation of AsA to MDHA.
[0132] like Gene name As shown in the yellow box, the most crucial step in the AsA-GSH cycle for removing ROS (mainly H2O2) is that APX uses AsA as an electron donor to reduce H2O from H2O2, while simultaneously oxidizing AsA to MDHA. Other enzymes in the AsA-GSH cycle (MDHAR, DHAR, and GR) only play a supporting role in the regeneration of AsA and GSH. After APX consumes AsA, subsequent reactions involve MDHAR catalyzing the regeneration of MDHA to AsA, DHAR catalyzing the regeneration of DHA (a further oxidation product of MDHA) to AsA, and GSH being oxidized to GSSG, while GR catalyzes the regeneration of GSSG to GSH. The experimental results demonstrate that treatment of peach fruits with β-ionone significantly increases the enzyme activities of APX, MDHAR, DHAR, and GR in the AsA-GSH cycle, thus improving the regeneration efficiency of AsA and GSH, increasing the efficiency of H2O2 removal, and ultimately enhancing the peach fruit's resistance to chilling injury.
[0133] The above experiments show that after β-ionone treatment of peach fruits, compared with the control group, the enzyme activities and relative gene expression of APX, MDHAR, DHAR and GR were significantly increased, ultimately improving the AsA-GSH cycle rate.
[0134] Example 3: Effects of exogenous β-ionone treatment on transcriptional regulation-related genes in peach fruits
[0135] The experimental results of Example 2 showed that exogenous β-ionone treatment of peaches improved their resistance to chilling injury by regulating both the enzyme and non-enzyme systems. Therefore, in this example, transcriptome sequencing was performed on β-ionone-treated and untreated peaches after a period of low-temperature storage. Genes most likely involved in regulating both enzyme and non-enzyme systems were screened from numerous transcriptional regulatory genes showing significant changes in abundance.
[0136] RNA was extracted from powder samples of the treatment and control groups from Example 1 after 14 days of low-temperature storage and reverse transcribed into cDNA, followed by transcriptome sequencing. The 10 transcriptional regulation-related genes with the highest differential expression and abundance compared to the control group are shown in Table 5 below.
[0137] Table 5. Sequencing results of 10 differentially expressed and most abundant transcriptional regulation-related genes.
[0138] CK-14 d_fpkm β-ionone-14 d_fpkm log2(fc) IAA16 GT-2 4.141 74.041 4.16 ERF106 1.757 23.288 3.73 WRKY4 5.044 48.282 3.26 ERF061 5.773 39.5 2.77 TEM1 5.388 33.734 2.65 GT-2 6.413 36.863 2.52 BHLH130 7.86 43.492 2.47 RSS3 5.184 26.033 2.33 Figure 9 3.751 18.267 2.29
[0139] According to the data in Table 5, the IAA16 gene showed the most significant expression difference and the highest expression abundance between the treated and untreated groups. The nucleotide sequence of the IAA16 gene is shown in SEQ ID NO.1.
[0140] Furthermore, powder from each sampling point of peach fruit in the treatment group and control group in Example 1 was collected at low temperature, and the relative expression level of the IAA16 gene in the powder from each sampling point was detected by q-PCR. The primers for the IAA16 gene are shown in Table 6 below.
[0141] Table 6. Primers for q-PCR detection of IAA16 gene
[0142]
[0143] The changes in the relative expression level of the IAA16 gene during low-temperature storage of peaches are as follows: Figure 10 As shown, peaches treated with exogenous β-ionone had significantly higher IAA16 gene expression levels throughout the storage period (0–35 days) compared to the untreated group, with the expression level increasing rapidly from 0 to 14 days and then maintaining a high transcriptional level from 14 to 35 days.
[0144] IAA16, a core member of the Aux / IAA family, is a key transcriptional repressor in the plant auxin signaling pathway. Its involvement in stress resistance signal transduction has been confirmed in Arabidopsis and rice, but its regulatory role in the chilling injury response of peach fruit remains unclear. Based on the experimental results of Example 2, increased expression levels of the IAA16 gene in peach fruit were accompanied by increased activities of SOD, CAT, and POD enzymes, as well as increased contents of ASA, GSH, and total phenolic non-enzymatic antioxidants, and improved efficiency of the ASA-GSH cycle. This indicates a significant positive correlation between the IAA16 gene and chilling injury resistance in peach fruit, suggesting that it may exert its effects by regulating both the enzyme and non-enzyme systems within the antioxidant system.
[0145] Example 4: Regulation of the antioxidant system by transient overexpression or silencing of the IAA16 gene
[0146] In this embodiment, an overexpression vector and an interference vector of the IAA16 gene will be constructed to verify its regulation of the antioxidant system (ascorbic acid (ASA) and glutathione (GSH)).
[0147] 1. Transient overexpression of the IAA16 gene in peach fruit
[0148] Transient expression of the IAA16 gene in peach fruit was performed using pGreenII 62-SK as the plasmid vector. First, the IAA16 gene (its nucleotide sequence is shown in SEQ ID NO.1) was amplified by PCR to construct the IAA16-62-SK plasmid. The amplification template was cDNA extracted from peach fruit RNA and reverse transcribed, and the amplification primers are shown in Table 7. The IAA16-62-SK plasmid was used to prepare an Agrobacterium infection solution (OD600 = 0.8). The Agrobacterium infection solution was injected into peach fruit. After injection, the peach fruit was cultured in an artificial climate chamber for 3 days. After 3 days, the infected portion was cut off, ground in liquid nitrogen, and stored at -80°C. Three biological replicates were set up, with the empty vector pGreenII 62-SK serving as a negative control. The contents of ascorbic acid (ASA and T-ASA), enzyme activities of APX and MDHAR, and relative expression levels of ASA metabolism-related genes (PMM, GMP, GME, GGP, GPP, MIOX4, GALUR, APX-1, APX-2, MDAR5, MDHAR, AO-1, AO-2, and AO2 genes, whose nucleotide sequences are shown in SEQ ID NO. 2–8, 22–24, 19, 9–11) were detected at the injection sites of peach fruits in the experimental and control groups, respectively. The contents of glutathione (GSH) and oxidized glutathione (GSSG), enzyme activities of DR and DHAR, and relative expression levels of GSH metabolism-related genes (GSH1, GSH2, GPX1, DHAR2, and GR genes, whose nucleotide sequences are shown in SEQ ID NO. 12–13, 25, 20–21) were also measured. The relative expression levels of the above ASA metabolism and GSH metabolism-related genes were detected by q-PCR, and the detection primers are shown in Table 8 below.
[0149] Table 7. Primers for IAA16 gene amplification
[0150]
[0151] Table 8. Primers for q-PCR detection of genes related to MT synthesis, ASA metabolism, and GSH metabolism.
[0152]
[0153] The ASA and T-ASA contents after transient overexpression of IAA16 in peach fruit are as follows: Figure 11-12 As shown, compared with the control, peach fruits overexpressing IAA16 showed significantly increased ASA and T-ASA contents; simultaneously, APX enzyme activity was significantly decreased compared with the control group, while MDHAR enzyme activity was significantly increased. The relative expression levels of ASA metabolism-related genes are shown in the figure. Figure 13As shown, the genes PMM, GMP, GME, GGP, GPP, MIOX4, and GALUR were significantly upregulated among ASA synthesis-related genes; the genes APX-1, APX-2, and MDAR5 were significantly downregulated among ASA cycling-related genes, while the MDHAR gene was significantly upregulated; and the genes AO-1, AO-2, and AO2 were significantly downregulated among ASA degradation-related genes. Therefore, overexpression of the IAA16 gene in peach fruit upregulated ASA synthesis-related genes, downregulated ASA degradation-related genes, and regulated ASA cycling-related genes, ultimately upregulating the levels of ASA and T-ASA. Simultaneously, the significant downregulation of APX-1 and APX-2 genes led to a significant decrease in APX enzyme activity, while the significant upregulation of the MDHAR gene led to a significant upregulation of MDHAR enzyme activity, thus regulating the ASA cycle.
[0154] The levels of GSH and GSSG in peach fruit after transient overexpression of IAA16 were as follows: Figure 14 As shown, the expression levels were significantly higher than those in the control group; simultaneously, the enzyme activities of DR and DHAR were significantly higher than those in the control group. The relative expression levels of GSH metabolism-related genes are shown in the figure. Figure 15 As shown, GSH1 and GSH2 genes were significantly upregulated among GSH synthesis-related genes; DHAR2 and GR genes were significantly upregulated among GSH cycling-related genes, while GPX1 was significantly downregulated. This indicates that overexpression of the IAA16 gene in peach fruit upregulated GSH synthesis-related genes, regulated GSH cycling-related genes, and ultimately upregulated GSH levels; simultaneously, the significant upregulation of DHAR2 and GR genes further upregulated the activities of DR and DHAR enzymes, thus accelerating GSH cycling.
[0155] 2. Transient silencing of the IAA16 gene in peach fruit
[0156] The experimental method for silencing the IAA16 gene in peach fruit is the same as the method for overexpressing the IAA16 gene in peach fruit described above, but the vectors used are different. In this experiment, TRV1 and TRV2 were used as vectors. The IAA16 gene fragment (the nucleotide sequence of the IAA16 gene fragment is shown in SEQ ID NO.26) was amplified by PCR and ligated into the TRV2 vector. The amplification primers are shown in Table 9 below.
[0157] Table 9. Primers for the peach fruit gene silencing experiment
[0158]
[0159] The amplified target gene was ligated into the TRV2 vector to obtain TRV2-IAA16. Peach fruits injected with TRV1+TRV2 (mixed ratio 1:1) infection solution served as the negative control group, while peach fruits injected with TRV1+TRV2-IAA16 (mixed ratio 1:1) infection solution served as the experimental group. The contents of ascorbic acid (ASA and T-ASA), enzyme activities of APX and MDHAR, and the relative expression levels of ASA metabolism-related genes (PMM, GMP, GME, GGP, GPP, MIOX4, GALUR, APX-1, APX-2, MDAR5, MDHAR, AO-1, AO-2, and AO2 genes) were detected at the injection sites of peach fruits in the experimental group (parallel detection of three peach fruits with silenced IAA16 gene expression) and the control group. The contents of glutathione (GSH) and oxidized glutathione (GSSG), enzyme activities of DR and DHAR, and the relative expression levels of GSH metabolism-related genes (GSH1, GSH2, GPX1, DHAR2, and GR genes) were also measured. The relative expression levels of the ASA and GSH metabolism-related genes were detected by q-PCR, using primers shown in Table 8 above.
[0160] After transient silencing of IAA16 in peach fruit, the ASA and T-ASA contents are as follows: Figure 16-17 As shown, compared with the control, the ASA and T-ASA contents of peach fruits were significantly decreased; meanwhile, APX enzyme activity was significantly increased compared with the control group, while MDHAR enzyme activity was significantly decreased compared with the control group. The relative expression levels of ASA metabolism-related genes are shown in the figure. Figure 18 As shown, the genes PMM, GMP, GME, GGP, GPP, and GALUR were significantly downregulated among ASA synthesis-related genes; the genes APX-1, APX-2, and MDAR5 were significantly upregulated among ASA cycling-related genes, while the MDHAR gene was significantly downregulated; and the genes AO-1, AO-2, and AO2 were significantly upregulated among ASA degradation-related genes. Therefore, silencing the IAA16 gene in peach fruit downregulated ASA synthesis-related genes and upregulated ASA degradation-related genes, ultimately leading to a decrease in ASA and T-ASA levels. Simultaneously, the significant upregulation of APX-1 and APX-2 genes resulted in a significant increase in APX enzyme activity, while the significant downregulation of the MDHAR gene resulted in a significant decrease in MDHAR enzyme activity, thus regulating the ASA cycle.
[0161] Transient silencing of the IAA16 gene in peach fruit resulted in the following levels of GSH and GSSG: Figure 19 As shown, the expression levels of GSH metabolism-related genes were significantly lower than those of the control group; simultaneously, the enzyme activities of DR and DHAR were significantly lower than those of the control group. The relative expression levels of GSH metabolism-related genes are shown in the figure. Figure 20As shown, GSH1 and GSH2 genes were significantly downregulated among GSH synthesis-related genes; DHAR2 and GR genes were significantly downregulated among GSH cycling-related genes, while GPX1 gene was significantly upregulated. This indicates that transient silencing of the IAA16 gene in peach fruit downregulated GSH synthesis-related genes, regulated GSH cycling-related genes, and ultimately downregulated GSH levels; simultaneously, downregulation of DHAR2 and GR genes slowed down GSH cycling.
[0162] Therefore, the construction of the IAA16 gene interference vector to transiently silence peach fruit verified that overexpression of the IAA16 gene in peach fruit can regulate the content of ASA and GSH and the efficiency of ASA-GSH cycling.
[0163] Example 5: Genetic transformation of peach fruit callus
[0164] The transient transformation experiment described above was affected by unstable gene expression and short-lived effects. Therefore, this experiment further confirmed the regulation of the IAA16 gene by overexpression of the IAA16 gene in the non-enzymatic system (ascorbic acid (ASA), glutathione (GSH), total phenols) and enzyme system (CAT, SOD, POD) of the antioxidant system through a genetic transformation experiment of peach callus.
[0165] In the genetic transformation experiment of peach callus, the IAA16 gene was overexpressed using PRI101 as a vector. A transient overexpression experiment of IAA16-pRI101 was constructed using reference peach fruit. The target gene sequence is shown in SEQ ID NO.1. The primers for amplifying the target gene are shown in Table 10 below.
[0166] Table 10. Primers for genetic transformation of peach callus
[0167]
[0168] The constructed stable expression vector IAA16-pRI101 was transformed into the GV3101 strain.
[0169] The Agrobacterium strains that tested positive by colony PCR were activated and used for genetic transformation of peach callus tissue. The specific method is as follows:
[0170] (1) Preparation of bacterial culture: Inoculate 1 mL of liquid LB medium containing the corresponding antibiotic with the positive strain obtained by colony PCR and incubate at 28℃ and 220 rpm for 12-15 h; inoculate 1 mL of bacterial culture into 50 mL of liquid LB medium containing the corresponding antibiotic and incubate at 28℃ and 220 rpm for 12 h; centrifuge the cultured bacterial culture at 6000 rpm for 8 min to collect the bacteria, retaining only the bacterial precipitate; wash the bacteria with ddH2O at 6000 rpm for 8 min and collect the bacterial cells again, then add MS liquid co-medium (MS 4.43 g L).-1 + 30g of sucrose -1 +6-BA 0.4mg L -1 +2,4-D 1.5mg L -1 + Acetyleugenol 0.1 mmol L -1 pH 6.0), adjust OD 600 =0.8-1.0, incubate at 28℃ and 180rpm for 2-3 hours.
[0171] (2) In a clean bench, use tweezers to crush the fluffy and soft wild-type peach callus and transfer it to the above-mentioned infection solution. Incubate at 28°C and 180 rpm for 30 min. Remove excess infection solution and use sterile filter paper to absorb the residual bacterial solution on the surface of the callus. Then transfer it to a callus propagation medium containing 0.1 mM acetylsuccinone and incubate in the dark at 24°C for 2 days.
[0172] (3) After co-culturing for 2 days, the callus tissue was transferred to a solid propagation medium containing resistance (30 mg / L). -1 Kana+200mg L -1 (Cef), make sure to spread the callus flat on the culture medium, culture it at room temperature in the dark, and observe its growth.
[0173] (4) After new callus grew for about a month, the plants were transferred to a new solid propagation medium containing resistance for propagation. After 2-3 generations of screening, three plants overexpressing the IAA16 gene were identified by qRT-PCR. The content of ascorbic acid (ASA and T-ASA), the enzyme activities of APX and MDHAR, and the relative expression levels of ASA metabolism-related genes (PMM, GMP, GME, GGP, GPP, MIOX4, GALUR, APX-1, APX-2, MDAR5, MDHAR, AO-1, AO-2, and AO2 genes, whose nucleotide sequences are shown in SEQ ID NO. 2-8, 22-24, 19, 9-11) were detected. The content of glutathione (GSH) and oxidized glutathione (GSSG), the enzyme activities of DR and DHAR, and the GSH metabolism-related genes (GSH1, GSH2, GPX1, DHAR2, and GR genes, whose nucleotide sequences are shown in SEQ ID NO. 2-8, 22-24, 19, 9-11) were also detected. The relative expression levels of total phenol content, PPO enzyme activity, and phenol metabolism genes (PAL and PPO genes, whose nucleotide sequences are shown in SEQ ID NO. 14-15) were measured. The relative expression levels of the enzyme activities of the three enzymes in the enzyme system (CAT, SOD, and POD) and their synthesis genes (SOD, POD, and CAT genes, whose nucleotide sequences are shown in SEQ ID NO. 16-18) were measured. The control group was wild-type callus (WT).
[0174] The genetic transformation experiment of peach callus to suppress the expression of the IAA16 gene employed CRISPR-CAS9 editing technology to construct the IAA16-crispr plasmid. The amplification primers for the target gene are shown in Table 11 below, and the sequence of the target gene is shown in SEQ ID NO. 27. The plasmid transformation method and detection data were consistent with the above-described experiment on overexpression of the IAA16 gene in peach callus. The SGRNA sequence results of plants expressing the suppressed IAA16 gene are shown below. Figure 21 As shown.
[0175] Table 11. Primers for genetic transformation of peach callus
[0176]
[0177] The ASA and T-ASA contents of the three plants overexpressing the IAA16 gene are as follows: Figure 22-23 As shown, compared with wild-type (WT), plants overexpressing the IAA16 gene had significantly higher ASA and T-ASA contents; meanwhile, APX enzyme activity was significantly lower than WT, while MDHAR enzyme activity was significantly higher. The relative expression levels of ASA metabolism-related genes in overexpressing plants are shown in the figure below. Figure 24 As shown, among ASA synthesis-related genes, PMM, GMP, GME, GPP, and MIOX4 genes were significantly upregulated, while GGP and GALUR genes were significantly downregulated. Among ASA cycling-related genes, APX-1 and MDAR5 genes were significantly downregulated, while APX-2 and MDHAR genes were significantly upregulated. Among ASA degradation-related genes, AO-1, AO-2, and AO2 genes were all significantly downregulated. The ASA and T-ASA contents of the three plants with suppressed IAA16 gene expression are shown below. Figure 25-26 As shown, compared with WT, plants with suppressed IAA16 gene expression had significantly lower ASA and T-ASA contents; simultaneously, APX enzyme activity was significantly higher than WT, while MDHAR enzyme activity was significantly lower. The relative expression levels of ASA metabolism-related genes in suppressed expression plants are shown in the figure below. Figure 27 As shown, among ASA synthesis-related genes, PMM, GMP, GME, GPP, and MIOX4 genes were significantly downregulated; among ASA circulation-related genes, APX-1 and APX-2 genes were significantly upregulated, while MDAR5 and MDHAR genes were significantly downregulated; among ASA degradation-related genes, AO-1, AO-2, and AO2 genes were all significantly upregulated. Therefore, overexpression of the IAA16 gene in peach callus tissue can upregulate the levels of ASA and T-ASA and regulate the ASA circulation rate.
[0178] The GSH and GSSH contents of the three plants overexpressing the IAA16 gene were as follows: Figure 28As shown, the expression levels of GSH metabolism-related genes in overexpressing plants were significantly increased compared to wild-type (WT); simultaneously, the enzyme activities of DR and DHAR were significantly increased compared to WT. The relative expression levels of GSH metabolism-related genes in overexpressing plants are shown in the figure below. Figure 27 As shown, GSH1 and GSH2 genes were significantly upregulated among GSH synthesis-related genes; DHAR2 and GR genes were significantly upregulated among GSH cycling-related genes, while GPX1 gene was significantly downregulated. The GSH and GSSH contents of the three plants with suppressed IAA16 gene expression are shown in the figure below. Figure 29 As shown, the expression levels of GSH metabolism-related genes in the inhibited expression plants were significantly lower than those in the wild-type (WT) plants; simultaneously, the enzyme activities of DR and DHAR were significantly lower than those in WT. The relative expression levels of GSH metabolism-related genes in the inhibited expression plants are shown in the figure below. Figure 30 As shown, GSH1 and GSH2 genes were significantly downregulated among GSH synthesis-related genes; DHAR2 and GR genes were significantly downregulated among GSH cycling-related genes, while GPX1 gene was significantly upregulated. This indicates that overexpression of the IAA16 gene in peach callus tissue can upregulate GSH levels and accelerate GSH cycling.
[0179] Combining the analysis of the regulation of ASA and GSH cycle-related genes by the IAA16 gene and the transient expression results in Example 4, overexpression of the IAA16 gene significantly downregulated the APX-1 gene, resulting in decreased APX enzyme activity; while significantly upregulated the MDHAR, DHAR2, and GR genes, leading to increased MDHAR, DHAR, and GR enzyme activities. Furthermore, the above analysis shows that upregulating IAA16 gene expression in peach fruit significantly increases ASA content. Therefore, even with decreased APX enzyme activity, high concentrations of ASA can still maintain the APX-catalyzed H2O2 scavenging rate through the "substrate saturation effect." In addition, the decrease in APX enzyme activity is an adaptive regulation; moderately reducing APX activity can reduce the ASA consumption rate. Combined with the high activity of MDHAR and DHAR, this can maintain a "high reserve" state of ASA (ASA is both a substrate for APX and a non-enzymatic antioxidant that directly scavenges ROS).
[0180] The total phenolic content of the three plants overexpressing the IAA16 gene was significantly higher than that of the wild-type (WT). The expression levels of phenolic metabolism-related genes in the overexpressing plants are as follows: Figure 31 As shown, the PAL gene was significantly upregulated among phenol synthesis-related genes, while the PPO gene was significantly downregulated among phenol degradation-related genes. The total phenol content of the three plants with suppressed IAA16 gene expression was significantly lower than that of the wild-type (WT). The expression levels of phenol metabolism-related genes in the suppressed expression plants are shown in the figure below. Figure 32 As shown, the PAL gene was significantly downregulated among phenol synthesis-related genes, while the PPO gene was significantly upregulated among phenol degradation-related genes. This indicates that overexpression of the IAA16 gene in peach callus tissue can upregulate the total phenol content.
[0181] The activities of CAT, SOD, and POD enzymes in the three plants overexpressing the IAA16 gene were significantly increased compared to the wild-type (WT) plants. The expression levels of genes related to the synthesis of these three enzymes in the overexpressing plants are shown below. Figure 33 As shown, the CAT, SOD, and POD genes were all significantly upregulated compared to the wild-type (WT). The enzyme activities of CAT, SOD, and POD in the three plants with suppressed IAA16 gene expression were significantly reduced compared to the wild-type (WT). The expression levels of the genes related to the synthesis of the three enzymes in the suppressed expression plants are shown below. As shown, the expression levels of CAT, SOD, and POD genes were significantly downregulated compared to WT. This indicates that overexpression of the IAA16 gene in peach callus tissue can upregulate the expression levels of the synthetic genes for these three enzymes (CAT, SOD, and POD), thereby increasing their enzyme activity.
[0182] Therefore, in conjunction with this embodiment and Example 4, it is demonstrated that by constructing an overexpression vector for the IAA16 gene, the non-enzymatic system (ascorbic acid (ASA), glutathione (GSH), total phenols) and the enzyme system (CAT, SOD, POD) in the antioxidant system of peach fruit can be regulated, thereby improving the cold damage resistance of peach fruit.
[0183] While the present invention has been disclosed above, it is not limited thereto. Any person skilled in the art can make various modifications and alterations without departing from the spirit and scope of the invention; therefore, the scope of protection of the present invention should be determined by the scope defined in the claims.
[0184] sequence list
[0185] SEQ ID NO.1
[0186] The nucleotide sequence of the IAA16 gene:
[0187] ATGAACATGCCACCGGATGCTGTTGACGATGATGATGTCAGCAAAAGCATGGATTTTAAGGACACTGAGCTCACCTTAGGACTGCCTGGTCGTCCACGACGTTGTTCTTCATCAGCAGCTGATCATTTCTTCGGAGGAATCAAGAGTGGTAGCTGCAGCGTGAAACGGGGGTTCATGGAGACCGTTGATCAGAATATTGGCCTGGAAAGCTTTACCAGCTGCGAGCCACGTAGCCAAATCAAAGTGGATGGGAAGTTGGAAGCTCATTACAACAACTACTCCTCCTCCAGCTCAAGTAGCAGGACAACTACTGCCGTGAAATCCCCAGCTGCAATGGCAAGAGTAGTTGGGTGGCCTCCAGTGAGATCGTTGAGACAGAAGGCGTTGGTGGAGAGCAAGATGAAGAGCAAGAGCACGTATGTAAAAGTGGGTGCAGATGGAGCTCCTTACTTGCGGAAACTAGACTTAGACATGTACAAAAGTTATCAGGAGCTATTGAGAGCCTTAGACCAAATGTTCCCTTCCTTCATTACAAGCGGTAAGTATGTGGAGGATACTACGAGCAACCAGGAGCAGCTTATGAAACCTGCAGTGAAAGGAATGGATGAATATATGGTGATGACATATGAAGACAAGGATGGGGACTGGATGTTAGTTGGAGACGTCCCTTGGAAAATGTTTATAGAATCATGCAAGCGTATTCGGTTGATGAAAAGTTCAGAGGCTGTTGGGATAGCTCCAAGGACGTCTCAGGTTCTGCCACAATGA
[0188] SEQ ID NO.2
[0189] Nucleotide sequence of the PMM gene:
[0190] ATGGCTGTCAGGAAGCCTGGTGTGATTGCCTTGTTTGATGTTGATGGGACTCTCACAGCTCCTAGAAAGGCGGTTACTCCAGAAATGTTGGGGTTCATTCGAGAACTTAGGAAGGCTGTTACAGTGGGAATAGTTGGAGGATCTGACCTTTCTAAGATAACGGAGCAGCTTGGAAGGACAGTTATTGATGACTATGATTATGTATTTTCTGAGAATGGACTTGTGGCTCACAAAGACAGGACACTGATTGGCACCCAGAGCTTGAAGACATTTCTTGGAGAAGAGAAGCTGAAGGAATTTATCAATTTTACACTTCATTATATCGCAGACTTGGACATACCTATAAAGAGGGGTACATTTATAGAGTTCCGAAGTGGGATGCTTAAT
[0191] GTATCACCAATTGGGAGAAACTGTAGCCAAGAAGAAAGGGATGAATTTGAAAGATTTGACAAGGTTCAGAATATAC
[0192] GCCCAAAAATGGTATCCATCCTTCGCGAGAAGTTTGCTCACCTTAACTTGACATTTTCCATAGGAGGACAGATAAGCT
[0193] TTGATGTTTTCCCTCAAGGTTGGGACAAGACATACTGCTTGAGATACCTAGAGAAGTTTCAAGAAATCCATTTCTTTG
[0194] GTGACAAAACTTACAAGGGAGGAAATGACCATGAAATTTATGAATCTGAACGAACCGTAGGTCATACAGTTACCAG
[0195] CCCTGAAGATACAATCAAGCAGTGCAAAGCTCTCTTTCTGAGCCCCTGA
[0196] SEQ ID NO.3
[0197] Nucleotide sequence of the GMP gene:
[0198] ATGAAGGCACTCATTCTTGTTGGAGGTTTTGGAACACGTTTGCGGCCATTGACACTCAGTGTCCCTAAGCCGCTTGT
[0199] TGAATTTGCAAACAAACCCATGATCCTGCATCAGATAGAGGCTCTTAAGGCAATTGGTGTTAGCGAAGTGGTTCTGG
[0200] CGATCAATTACCAACCAGAGGTGATGATGACTTTCCTGAAGGAGTTTGAGACAAAGGTTGGCATCAAGATCACATGC。
[0201] TCACAAGAGACTGAGCCCCTTGGTACTGCTGGACCTCTGGCTCTTGCTAGAGACAAACTGATAGATGATTCTGGCGA
[0202] GCCCTTCTTTGTCCTTAACAGTGATGTTATCAGCGAGTACCCATTTAAGCAAATGATCGAATTCCATAAATCCCATGGA
[0203] GGAGAAGCTTCCATAATGGTGACCAAGGTGGATGAGCCATCGAAATATGGAGTGGTGGTTATGGAAGAATCTACAGG
[0204] GAAAGTTCAGAAATTTGTAGAGAAACCAAAACTGTTTGTTGGTAACAAAATCAATGCTGGAATATACCTGTTGAACC
[0205] CCTCAGTTCTTGATCGAATTGAGCTGAGACCAACTTCAATTGAGAAAGAGGTATTCCCAAATATTGCAGCAGAGAAT
[0206] AAGCTCTTCGCAATGGTCCTTCCAGGGTTTTGGATGGACATTGGGCAACCAAGGGATTATATTACAGGCCTGAGACT
[0207] CTACTTGGACTCATTGAGGAAGAACTCTTCATCTAAGTTGGCCAGAGGCTCCAATGTTGTGGGAAATGTTCTGGTGG
[0208] ATGAGACTGCCAAAATTGGAGAGGGGTGCCTGATTGGACCAGATGTTGCAATTGGTCCGGGTTGCGTTGTTGAGTC
[0209] AGGAGTTAGGCTATCTCGCTGTACAGTAATGCGTGGAGTCCGGATCAAGAAGCATGCTTGCATTTCCGGCAGTATCAT
[0210] CGGATGGCACTCCACAGTTGGACAATGGGCTCGTGTAGAGAACATGACTATCCTCGGAGAAGATGTTCATGTAAGCG
[0211] ATGAAATTTACAGTAATGGAGGTGTGGTTTTGCCCCACAAAGAAATCAAGTCGAGCATTTTGAAGCCAGAAATTGTA
[0212] ATGTAG
[0213] SEQ ID NO.4
[0214] Nucleotide sequence of the GME gene:
[0215] ATGGGGAGTACCGGTGGACATGACTACGGTGCATACACCTATGAGAACCTCGAGAGGGAACCTTATTGGCCTTCAGA
[0216] AAAGCTTCGAATTTCCATTACTGGGGCAGGTGGCTTTATTGCCTCACACATTGCTCGGAGATTGAAGAATGAGGGCC
[0217] ATTACATTATTGCTTCTGATTGGAAGAAGAACGAGCACATGACTGAAGACATGTTCTGTCATGAATTCCATCTCGTTG
[0218] ACCTTAGGGTTATGGATAATTGCTTGAAGGTTACCAAGAATGTTGACCATGTGTTCAACCTCGCTGCCGATATGGGTG
[0219] GGATGGGCTTCATCCAGTCCAACCATTCTGTCATTTTTTACAATAATACTATGATTAGCTTCAACATGGTGGAAGCTGC
[0220] TAGAATCAATGGAGTGAAGAGGTTTTTCTATGCTTCTAGTGCTTGCATTTACCCTGAGTTTAAGCAGCTGGAAACCAA
[0221] TGTGAGCTTGAAGGAGTCTGATGCCTGGCCTGCAGAGCCTCAAGATGCCTATGGCTTAGAGAAGCTTGCAACTGAG
[0222] GAGTTGTGCAAGCACTACACAAAGGACTTTGGAATTGAGTGTCGTATTGGAAGGTTCCATAACATTTATGGTCCTTTT
[0223] GGAACCTGGAAAGGTGGGAGGGAGAAGGCACCTGCTGCTTTTTGCAGAAAGACTCTCACTTCCACTGATAAGTTTG
[0224] AGATGTGGGGAGATGGACTTCAGACTCGATCCTTCACCTTCATCGATGAATGTGTAGAAGGTGTACTTCGGTTGACA
[0225] AAGTCTGACTTCCGTGAGCCAGTGAATATTGGAAGTGACGAGATGGTCAGCATGAATGAGATGGCGGAGATAGTTCT
[0226] TAGCTTTGAGGATAAGAAGCTGCCTATCCAGCACATTCCTGGGCCAGAGGGTGTCCGTGGTCGTAACTCAGACAAC
[0227] ACACTGATTAAAGAGAAACTTGGCTGGGCTCCCACCATGAGGTTGAAGGATGGGTTGAGAATTACATACTTCTGGAT
[0228] CAAGGAACAGATTGAGAAAGAGAAGGCACAAGGCACTGACCTGTCGAATTATGGGTCATCTAAGGTGGTGGGAAC
[0229] CCAAGCCCCAGTTCAACTTGGTTCGCTACGTGCTGCTGATGGCAAAGAATGA
[0230] SEQ ID NO.5
[0231] Nucleotide sequence of GPP gene:
[0232] ATGGCTGAAAATGATTCGCTTGCTCAGCTTCTCGCCTCTGCAGTTGACGCCGCCAAGAAAGCTGGCGAGATAATTCG
[0233] AAAAGGGTTCTACGAGACCAAACATGTGGAGCATAAAAGCCAGGTGGATTTGGTCACAGAAACTGATAAGGCATGT
[0234] GAAGATCTCATATTTAATCATCTCAAGAACCTTTACCCCACACACAAGTTCATTGGGGAAGAAACTACTGCTGCTTGT
[0235] GGTGTAACAGAGCTGACTGACGACCCCACATGGATAGTTGATCCCCTGGATGGAACCACTAACTTTGTGCATGGGTT
[0236] CCCCTTTGTCTGTGTCTCAATTGGTCTTACAATTGGAAAGATTCCAACAGTTGGTGTTGTTTACAATCCAATAATCGAT
[0237] GAGCTTTTTACTGGTGTACGTGGAGGAGGTGCAAAAAGTATCATCTCAGACCGAACTTGTGAAGTCTCTCCTT
[0238] GCAACTGAGGCTGGGACACAACGCGATAAATTAACTGTGGATGCTACTACAAACAGACTAAATAGCTTACTTTTTAA
[0239] GGTGAGATCTCTTCGCATGAGTGGCTCCTGTGCACTGAACCTCTGTGGAATTGCATGTGGGAGGCTTGATCTATTTTG
[0240] TGAACTCGGCTTTGGGGGTCCTTGGGATGTGGCAGGTGGTGCTGTGATTGTTACAGAAGCTGGAGGATCTGTGTATG
[0241] ATCCATCTGGTAAGGAGTTTGACATCACAGCTCAAAGAGTAGCAGCATCAAACCCTTTGCTTAAGGATGCATTTGTT
[0242] GGGGCTTTGCTGGAATCGGAATGA
[0243] SEQ ID NO.6
[0244] Nucleotide sequence of the GGP gene:
[0245] ATGATGTTAAGGATCAAGAGGGTTCCTACTGTAGTTTCGAATTACCAGAAAGATGAGGCGGAAGAGGGTGCTCGCC
[0246] GCGTTGGGGGTTGTGGCCGCAACTGTCTTAATCAATGTTGCATTCCAGGGGCAAAGCTTCCGTTGTATGCTTTCAAG
[0247] AAGCTGACCAAGATTGATGGTGACAAGGAGTTGCCCGGAAGTGAGAAAAGAGAGCCTCCCGTTGACTTTCTTGACT
[0248] CACTGCTTCTTGGGGAGTGGGAAGATCGCATGCAGAGAGGGCTGTTTCGTTATGACGTCACTGCCTGTGAAACCAA
[0249] GGTGATCCCGGGGCAGTTTGGTTTCATAGCCCAGCTGAATGAGGGTCGCCACTTGAAGAAGAGACCAACTGAGTTC
[0250] CGAGTTGATAAGGTCCTCCAGCCCTTTGATGGCAACAAGTTTAACTTCACCAAAGTTGGGCAAGAGGAGGTCCTCT
[0251] TCCAGTTTGAAGCAAGCGAAGATGGTGAAGTTCAGTTTATCCCTAGTGCGCCCATTGAGCCTGAAAATTCGCCCAGT
[0252] GTTGTTGCCATCAATGTCAGTCCAATTGAATATGGACATGTGCTGTTGATTCCTCGTATTCTAGAGCACTTGCCACAA
[0253] AGGATTGACCGTGAAAGCTTCTTGCTTGCACTTCACATGGCCGCCGCAGCAGGGAATCCCTACTTTCGATTGGGTTA
[0254] CAACAGCTTGGGTGCATTTGCTACCATCAATCACCTTCACTTCCAGGCTTACTACTTGGCTGTAACCTTTCCCATTGA
[0255] GAAGGCTCCTACCAAGAAAATCACTGTTTCAGGTGCTGGGGTGAGGGTCTCTGAGCTTCTGAACTATCCCGTCAGA
[0256] GGTCTTGTCTTCGAGGGTGGAAATACTCTGCAAGATTTGTCAAACACTGTCTCTGATGCATGCATATGCCTTCAAGAGAACAACATACCTTACAATGTCCTTATCTCCGACTGTGGAAAGCGGATCTTTCTCCTGCCACAGTGTTATGCTGAGAAACAAGCTCTTGGGGAAGTGAGAGCAGAGCTCCTGGATACTCAGGTGAATCCAGCTGTGTGGGAAATTAGTGGGCATATGGTGTTAAAGAGGAAAAAGGACTATGAAGAGGCGTCTGATGAAAATGCCTGGAAGCTCCTTGCAGAGGTCTCCCTTTCAGAAGAGAGGTTCCAAGAAGTGAATTCTCTTATTTTTGAGGCCATTGCTTCTGATGATAATGGGAATGCAAATTTACTCGAGGATCCGGAAGTTAAGCCCCATTCTCGTGAAGAAGTCGACACCATTAACACAAGCTCCCATGCTGCTATGGTGACTGGGACACAACAATGCCTTGTTCTGCAGTAA
[0257] SEQ ID NO.7
[0258] Nucleotide sequence of the MIOX4 gene:
[0259]
[0260] SEQ ID NO.8
[0261] The nucleotide sequence of the GALUR gene:
[0262] ATGGCAAAGGCAATTCCTGAGGTAATTCTGAGCTGCGGTGACGACATTCTAGCCATTCCAGTGATTGGCATGGGAACTGCATACCCTGCGCCGGATCCAGAAACAGACAAGGCTGCGGTTCTTGAAGCCATTAAAGCCGGCTACCGCCACTTTGACACCGCCTTAGTTTACGGGTCGGAGAAATATCTAGGTCAAGCCATATCCGATGCTGTGCGTCTTGGACTCATCAAGTCCAGGAGTGAGGTGTTCATCACCACCAAGCTTTTTGCCAGCTTTGCTGAGAAGGATCTTGTGGTGCCTGCCCTTAACATGAGTCTAAGGAATCTGCAACTGGAGTACGTGGATATGTACATAATTCATTGGCCCTTCAAATTTGGGGGAGAGGTGAAGAGTATGCCTGTTGCAAAAGAGATGGTGCTACCTCTAGATTTGAAGTCAGTTTGGGGAGGCATGGAAGAGTGCAAGAGACTTGGCCTTGCCAGGGGCATTGGCGTCAGTAATTTCACTTGCAACATGCTTCAGGACCTCCTTTCCATCGCCAAAATCCCTCCCGTCCTCAACCAATTGGAGATGAGCCCCGCTTGGCAGACAAAGAAACTGAATGACTTCTGTAAGGCAAAGGGTATCCATGTTACAGCTTACTCTCCCCTGGGCGGAGCTAACAGTCGAGTAGGAGACGACAGGGTTTTATGCTCAAACATCCTCGAAGACATTGCCAAAGCCAAAGGCAAAACAACTGCTCAGGTATCGTTGAGGTGGGTTTATGAGCAAGGGGTGAGCATGGTAACAAAAAGCAACAACAAGGAAAGAATGAAGCAGAACGTTGACATATTCGATTGGTCGTTGACTGACGAGGAATTGGAAAAGATTAGTCATTTTCCTCAGCGGAAAGCAGTTACCTTTGCCTCAATTGTTGGGCCGCATGATCTAATTGTCGACATTGACGCCCAACTGTGA
[0263] SEQ ID NO.9
[0264] Nucleotide sequence of the AO-1 gene:
[0265]
[0266] SEQ ID NO.10
[0267] Nucleotide sequence of the AO-2 gene:
[0268]
[0269] SEQ ID NO.11
[0270] Nucleotide sequence of the AO2 gene:
[0271]
[0272] SEQ ID NO.12
[0273] The nucleotide sequence of the GSH1 gene:
[0274]
[0275] SEQ ID NO.13
[0276] The nucleotide sequence of the GSH2 gene:
[0277]
[0278] SEQ ID NO.14
[0279] The nucleotide sequence of the PAL gene:
[0280]
[0281] SEQ ID NO.15
[0282] The nucleotide sequence of the PPO gene:
[0283]
[0284] SEQ ID NO.16
[0285] Nucleotide sequence of the SOD gene:
[0286] ATGATAGCCCAAGGTATCTGGGCACACGATCTGGGCACACGGGTCGTTTTTCCCAGGACCGCACCCAGATTCGCACCTACAATATATATTTTATACGCACGCTCTCACCTCACTCAAGTCTTCTCTCACTCTCTCTCTGCCCTCTCCTTTCTCGTCCTCACTCAAGTCCAGCAACACACTTCGATGGCTCTTCGATCTCTCGTGGCCAGGAAATCCCTTGGATTGGGGTTTCAGAGCAAAGCCAAAATCCTCGCCGTAGGTTCTACAGCTCATTCCCGTGGCTTTCAAACCTTCTCGCTTCCCGACCTTCCGTACGACTATGGCGCTCTCGAGCCTGCAATTAGTGGCGAGATCATGCAGCTCCATCACCAGAAGCACCACCAGACTTACGTCACCAACTACAACAAAGCTCTTGAGCAGCTCCACGACGCCATCGCCAAGGGTGATGCTGCTGCTGTTGTTAAATTGCAGAGCGCCATCAAGTTCAATGGCGGAGGTCATGTCAACCACTCGATTTTCTGGAAGAATCTTACTCCTGTTGGTCAAGGAGGTGGTGAGCCCCCTCATGGTTCCCTGGGCTGGGCTATTGACACAAATTTTGGTTCTATGGAAGCATTAGTGCAAAAGATCAATGCAGAAGGCGCTGCTTTGCAGGGTTCTGGATGGGTGTGGCTGGCTCTAGACAAAGAGTTGAAGAAACTTGTGGTTGAAACCACTGCAAATCAGGACCCATTGGTTACCAAAGGACCAACTTTAGTTCCATTGCTTGGTATTGATGTTTGGGAGCATGCGTACTACTTACAGTATAAGAATGTGAGGCCAGATTATCTCAAGAACATATGGAAAGTAATCAACTGGAAGTATGCCAGCGAAGTGTACGAGAAAGAAAGCCCTTG
[0287] SEQ ID NO.17
[0288] The nucleotide sequence of the POD gene:
[0289]
[0290] SEQ ID NO.18
[0291] Nucleotide sequence of the CAT gene:
[0292]
[0293] SEQ ID NO.19
[0294] The nucleotide sequence of the MDHAR gene:
[0295]
[0296] SEQ ID NO.20
[0297] Nucleotide sequence of DHAR2 gene:
[0298] ATGGCTCTTGAGATTGCTGTCAAGGCTGCCGTTGGTGCCCCTGATGTTCTTGGCGACTGCCCTTTCTGCCAAAGGGTTCTTCTAACGTTGGAGGAGAAGAAAGTACCTTACAAGTTTCACCTCATCAGTTTCAGCGACAAACCCAAATGGTTTACCGAAGTGAATCCAGAGGGAAAGGTGCCTGTGGTGAAGTTCGATGACAAATGGGTGGCTGATTCTGATGTGATTGTTGGGATTATTGAGGAAAAATACCCTGAACCTTCTCTCAAAACTCCTCCTGAATTTGCTTCTGTGGGATCAAAGATATTTGGTTCATTCGTGACATTTGTGAAGAGTAAGGATCCCAGTGATGGGTCAGAACAGGCTTTGGTTAATGAGCTGAAGGCATTGGATGAGCATCTTAAGGCGCATGGTCCATATATTGCTGGGGAGAAGATCACTGCCGCAGATCTAAGCTTGGCACCAAAACTGTTCCATCTCAAGGTGGCCCTTGGCCATTTCAAGAAGTGGACTGTTCCTGAAGACTTGACCAGTTACTATAAGTACACTGAGCTGCTTTTCTCAAAGGAATCTTTTGTGAAGACCAAAACTGAAGAGAAATATGTGATTGCCGGCTGGGAGTCGAAGGTCAATCCATGA
[0299] SEQ ID NO.21
[0300] Nucleotide sequence of GR gene:[[ID=IS]] [[ID=IS]]
[0301]
[0302] SEQ ID NO.22
[0303] Nucleotide sequence of the APX-1 gene:
[0304] ATGGGGAAGAGCTACCCTACCGTGAGCGAAGAGTACAAGAAGGCCATCGACAAGGCCAAGAGGAAGCTCAGAGGCTTCATCGCCGAGAAGGCCTGCGCTCCACTCATGCTTCGTATCGCATGGCATTCTGCTGGTACCTACGATTCGAGAACAAAAACCGGAGGCCCATTCGGAACTATGAAGCACGCAGCTGAGCAATCGCACGGGGCCAACGCTGGTCTCGATATCGCTGTCAGGCTCTTGGAGCCCATCAAGCAACAGTTCCCAATTCTCTCTTACGCTGACTTCTATCAGTTGGCTGGTGTTGTTGCTGTTGAGATTACTGGTGGGCCTGATGTCCCCTTCCATCCAGGAAGAGAGGACAAGCCTGAGCCACCTCCAGAAGGCCGTCTTCCTGATGCTACCAAGGGTAATGACCATTTGAGGGATGTCTTTGGCAAAACCATGGGCCTCAGCGACCAGGATATTGTTGCTCTCTCTGGCGGTCACACTCTGGGAAGGTGCCACAAGGAGCGATCTGGATTTGAAGGACCCTGGACTCCCAACCCCCTCATCTTCGACAACTCGTATTTCACGGTGCTCCTGAGTGAAAAGTATGATGGTCTTCTAATGCTTCCAACTGACACTGCCCTTCTGTCTGACCCTGTCTTCCGCCCTCTTGTTGAAAAATATGCTGCGGATGAAGATGCCTTCTTTGCTGATTACGCTGCAGCACACCAGAGGCTTTCTGAGCTTGGGTTTGCTGAGGCCTAASEQ ID NO.23
[0305] Nucleotide sequence of the APX-2 gene:
[0306] ATGGCGAAATGCTACCCGACTGTGAGCGAGGAATATCAGAAGGCAGTGGATAAATGCAAGAGAAAGCTCCGAGGACACATCGCTGAAAAGCACTGCGCTCCTATAATTCTCCGATTAGCATGGCATTCGGCTGGTACCTTCGACGTGCAAAGCAAGACAGGAGGGCCGTTCGGGACCATAAGGCACCCGGAGGAGCTTGCTCATGAAGCAAACAATGGCCTGGATATTGCGGTCAGGCTCTTGGAGCCGATCAAGGAGAAGTTTCCGATTCTCTCATACGCAGATTTCTACCAGTTGGCCGGAGTTGTTGCTGTGGAAATTACAGGGGGGCCTGATGTTCCTTTCCACCCTGGTAGACCGGACAAACAAGAACCGCCACCAGAAGGTCGCTTGCCGGATGGCTCCAAAGGTTCGGATCATTTGAGGGATGTCTTTGGTCACATGGGTCTTAGTGACAAGGATATTGTTGTATTATCCGGTGGACACACATTGGGTAGGTGCCACAAAGAACGTTCTGGATTTGAGGGACCCTGGACAACCAACCCCCTCATTTTTGACAACTCCTATTTCAAGGAACTTTTTAGTGGAGAGAAAGAAGGCCTTATCCAGCTGCCATCAGACAAGGCTCTTCTGGAGGATCCAGTCTTTCGTCCTCTTGTTGAGACCTATGCCGCGGACGAGGACGCTTTCTTTGCGGATTATGCCGAAGCGCATTTGAAACTCTCAGAGCTTGGATTCGCTGATGCCGAGTAA
[0307] SEQ ID NO.24
[0308] Nucleotide sequence of the MDAR5 gene:
[0309]
[0310] SEQ ID NO.25
[0311] Nucleotide sequence of GPX1 gene:
[0312] ATGCTACTCCTTTCGGTGATGGGCGTGGGAATGCATTTGTTGAAATTCACCAACTGGGTCTCTCTCTTCGTTCTGGGTTTTGCTTTCTTGTACTTCTATTACGCCTACCAGTTCTCTTCTTCCCAAATTATGGCTGAAGGAAGTTCCAAATCAATATACGATTTCACAGTCAAGGATATTCATGGTAACGATGTAAAGCTGAGTGAATACGGTGGGAAGGTTCTCCTGATTGTAAATGTTGCTTCCCAATGTGGTTTAACACAATCCAACTACAAGGAATTAAGTGTTTTGTATGAAAAGTACAAAAACAAAGGTTTTGAGATCTTGGCATTTCCTTGCAACCAGTTTGGAGGACAAGAGCCAGGAAACAATGAGGAGATTCAAGAAGTTGCATGCACGAGGTTTAAAGCTGAATTCCCAATCTTTGACAAGATTGAGGTGAATGGGAAGAATGAGGCGCCCCTTTACAAATTCCTGAAATTACAGAAAGGTGGGCTCTTTGGAAATGGCATCAAATGGAACTTTACCAAGTTTTTGGTTAACAAAGAAGGAAAAGTTGTGGAGAGATATGCTCCTGTGACATCACCTCTTAAAATTGAGAAAGACATCCAGAGTCT
[0313] GTTGGAATCTTCTTGA
[0314] SEQ ID NO.26
[0315] Fragment nucleotide sequence of transient silencing interference vector of IAA16 gene:
[0316] ATGAACATGCCACCGGATGCTGTTGACGATGATGATGTCAGCAAAAGCATGGATTTTAAGGACACTGAGCTCACCTTAGGACTGCCTGGTCGTCCACGACGTTGTTCTTCATCAGCAGCTGATCATTTCTTCGGAGGAATCAAGAGTGGTA GCTGCAGCGTGAAACGGGGGTTCATGGAGACCGTTGATCAGAATATTGGCCTGGAAAGCTTTACCAGCTGCGAGCCACGTAGCCAAATCAAAGTGGATGGGAAGTTGGAAGCTCATTACAACAACTACTCCTCCTCCAGCTCAAGTAGCAG
[0317] SEQ ID NO.27
[0318] Fragment nucleotide sequence of the IAA16 gene callus interference vector:
[0319] ATGAACATGCCACCGGATGCTGTTGACGATGATGATGTCAGCAAAAGCATGGATTTTAAGGACACTGAGCTCACCTTAGGACTGCCTGGTCGTCCACGACGTTGTTCTTCATCAGCAGCTGATCATTTCTTCGGAGGAATCAAGAGTGGTAGCTGCAGCGTGAAACGGGGGTTCATGGAGACCGTTGATCAGAATATTGGCCTGGAAAGCTTTACCAGCTGCGAGCCACGTAGCCAAATCAAAGTGGATGGGAAGTTGGAAGCTCATTACAACAACTACTCCTCCTCCAGCTCAAGTAGCAGGACAACTACTGCCGTGAAATCCCCAGCTGCAATGGCAAGAGTAGTTGGGTGGCCTCCAGTGAGATCGTTGAGACAGAAGGCGTTGGTGGAGAGCAAGATGAAGAGCAAGAGCACGTATGTAAAAGTGGGTGCAGATGGAGCTCCTTACTTGCGGAAACTAGACTTAGACATGTACAAAAGTTATCAGGAGCTATTGAGAGCCTTAGACCAAATGTTCCCTTCCTTCATTACAAGCGGTAAGTATGTGGAGGATACTACGAGCAACCAGGAGCAGCTTATGAAACCTGCAGTGAAAGGAATGGATGAATATATGGTGATGACATATGAAGACAAGGATGGGGACTGGATGTTAGTTGGAGACGTCCCTTGGAAAATGTTTATAGAATCATGCAAGCGTATTCGGTTGATGAAAAGTTCAGAGGCTGTTGGGATAGCTCCAAGGACGTCTCAGGTTCTGCCACAATGA
Claims
1. The use of the IAA16 gene in the preparation of agents to improve the cold resistance of peach fruits, characterized in that, The nucleotide sequence of the IAA16 gene is shown in SEQ ID NO.
1.
2. The use as described in claim 1, characterized in that, The cold resistance of peach fruit is improved by increasing the expression of the IAA16 gene; the improvement of cold resistance of peach fruit includes increasing the content of AsA, GSH and phenolic substances, increasing the activity of SOD, CAT and POD, and regulating the ASA-GSH cycle.
3. The use as described in claim 2, characterized in that, Increasing the expression of the IAA16 gene can increase the expression levels of one or more genes among PMM, GMP, GME, and GPP, while decreasing the expression levels of one or more genes among AO-1, AO-2, and AO2, thereby increasing AsA content. Increasing the expression of the IAA16 gene can also increase the expression levels of one or more genes among GSH1 and GSH2, thereby increasing GSH content. Increasing the expression of the IAA16 gene can also increase the expression level of the PAL gene while decreasing the expression level of the PPO gene, thereby increasing phenolic content.
4. The use as described in claim 2, characterized in that, Increasing the expression of the IAA16 gene can increase the expression levels of CAT, SOD, and POD genes, thereby enhancing their activities. Increasing the expression of the IAA16 gene can also increase the expression levels of MDHAR, DHAR2, and GR genes, while decreasing the expression level of the APX-1 gene, thus regulating the ASA-GSH cycle.
5. The use as described in claim 3, characterized in that, The nucleotide sequences of the PMM, GMP, GME, GPP, AO-1, AO-2 and AO2 genes are shown in SEQ ID NO. 2-5 and 9-11, respectively; the nucleotide sequences of the GSH1 and GSH2 genes are shown in SEQ ID NO. 12-13; and the nucleotide sequences of the PAL and PPO genes are shown in SEQ ID NO. 14-15.
6. The use as described in claim 4, characterized in that, The nucleotide sequences of the SOD, POD and CAT genes are shown in SEQ ID NO. 16-18; the nucleotide sequences of the MDHAR, DHAR2, GR and APX-1 genes are shown in SEQ ID NO. 19-22.
7. The use of an IAA16 gene overexpression vector for preparing a formulation to improve the cold resistance of peach fruit, characterized in that, The overexpression vector contains a nucleotide sequence such as SEQ ID NO.
1.
8. A preparation for improving the cold resistance of peach fruit, characterized in that, Including overexpression vectors of the IAA16 gene.
9. The formulation as described in claim 8, characterized in that, The overexpression vector contains a nucleotide sequence such as SEQ ID NO.
1.
10. A method for improving the cold resistance of peach fruit, characterized in that, The method involves applying the preparation as described in any one of claims 8 or 9 to peach fruits.