Application of aluminum-activated malic acid transporter GbALMT12A12 in regulation and control of cotton mature fiber quality

By overexpressing or knocking out the GbALMT12_A12 gene, CRISPR-Cas9 technology was used to regulate the quality of mature cotton fibers, solving the problem of regulating cotton fiber length and breaking strength, and achieving significant improvement in cotton quality.

CN121575002APending Publication Date: 2026-02-27ANYANG INST OF TECH +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202512012158.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-29
Publication Date
2026-02-27

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively regulate the quality of mature cotton fibers, particularly fiber length and breaking strength, and lack key gene regulation methods.

Method used

By overexpressing or knocking out the aluminum-activated malate transporter GbALMT12_A12 gene, gene editing was performed using CRISPR-Cas9 technology to regulate the quality of mature cotton fibers. Cotton genetic engineering was then carried out using expression cassettes or recombinant expression vectors of the GbALMT12_A12 gene, its encoded protein, and promoter.

Benefits of technology

Significantly increasing or decreasing the length and breaking strength of mature cotton fibers provides a theoretical basis and genetic resources, offering new ideas for cotton variety improvement and enabling the cultivation of new cotton varieties with excellent fiber quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121575002A_ABST
    Figure CN121575002A_ABST
Patent Text Reader

Abstract

The invention provides an application of an aluminum-activated malic acid transporter GbALMT12A12 in regulation and control of cotton mature fiber quality, and belongs to the technical field of cotton gene engineering. It is found that the GbALMT12A12 gene can effectively regulate and control the cotton mature fiber quality, an excellent gene resource can be provided for synergistically improving the cotton mature fiber quality through a molecular design breeding technology, a theoretical basis is provided for cotton variety improvement, and the GbALMT12A12 gene can be used for cultivating new cotton varieties with excellent fiber quality.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of cotton genetic engineering technology, and more particularly to an aluminum-activated malate transporter. GbALMT12_A1 Application of 2 genes in regulating the quality of mature cotton fibers. Background Technology

[0002] Cotton is a versatile crop grown globally, providing natural fiber, oil, and other uses. As the world's largest producer and consumer of textiles, my country has consistently ranked first globally in cotton production and planting area for many years, and the cotton industry occupies a vital strategic position in my country's national economy. Mature cotton fiber length and breaking strength are important indicators affecting cotton fiber quality; therefore, identifying key genes related to this phenotype and elucidating the molecular mechanisms is crucial for improving fiber quality. Previous research, through fine mapping and gene cloning analysis of the high-quality terrestrial-marine infiltration line MBI7747, identified the main QTLs controlling fiber strength (…). qFL-A12-2 The candidate gene for the aluminum-activated malate transporter GbALMT12_A12 was studied in cotton. GbALMT12_A12 Genes will enhance our understanding of the genetic regulation mechanisms of fiber quality and provide excellent genetic resources for the synergistic improvement of cotton fiber quality using molecular design breeding techniques. Summary of the Invention

[0003] The purpose of this invention is to provide a GbALMT12_A12 Gene, GbALMT12_A12 Gene-encoded proteins, containing GbALMT12_A12 Genes and GbALMT12_A12 The application of gene promoter expression cassettes or plant recombinant expression vectors containing such expression cassettes in regulating the quality of mature cotton fibers can be used to cultivate new cotton varieties with excellent mature fiber quality.

[0004] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides GbALMT12_A12 Gene, GbALMT12_A12 Gene-encoded proteins, containing GbALMT12_A12 Genes and GbALMT12_A12 The application of gene promoter expression cassettes or plant recombinant expression vectors containing such expression cassettes in regulating the quality of mature cotton fibers. GbALMT12_A12 The nucleotide sequence of the gene is shown in SEQ ID No. 1.

[0005] Preferably, the GbALMT12_A12 The amino acid sequence of the gene-encoded protein is shown in SEQ ID No. 2.

[0006] Preferably, the GbALMT12_A12 The nucleotide sequence of the gene promoter is shown in SEQ ID No. 3.

[0007] Preferably, the quality of the mature cotton fiber is the mature cotton fiber length and breaking strength.

[0008] Preferably, by improving GbALMT12_A12 The expression level of the gene or the activity of the GbALMT12_A12 protein can improve the quality of mature cotton fibers.

[0009] Preferably, the backbone plasmid of the plant recombinant expression vector is pCAMBIA2300.

[0010] Preferred, by knockout GbALMT12_A12 Genes can reduce the quality of mature cotton fibers.

[0011] Preferably, the knockout is performed by gene editing at two editing sites using CRISPR-Cas9 technology.

[0012] Preferably, the nucleotide sequences of the two editing sites are shown in SEQ ID No. 8 and SEQ ID No. 9.

[0013] Beneficial effects: This invention, through the GbALMT12_A12 Protein expression level analysis and phenotypic analysis were performed on the overexpressed and gene-edited materials. The results showed that the quality of mature cotton fibers increased in the overexpressed material, while the quality of mature cotton fibers decreased in the knockout material. This indicates that... GbALMT12_A12 Genes can effectively regulate the quality of mature cotton fibers, providing a theoretical basis and genetic resources for cotton variety improvement. They can be used to cultivate new cotton varieties with superior mature fiber quality. This invention can be used in molecular breeding research to improve cotton fiber quality through hybridization, transgenics, and other methods, providing new insights into the mechanism of cotton fiber development and holding significant importance in the cultivation of superior cotton fiber varieties or in related research. Attached Figure Description

[0014] Figure 1 In Example 1 GhALMT12_A12 Gene structure diagram; Figure 2 This is a diagram showing the domain structure analysis of the GhALMT12_A12 protein in Example 1; Figure 3 In Example 1 GbALMT12_A12 Image showing the identification results of gene overexpression and gene-edited plants; Figure 4 In Example 1 GbALMT12_A12 Comparison of mature cotton fiber length between gene-overexpressing, knockout plants and wild-type plants; Figure 5 In Example 1 GbALMT12_A12Image showing the results of plant tissue-specific staining analysis of the GUS gene promoter. Detailed Implementation

[0015] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0016] Unless otherwise specified, the methods used in the following examples are conventional methods, and the materials and reagents used in the examples are commercially available unless otherwise specified.

[0017] SEQ ID No. 1: SEQ ID No.2: ; SEQ ID No.3:

[0018] Example 1

[0019] I. Cotton Genes GbALMT12_A12 Genomic DNA sequence and cDNA isolation and cloning

[0020] 1. RNA extraction and reverse transcription from cotton fibers 10 days after flowering. Prepare a mortar, clean and dry it, then sterilize it by igniting with an appropriate amount of 95% alcohol. After cooling, pre-cool it with liquid nitrogen. Take cotton fiber tissue from the high-quality land-sea infiltration line MBI7747 10 days after flowering from a -80 ℃ ultra-low temperature freezer, place it in a mortar, add liquid nitrogen, and grind rapidly until thoroughly ground into powder. Use a liquid nitrogen-pre-cooled spatula to transfer the powder into 2 mL liquid nitrogen-pre-cooled centrifuge tubes, and immediately perform RNA extraction. RNA extraction was performed using the RC401 plant total RNA extraction kit from Nanjing Novizan Biotechnology Co., Ltd. The experimental procedure is described in the kit's instruction manual. Reverse transcription was performed using the R412 reverse transcription kit from Nanjing Novizan Biotechnology Co., Ltd. The procedure is described in the kit's instruction manual, yielding total cDNA from the cotton.

[0021] 2. Gene-specific primer loaders with sequences near the restriction sites of pCAMBIA2300 were designed as primers F and R for PCR amplification. Using the above cDNA as a template, PCR amplification was performed using high-fidelity DNA polymerase P521 from Nanjing Novizan Biotechnology Co., Ltd. The primer sequences are shown in Table 1.

[0022] Table 1 Genes GbALMT12_A12 Cloning primers

[0023] 3. After purifying the obtained PCR product using a gel extraction method, it was ligated into the pCAMBIA2300 vector for sequencing. Sequencing results showed that: GbALMT12_A12 The gene has a nucleotide sequence of 1626 nucleotides, as shown in SEQ ID No. 1, and its structure is as follows. Figure 1 As shown; the protein sequence is 541 amino acids, as shown in SEQ ID No. 2, and the structural domains of this protein are as follows. Figure 2 As shown.

[0024] 4. Cotton DNA Extraction. Young, fresh leaves of the high-quality terrestrial-marine infiltration line MBI7747 were taken from a -80℃ ultra-low temperature freezer and placed in a mortar. Liquid nitrogen was added, and the leaves were rapidly ground into powder. The powder was then transferred to pre-cooled 2 mL centrifuge tubes using a liquid nitrogen-cooled spatula. DNA extraction was performed using the DC104 Plant DNA Extraction Kit from Nanjing Novizan Biotechnology Co., Ltd. The experimental procedure is detailed in the kit's instruction manual. Gene-specific primers were designed, with sequences near the GUS restriction site of pCAMBIA3301-GUS used as primers F and R for PCR amplification. Using the extracted DNA as a template, PCR amplification was performed using high-fidelity DNA polymerase P521 from Nanjing Novizan Biotechnology Co., Ltd. The primer sequences are shown in Table 2.

[0025] Table 2 Genes GbALMT12_A12 promoter cloning primers

[0026] 5. After purifying the obtained PCR product using a gel extraction method, it was ligated into the vector pCAMBIA3301-GUS and sequenced. Sequencing results showed that the desired PCR product was obtained. GbALMT12_A12 The promoter fragment 1500 bp upstream of the gene has the nucleotide sequence shown in SEQ ID No. 3.

[0027] two, GbALMT12_A12 Obtaining and phenotypic analysis of transgenic cotton plants

[0028] 1. The correctly sequenced pCAMBIA2300-GbALMT12_A12 plasmid was transformed into Agrobacterium GV3101. The cotton Jin668 was then transformed by our laboratory using the cotton genetic transformation technology system developed by Professor Jin Shuangxia of Huazhong Agricultural University, resulting in 6 cotton overexpression lines.

[0029] 2. Simultaneously, the open reading frame of the GbALMT12_A12 gene was predicted on a gene editing website (http: / / crispr.hzau.edu.cn), and two editing sites (Site 1 / SEQ ID No. 8: GATGATCAGAGAGTATTCCAGGG, Site 2 / SEQ ID No. 9: ATGACGCAAAAGCAGCAAAAGGG) were selected for gene editing vector construction. A vector containing these two editing sites (pGbALMT12_A12-Cas9-S1+S2) was constructed with a 304 bp interval on the genome. After sequencing verification confirmed the vector's correctness, it was introduced into Agrobacterium GV3101 and transformed into cotton Jin668 using cotton genetic transformation technology, resulting in 10 cotton gene mutant lines.

[0030] 3. Identification of transgenic cotton plants with the GbALMT12_A12 gene

[0031] Quantitative fluorescence detection of 6 overexpression lines revealed: gene GbALMT12_A12 The expression levels of the gene were upregulated compared to the control, indicating that the gene was overexpressed. Target detection in 10 knockout transgenic lines revealed deletion or insertion mutations at the target sites, totaling six mutation types, demonstrating that the gene had been effectively edited and its protein function was impaired. Results are as follows... Figure 3 As shown (a: overexpression) GbALMT12_A12 Quantitative fluorescence detection of gene lines, b: GbALMT12_A12 Detection of gene-edited (CRISPR-Cas9) cotton targets. ALMT-OE: GbALMT12_A12 -over expression, ALMT-DK: GbALMT12_A12 -Cas9-S1+S2).

[0032] 4. GbALMT12_A12 Phenotypic analysis of mature cotton fiber quality in genetically modified cotton

[0033] The plant materials are as follows: control group cotton Jin668, GbALMT12_A12 Gene overexpression materials ALMT-OE1, ALMT-OE2, ALMT-OE3, ALMT-OE4, ALMT-OE5, ALMT-OE6 and GbALMT12_A12 Gene-edited cotton varieties: ALMT-DK1, ALMT-DK2, ALMT-DK3, ALMT-DK4, ALMT-DK5, and ALMT-DK6.

[0034] After the cotton matures naturally, the mature seed cotton from the upper part is harvested. Using the same ginning machine, 15g of lint is weighed after ginning for fiber quality testing (length (FL), fiber breaking strength (FS), and micronaire value (FM)) (Cotton Fiber Quality Inspection and Supervision Center (Cotton Research Institute, Chinese Academy of Agricultural Sciences)). The results are shown in Table 3.

[0035] Table 3. Fiber quality performance of transgenic cotton overexpression lines and gene-edited lines.

[0036] Note: ALMT-OE: GbALMT12_A12 -over expression, ALMT-DK: GbALMT12_A12 -Cas9-S1+S2.

[0037] Simultaneously, cotton bolls from the same location that had just opened were collected, and fiber length was analyzed. The results are as follows: Figure 4 As shown in Table 3 and Figure 4(ALMT-OE: GbALMT12_A12 -over expression, ALMT-DK: GbALMT12_A12 As can be seen from the results (Cas9-S1+S2), cotton lines overexpressing this gene showed significantly longer mature cotton fibers and increased breaking strength compared to the control; cotton lines with the gene knocked out showed significantly shorter mature cotton fibers and decreased breaking strength compared to the control. This indicates that this gene is involved in the regulation of cotton fiber length and can significantly increase the length of mature cotton fibers.

[0038] three, GbALMT12_A12 Obtaining and phenotypic analysis of transgenic Arabidopsis plants with gene promoters

[0039] Will GbALMT12_A12 The gene promoter fragment (GbALMT12_A12P1500) was ligated into the vector pCAMBIA3301-GUS. The correctly sequenced pCAMBIA3301-GUS-GbALMT12_A12-P1500 plasmid was transformed into Agrobacterium GV3101. The transgenic Arabidopsis thaliana was then transformed by our laboratory using the flower immersion method, and T3 generation transgenic Arabidopsis thaliana plants were obtained.

[0040] T3 generation seeds were planted in nutrient soil for histochemical staining. Results are as follows: Figure 5 (a: root and rosette leaves, b: stem, c: leaf, d: inflorescence, e: pod) As shown, the epidermal hairs of the Arabidopsis leaves and stems, as well as the flower buds, are all stained blue. This indicates the presence of genes. GbALMT12_A12 The promoter-driven GUS gene is expressed in the epidermal hairs of Arabidopsis leaves, stems, and flower buds. The development mechanism of cotton fibers is similar to that of Arabidopsis epidermal hairs, further suggesting that this gene may affect the development of cotton fiber cells.

[0041] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A kind GbALMT12_A12 Gene, GbALMT12_A12 Gene-encoded proteins, containing GbALMT12_A12 Genes and GbALMT12_A12 The application of gene promoter expression cassettes or plant recombinant expression vectors containing such expression cassettes in regulating the quality of mature cotton fibers, characterized in that... The GbALMT12_A12 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

2. Use according to claim 1, wherein The GbALMT12_A12 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No.

2.

3. The use according to claim 1, wherein The GbALMT12_A12 The nucleotide sequence of the gene promoter is shown in SEQ ID No.

3.

4. The use according to claim 1, wherein The cotton mature fiber quality is cotton mature fiber length and breaking tenacity.

5. The use according to claim 1, wherein By increasing GbALMT12_A12 The expression amount of the gene or the activity of the GbALMT12_A12 protein can improve the quality of mature cotton fibers.

6. The use according to claim 1, wherein The backbone plasmid of the plant recombinant expression vector is pCAMBIA2300.

7. The use according to claim 1, wherein By knocking out GbALMT12_A12 genes can reduce mature cotton fiber quality.

8. Use according to claim 7, wherein the compound is ###0002### The knockout is gene editing on two editing sites by CRISPR-Cas9 technology.

9. Use according to claim 8, wherein the compound is ###0002### The nucleotide sequences of the two editing sites are shown in SEQ ID No. 8 and SEQ ID No. 9.